This document summarizes a student research project that aims to sequence and analyze the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes from two plant species endemic to Puerto Rico: Cyperus alternifolius and Schefflera actinophylla. The student will transform and clone the GAPDH genes from these plants into E. coli, purify and sequence the cloned genes, and perform bioinformatics analysis to compare the sequences to other known GAPDH genes. The GAPDH gene codes for an important enzyme involved in cellular processes like glycolysis and apoptosis. While well-studied in model organisms, the GAPDH genes from many native Puerto Rican plants have yet to be sequenced.

1. PCR Amplification, Cloning, Sequence Determination, and Bioinformatics Analyses of Novel Plant GAPDH Genes from Cyperus alternifolius, Schefflera actinophylla and Tropical Flora Endemic to Puerto RicoLydia E. Cortes, Dr. Michael Rubin. University of Puerto Rico at CayeyBiographical Sketch (CV)Lydia E. CortesEducation and Honors: University of Puerto Rico at CayeyBachelor degree in Natural Sciences, Concentration in BiologyActual GPA 3.90Professional Experience: Investigator in training RISE Program, University of Puerto Rico at CayeyExchange student at UMASS Boston Courses about Caribbean history and culture. Certification on PCR University of North Carolina at Chapel Hill Summer ResearchLeadership AllianceMiller School of Medicine, University of MiamiResearch PlanSpecific AimsThe investigation has four principal aims:Transform and clone Cyperus alternifolius and Schefflera actinophylla GAPDH genes into E. Coli JM109Purify and clone Cyperus alternifolius and Schefflera actinophylla GAPDH genesSequence determination of clones Cyperus alternifolius and Schefflera actinophylla GAPDH genesBioinformatics analysis of Cyperus alternifolius and Schefflera actinophylla GAPDH genesBackground and Significance GAPDH, or glyceraldehyde-3-phosphate dehydrogenase, is a protein coding gene. The product of this gene catalyzes an energy-yielding step in carbohydrate metabolism, catalyzing the sixth step of glycolysis and thus serving to break down glucose for energy and carbon molecules.In addition, GAPDH has recently been implicated with transcription activation, initiation of apoptosis, and Endoplasmic Reticulum to Golgi vesicle shuttling.The enzyme of GAPDH exists as a tetramer of identical chains, each subunit having an active site. The reaction catalyzed by GAPDH is:Glyceraldehyde-3-phosphate+ NAD+ + Pi —>1,3-bisphosphoglycerate+ NADH +H+The GAPDH gene has been found and sequenced in various organisms such as humans and Arabidopsis Thaliana; but other organisms have not been sequenced for this gene. The purpose of this investigation is to sequence the GAPDH gene from various plants endemic to Puerto Rico. The hypothesis is that the two plants studied in this investigation will have some segments with a similar sequence, but other sequences will be different.GAPDH is one of many genes called housekeeping genes. These genes are really important for the scientists since they code for proteins that are expressed at a relatively constant rate.Housekeeping genes provides a reference against which to compare a protein (or RNA) of interest. Lately, research has proven that the proteins coded from GAPDH are not expressed constantly, so some scientists do not consider GAPDH as a housekeeping gene anymore. The role of GAPDH in cell death or apoptosis is the principal factor studied from this gene. According to past research, GAPDH appears to contribute to cell death triggered by a nitric oxidecascade; this is by functioning in the nucleus to stimulate the acetyltransferase activity of p300/CBP, leading to the activation of p53 and proapoptotic gene expression. Burke et al.