In the detection of Covid-19, the sensitivity is very important for prevention of virus-spreading and aggravation. Here we present a sensitive detection system for Covid-19. I hope, this system contributes to Covid-19 disaster even small degree.
2. Data to support research and public health activities directed at the ongoing SARS-CoV-2 (Wuhan
coronavirus) outbreak. (https://www.ncbi.nlm.nih.gov/genbank/sars-cov-2-seqs/)
Complete genome sequences of 48 virus isolates were registered in the Genbank on February 26, 2020. All the
sequences were downloaded and used to construct detection primer sets for Covid-19.
Genebank RefSeq Gene region collection date Locality
MN908947 NC_045512 complete 1-Dec-19 China
MT019529 complete 23-Dec-19 China: Wuhan
LR757998 complete 26-Dec-19 China: Wuhan
MN996527 complete 30-Dec-19 China: Wuhan
MN996528 complete 30-Dec-19 China: Wuhan
MN996529 complete 30-Dec-19 China: Wuhan
MN996530 complete 30-Dec-19 China: Wuhan
MN996531 complete 30-Dec-19 China: Wuhan
MT019530 complete 30-Dec-19 China: Wuhan
MT019531 complete 30-Dec-19 China: Wuhan
MT019532 complete 30-Dec-19 China: Wuhan
LC522972 complete Jan-20 Japan
LC522973 complete Jan-20 Japan
LC522974 complete Jan-20 Japan
LC522975 complete Jan-20 Japan
LR757996 complete 1-Jan-20 China: Wuhan
MT019533 complete 1-Jan-20 China: Wuhan
MT039890 complete Jan-20 South Korea
MN988668 complete 2-Jan-20 China
MN988669 complete 2-Jan-20 China
LR757995 complete 5-Jan-20 China: Wuhan
MT093631 complete 8-Jan-20 China
MN938384 complete 10-Jan-20 China: Shenzhen
MN975262 complete 11-Jan-20 China
MT072688 complete 13-Jan-20 Nepal
MT049951 complete 17-Jan-20 China: Yunnan
MN985325 complete 19-Jan-20 USA: WA
MT039873 complete 20-Jan-20 China: Hangzhou
MN988713 complete 21-Jan-20 USA: IL
MN994468 complete 22-Jan-20 USA: CA
MN997409 complete 22-Jan-20 USA: AZ
MN994467 complete 23-Jan-20 USA: CA
MT007544 complete 25-Jan-20 Australia: Victoria
MT020880 complete 25-Jan-20 USA: WA
MT020881 complete 25-Jan-20 USA: WA
MT044258 complete 27-Jan-20 USA: CA
MT044257 complete 28-Jan-20 USA: IL
MT027062 complete 29-Jan-20 USA: CA
MT027063 complete 29-Jan-20 USA: CA
MT027064 complete 29-Jan-20 USA: CA
MT039888 complete 29-Jan-20 USA: MA
MT039887 complete 31-Jan-20 USA: WI
MT066175 complete 31-Jan-20 Taiwan
MT066176 complete 5-Feb-20 Taiwan
MT106052 complete 6-Feb-20 USA: CA
MT093571 complete 7-Feb-20 Sweden
MT106053 complete 10-Feb-20 USA: CA
MT106054 complete 11-Feb-20 USA: TX
3. Strategy for construction of the Covid-19 detection
• Survey of conserved sequence among the Covid-19 sequences registered in the Genbank.
• Design the primer sets to produce the PCR product up to 150bp.
• The primer (designated as reverse primer) for reverse transcription from viral RNA to cDNA is
to be added with a Tag sequence.
• In the first process of the Covid-19 detection, RNA is extracted from biological samples and
used as a temperate for reverse transcription.
• In the reverse transcription, viral RNA is transformed to cDNA using the reverse primer and
reverse transcriptase.
• The cDNA thus obtained is subjected to real time PCR using the forward primer and the tag-
primer to measure the amount of cDNA in the samples. The amount of cDNA corresponds
directly to that of viral RNA in the samples.
• The schematic presentation of these processes is shown in the following slide.
4. Schematic presentation of Covid-19 detection
RNA
extraction
Reverse primer
5’ 3’
Tag primer
cDNA
RNA
Tag-sequence
5’3’
Reverse
transcription
Forward primer
Conventional/Real-time
PCR
Tag sequence/primer is designed not to hybridize any of sequences registered in Genbank and not
to form secondary structure.
5. One of conserved sequence regions in all the viral sequences registered in
Genbank
GTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGA
NC_045512 (MN908947: reference genome)
4124 4208
mer Tm GC PCR product
1-3L forward primer GTGGGTGATGTTGTTCAAGAGGGTGT 26 71.6 50.0
85
1-3R reverse primer TCGCTAGCATTTCAGTAGTGCCACCAG 27 73.0 51.9
forward primer reverse primer
Tag
2720..8554
/gene="orf1ab"
/locus_tag="GU280_gp01"
/product="nsp3"
/note="former nsp1; conserved domains are: N-terminal
acidic (Ac), predicted phosphoesterase, papain-like proteinase, Y-domain, transmembrane domain 1 (TM1),
adenosine diphosphate-ribose 1''-phosphatase (ADRP); produced by both pp1a and
pp1ab"/protein_id="YP_009725299.1"
8. All the sequences registered in the Genbank have been examined concerning the homology
with forward/reverse primer sequences. When covid-19 sequences were excluded,
homologous regions to either forward or reverse primer sequences were not found in the
one and same registered sequences.
This fact indicates that no PCR products are produced in the current PCR
9. The findings described in the preceding slides indicate that the detection of Covid-19 RNA is promising.
In order to verify this, partial viral RNA sequence ranging from 4124 and 4208 base position (MN908947:
reference genome) is synthesized and used as positive control for the detection system.
M DW 2000 200 20
500bp
100bp 110bp
[RESULTS] : The current system can detect up to 20 molecules of Covid-19 viral DNA.
M: Molecular marker
DW: Negative control (water)
2000: 2,000 molecules of Covid-19 partial RNA sequence
200: 200 molecules of Covid-19 partial RNA sequence
20: 20 molecules of Covid-19 partial RNA sequence
110bp: The expected signal fragment size of Covid-19
Currently, the detection conditions are being under optimization
10. PCR conditions were optimized to increase detection sensitivity. Also PCR cycles were
increased up to 40.
M: Molecular marker
C1: Negative control (water) for PCR
C2: Negative control (water) for RT-PCR
0: 0 molecules of Covid-19 partial RNA sequence
2: 2 molecules of Covid-19 partial RNA sequence
20: 20 molecules of Covid-19 partial RNA sequence
200:200 molecules of Covid-19 partial RNA sequence
2000: 2,000 molecules of Covid-19 partial RNA sequence
110bp: The expected fragment from Covid-19
PCR cycles:40
RT was performed in the presence of human RNA
M C1 C2 0 2 20 200 2000 M
110bp
Conclusion: This system can detect Covid-19 RNA at a level of more than 2 molecules
Sensitive detection helps prevention of virus spreading and aggravation.