(1996) postulated that the diseases characterized by the presence of an expanded CAG repeat may share a common metabolic pathogenesis involving GAPDH as a functional component. Observations made by Myers et al. (2002), Li et al. (2004), and other scientist raised the possibilities that the GAPDH genes are Alzheimer disease risk factors, a hypothesis that is consistent with the role of GAPDH in neuronal apoptosis. GAPDH gene has been related with other diseases such as Cancer and Huntington disease. Sequencing and studies of the GAPDH gene have been developing for a long time. Li et al. (2004) located a GAPDHpseudogene on chromosome 12q of the human. Arabidopsis thaliana is a plant studied extensively and used as the control for various research. A. thaliana’s genome has been sequence completely, including the GAPDH gene. The sequence of A. thaliana’s GAPDH gene is presented in figure 1.A. thaliana has eight GAPDH genes, some of them are: GAPC (Cytosolic), GAPCP ( Plastid), GAPA (Chloroplast), GAPB (Chloroplast) and GAPN (Cytosolic, nonphosphorylating). In table 1 is seen the reaction that catalyzes each enzyme.Even when a lot of information is available about the GAPDH gene of various organisms, several other organisms have not been sequenced for the gene. For example, most of the plants native from Puerto Rico have not been sequenced for the GAPDH gene. Cyperus alternifolius and Schefflera actinophylla are the two species of plants studied in this investigation. Cyperus alternifolius (umbrella papyrus or umbrella palm) is a grass-like plant in the very large genus Cyperus of the sedge family, Cyperaceae. The sequences for eight genes of Cyperus alternifolius are present in GenBank, but none of them is the GAPDH gene. Schefflera actinophylla (Brassaia actinophylla) is a tree in the Araliaceae family, and only five genes of this plant have been sequenced. The purpose of this investigation is to sequence the GAPDH gene from the plants Cyperus alternifolius and Schefflera actinophylla. With a wider knowledge about GAPDH variants, it will be possible to study and learn more about the gene. It could be possible to find a way for the GAPDH to still be functional as a housekeeping gene. By sequencing the gene it will be possible too to study its sequence and mutations, information that could be used in future studies.Research Design and MethodsTransform and cloneCyperus alternifolius andSchefflera actinophylla GAPDH genes into E. Coli JM109 For transformation, we pipette 5 microliters of DNA from Cyperus alternifolius and Schefflera actinophylla in a microcentrifuge tube. Then added 50 microliters of JM 109 E. Coli competent bacteria (prepared before) to the tubes. Incubate for 30 minutes in ice. Heated each microcentrifuge tube for 45 seconds at 37 °C. Incubated in ice for two minutes. Added 950 microliters of SOC media to each tube. Incubated for 45 minutes at 37°C, while shaking. Plated 5 microliters of cells in LB Amp agar plates. Took the rest 900 microliters, centrifuged and took out the supernatant. Pipette 50 microliters of media and resuspended. Plated the cells. Incubate at 37 °C overnight. Before the following step, transformed bacterial colonies will need to be grown in liquid culture minipreps. First, we prepared 25 ml of LB Amp broth. Using sterile technique, pipette 18 ml of LB Amp broth into one culture tube. Used a sterile pipette tip to pick a single colony from the LB Amp IPTG plate containing the plated bacteria transformed with the plant gene ligation reaction. Placed the miniprep cultures to grow overnight at 37°C in a shaking incubator. Prepared a 1% agarose gel and electrophoresis running buffer to analyze the plasmid miniprep restriction enzyme digestion. Counted the number of bacterial colonies that grew on the LB Amp IPTG agar plates.Purify and clone Cyperus alternifolius and Schefflera actinophyllaGAPDH genes Added 100 ml of 95–100% ethanol to the Aurum wash solution and mix well. Transfered 1.5 ml of each miniprep culture into one of the appropriately labeled microcentrifuge tubes by pipetting or decanting. Centrifuged the microcentrifuge tubes for 1 minute at top speed (>12,000 x g) to pellet the bacteria. Located the bacterial pellet and removed the supernatant from each tube using a 1,000 µl pipet or a vacuum source, avoiding the pellet. Resuspended the bacterial pellet in each tube in 250 µl of resuspension solution by pipetting up and down or vortexing. Pipette 250 µl of lysis solution into each tube andl mixed by gently inverting 6–8 times. Within 5 minutes of adding lysis solution, pipette 350 µl of neutralization solution into each tube and mixed by gently inverting 6–8 times. Centrifuged the tubes for 5 minutes at top speed in the microcentrifuge. Decanted or pipette supernatant from the centrifuged tubes onto the appropriately labeled column. Centrifuged the columns in the microcentrifuge for 1minute at top speed. Discarded the flow-though from the collection tube and replaced the column in the collection tube. Pipette 750 µl of wash solution onto each column. Centrifuged columns in the capless collection tubes in the microcentrifuge for 1 minute at top speed. Discarded the flow-though from the collection tube. Replaced columns into collection tubes and centrifuged for an additional 1 minute to dry out the column. Transfered each column to the appropriately labeled capped \"
miniprep DNA\"
microcentrifuge tube and pipette 100 µl of elution solution onto the column. Let the elution solution be absorbed into the column for 1–2 minutes. Placed the column in the microcentrifuge tube into the centrifuge. Centrifuged the columns for 2 minutes. Discarded the columns and caped the tubes containing the eluted sample. Stored the miniprep plasmid DNA. For restriction digestion analysis, first prepared a 10x master mix for Bgl II restriction digestion reactions. Prepared digestion reactions by combining 2 µl of the Bgl II master mix and 10 µl of each plasmid DNA in the appropriately labeled microcentrifuge tubes. Added too 6 ul of water and 2 ul of Bgl II enzyme. Mixed the tube components and spin briefly in a microcentrifuge to collect the contents at the bottom of the tube. Incubated the reactions at 37°C for 1 hour. For electrophoresis, added 1 µl of 5x loading dye to each sample. Put a 1% agarose gel in the electrophoresis chamber and added electrophoresis running buffer to just cover the gel. Loaded 20 µl of each sample and 10 µl of the 500 bp molecular weight ruler. Connected the electrophoresis chamber to the power supply and turned on the power. Ran the gel at 70 V for 30 minutes. Sequence determination of clones Cyperus alternifolius andSchefflera actinophyllaGAPDH genes Prepared four sequencing samples for each of your two plasmid minipreps. Combined each plasmid miniprep with each of the four different sequencing primers — two forward primers and two reverse primers — to ensure complete coverage of the insert. In the microcentrifuge tubes, combined 10 μl of the miniprep DNA with 1 μl of sequencing primer. Pipette up and down to mix. Pipette 10 μl of the plasmid/primer mixtures into the assigned wells of the 96-well plate. Sealed the plate using the sealing film. Mailed the plate to the sequencing facility.Bioinformatics analysis of Cyperusalternifolius and Scheffleraactinophylla GAPDH genes Used iFinch for Educators and FinchTV to look at the quality of individual reads and the class’ data as a whole set. Then, use BLAST (blastn) for a preliminary determination of which GAPDH gene was cloned. Assembled sequences into a contig using CAP3, and corrected sequencing errors with FinchTV. Verified which GAPDH gene was cloned using BLAST (blastn) on the contig sequence against the GenBank genomic sequence database. Annotated gene by predicting gene structure (i.e. exon/intron boundaries) and mRNA sequence using BLAST (blastn) against the GenBank mRNA sequence database. Translated the predicted mRNA sequence into protein sequence and verified it with BLAST(blastp).Previous Results Luis Lopez and Dr. Michael Rubin began this investigation by extracting the nucleic acid, doing PCR and electrophoresis of the GAPDH gene from Cyperus alternifolius and Schefflera actinophylla. The results obtained from this investigation are presented in figures 2, 3 and 4. In figure 2 can be seen the isolated genomic DNA and initial PCR of Arabidopsis Thaliana, Cyperus alternifolius and Schefflera actinophylla. According to this results, the GAPDH gene of these three plants were sequenced. In figure 3 is seen the gel of the nested PCR. According to these results, both the purified and unpurified sequences of GAPDH gene from Arabidopsis Thaliana, Cyperus alternifolius and Schefflera actinophylla were obtained. Figure 4 presents the cloning gel. In this gel is seen both the vector and the DNA of Arabidopsis Thaliana, Cyperus alternifolius and Schefflera actinophylla’s GAPDH gene.Results During the transformation protocol, the E.Coli cells transformed were count. The way of knowing which cells were transformed is by growing the cells in an Ampicilline solution. Only the cells transformed with the GAPDH gene were resistant to Ampicilline, this is because the E. Coli cells do not have the sequence for resistance, but the GAPDH gene inserted does. The results obtained were similar to the expected, this is because in the plates grown with a concentration of 900 ul was seen more transformed cells than the ones grown in a 50 ul concentration. This difference was more that a 400 fold. The results are seen in Table 2. In figure 5 is seen the cloning gel. The gel broke, but it was possible to obtained results. According to the gel, the sequences of the GAPDH gene from Cyperus alternifolius and Schefflera actinophylla were obtained. In figure 6 is seen the cloning gel that was performed again. Cyperus alternifoliu’s DNA had a size of 1500 bp and Schefflera actinophylla’s DNA had a size of 1000 bp.Tables and Figures:GACTACGTTGTTGAGTCTACTGGTGTCTTCACTGACAAAGACAAGGCTGCAGCTCACTTGAAGGTTTGTCTTATTTGAATTGGTTATTTTTGTCTTGTAATGATATAAATAGTTTATGTGCTAGAATTTGCTTAGTATCATTCAACTAAATTTGTGACTTGTTGTATTTTCAGGGTGGTGCCAAGAAGGTTGTTATCTCTGCCCCCAGCAAAGACGCTCCAATGTTTGTTGTTGGTGTCAACGAGCACGAATACAAGTCCGACCTTGACATTGTCTCCAACGCTAGCTGCACCACTAACTGCCTTGCTCCCCTTGCCAAGGTAAAATATCTGATATTCTATATGATCAAATTTGACTTTGTATTTCAAGTTGAAGTGACTAATTTCATTTAACGTTCTTTGATTTCATTGTGTAGGTTATCAATGACAGATTTGGAATTGTTGAGGGTCTTATGACTACAGTCCACTCAATCACTGGTAAATTTATCAATCAGTTAGAAGTTTATTACAAACTTGCTTGCCTATAGGTGGAAAATTTGTGATTTAATGGGGTTTGCTTTATGATTTCAGCTACTCAGAAGACTGTTGATGGGCCTTCAATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTCAACATTATTCCCAGCAGCACTGGAGCTGCCAAGGCTGTCGGAAAGGTGCTTCCAGCTCTTAACGGAAAGTTGACTGGAATGTCTTTCCGTGTCCCAACCGTTGATGTCTCAGTTGTTGACCTTACTGTCAGACTCGAGAAAGCTGCTACCTACGATGAAATCAAAAAGGCTATCAAGTAAGCTTTTGAGCAATGACAGATTAAGTTTACTTATATTCCAGTAGTGATCAAATTACTCACCAAGTGTTTTTACCACCAATACATAGGGAGGAATCCGAAGGCAAACTCAAGGGAATCCTTGGATACACCGAGGATGATGTTGTCTCAACTGACTTCGTTGGCGACAACAGGTCGAGCATTTTTGACGCCAAGGCTGGAATTGCATTGAGCGACAAGTTTGTGAAATTGGTGTCATGGTACGACAACGAATGGFig. 1. Sequence of GAPDH gene from Arabidopsis Thaliana. Presenting Initial Primers (in bold) and Nested Primers (underlined). 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17Fig 2. Isolated Genomic DNA and Initial PCR. From left to right: (1)marker, (2) Arabidopsis Thaliana, (3) Cyperus DNA, (4) Schefflera DNA, (5) marker, (6) PCR 1, (7) Negative Control, (8) Arabidopsis gDNA, (9) pGAP, (10) marker, (11) PCR 1, (12) Negative control, (13) Arabidopsis, (14) pGAP, (15) Cyperus DNA, (16) Schefflera DNA, (17) marker 1 2 3 4 5 6 7 8 9 10 11 12 13Fig 3. Nested PCR. From left to right: (1) marker, (2) Negative Control, (3) Unpurified Arabidpsis 1, (4) Purified Arabidpsis 1, (5) Unpurified Arabidopsis 2, (6) Purified Arabidopsis 2, (7) Unpurified pGAP, (8) Purified pGAP, (9) marker, (10) marker, (11) Unpurified and Purified Cyperus DNA, (12) Unpurified and Purified Schefflera DNA 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24Fig 4. Cloning gel. From left to right: (1) and (2) no DNA, (3) pGAP Bacterial product, (4) - (6) pGap restriction digest product, (7)- (10) Arabidopsis PCR, (11) marker, (12)- (17) Cyperus DNA and (18) – (24) Schefflera DNA.1 2 3Fig 5. Cloning gel. (1)Cyperusalternifolius, (2)Scheffleraactinophylla,and (3) marker.1 2 3Fig 6. . Cloning gel. (1)Cyperusalternifolius, (2)Scheffleraactinophylla,and (3) marker.Fig 7. Cloning gelTable 1. GAPDH enzymes and the genes enconding them in Arabidopsis. Enzyme Commission (EC) assigns numbers to all enzymes based on the reactions that they catalyze:• EC 1._._._ designates enzymes that are oxidoreductases.• EC 1.2._._ designates enzymes that act on the aldehyde or oxo group of donors• EC 1.2.1._ designates enzymes specifically with NAD+ or NADP+ as acceptor• EC 1.2.1.12 specifically designates a phosphorylating GAPDH enzymeTable 2.Cells transformed with GAPDH gene.Type of DNANumber of cells in 50 microlitersNumber of cells in 900 microlitersCYPERUS ALTERNIFOLIUS17440SCHEFFLERA ACTINOPHYLLA10560Acknowledgements: I would like to acknowledge Dr. Robert Ross, who helped me choose the plants to be studied in a future.The RISE Students: Mayrim Bernard, Aixa Castro, SheydanisDíaz, Luis López, and Pedro Rodríguez. They extracted the nucleic acid, did PCR and electrophoresis of the GAPDH gene from Cyperusalternifolius and Scheffleraactinophylla.Melisa Medina, Paola Montes and Ana Velazquez, who helped me during the investigation.Dr. Edgar Lleraand Yadira Ortiz who help me when I needed them. RISE Program (R25GM59429) for their founding and materials.Reference:Burke, J. R.; Enghild, J. J.; Martin, M. E.; Jou, Y.-S.; Myers, R. M.; Roses, A. D.; Vance, J. M.; Strittmatter, W. J. :Huntingtin and DRPLA proteins selectively interact with the enzyme GAPDH. Nature Med. 2: 347-350, 1996.PubMedID :8612237Cloning and Sequencing Explorer Series: Curriculum Manual. Biotechnology Explorer. 1-302.Li, Y.; Nowotny, P.; Holmans, P.; Smemo, S.; Kauwe, J. S. K.; Hinrichs, A. L.; Tacey, K.; Doil, L.; van Luchene, R.; Garcia, V.; Rowland, C.; Schrodi, S.; and 20 others :Association of late-onset Alzheimer's disease with genetic variation in multiple members of the GAPD gene family. Proc. Nat. Acad. Sci. 101: 15688-15693, 2004. Note: Erratum: Proc. Nat. Acad. Sci. 103: 6411 only, 2006. PubMedID :15507493Myers, A.; Wavrant De-Vrieze, F.; Holmans, P.; Hamshere, M.; Crook, R.; Compton, D.; Marshall, H.; Meyer, D.; Shears, S.; Booth, J.; Ramic, D.; Knowles, H.; and 16 others :Full genome screen for Alzheimer disease: stage II analysis. Am. J. Med. Genet. 114: 235-244, 2002.PubMedID :11857588Rethore, M.-O.; Junien, C.; Malpuech, G.; Baccichetti, C.; Tenconi, R.; Kaplan, J.-C.;deRomeuf, J.; Lejeune, J. :Localisation du gene de la glyceraldehyde-3-phosphate dehydrogenase (G3PD) sur le segment distal du bras court de chromosome 12. Ann. Genet. 19: 140-142, 1976.PubMedID :1085604