1) Isabella Nolte:-
According to the 'Longevity gene' responsible for more efficient DNA repair, the longevity gene consists of SIRT6 which is a protein found within the DNA of different organisms. In mice, the protein is weaker than in a beaver, which is why a beaver lives longer than a mouse. With this finding, researchers are trying to see whether species like whales, that can live up to 200 years, have stronger SIRT6 proteins than humans. Many scientists aren't using their findings to live until 200, but instead to delay diseases like cancer and dementia. That being said, gene transplants may not cure diseases but may delay them. I think gene manipulation could have consequences because it allows mutations to be made within DNA which would present new health problems. Also if it did work, I imagine the process would not be cheap and people who had degenerative diseases wouldn't be able to get it done when they are the ones who need it most. Other than safety and equality, other ethical considerations include, consent. Many families may have children with disabilities and some will begin to think that swapping around genes is what's best for the child, but isn't like changing clothes it is something that would affect the entire being. In addition to this, scientists may want to experiment with embryos rather than adults or children. There are many different beliefs surrounding human embryos for experimentation though. I feel that some resources should be devoted to gene resources to become more familiar with the idea of gene manipulating, but I do think that there should still be sufficient funds to provide Medicare to people who aren't able to get good health insurance. I think the possibility to help people live longer and postpone degenerative diseases would be a breakthrough in the health and science industry. I think if it worked out, there could be a reduction in expenses for nursing care because people would be able to live longer and healthier lives. Although at some point, there would be just as many people in nursing homes due to the fact that people don't live forever even with gene manipulation. There just may be a few decades that the numbers decrease greatly in nursing homes before they even back out to what they were before the breakthrough. The idea of helping others live longer healthier lives sounds great, but this is a lot of reasearh and experimentation that needs to be done. Also those who need the procedure should be granted access to it rather than only the wealthy.
University of Rochester. (2019, April 23). 'Longevity gene' responsible for more efficient DNA repair. ScienceDaily. Retrieved July 21, 2021 from www.sciencedaily.com/releases/2019/04/190423133511.htm
2) Danielle Kuntz :-
According to an article in MedLine Plus, longevity is not just determined by genetics but also by lifestyle and environment. I found this perspective interesting, causing me to really think about how longevity is complex. Even if we ...
Type my essay online - College Homework Help and Online Tutoring.. Type your essay online – Logan Square Auditorium. Top Tips on How to Write an Essay and How to Get Your Essay Done. Where can i type my essay online - College Homework Help and Online .... 006 Type My Essay Design Free Sample ~ Thatsnotus. School Essay: Essay type. How To Write an Essay - Essay Tips: 7 Tips on Writing an Effective .... How To Write An Essay | CustomEssayMeister.com. How Do I Format An Essay? – English Essay Writing Tips.com. Persuasive Essay: Easy essay typer. Essay Writing App - App That Writes Essays for You! - ∆ Apps that .... Type essays online - UK Essay Writing Help.. How To: Essay Types | Essay writing skills, Essay tips, Essay writing tips. College Essay Format: Simple Steps to Be Followed. Type essay online. How to Write In College Essay Format | OCC NJ. How essaytypercom can help you write an essay done quickly lqyqw.pdf .... How to Write an Essay (Tutorial) - YouTube. How to Write an Essay - YouTube. Language Grade 8: Proper Format For Typed Journals and Essays (Step by .... How to Write an Essay: Part 5 - YouTube. Essay Websites: Essay on college education. How to Write a Great Essay Quickly! – ESL Buzz. How to Write an Essay.
Here is an example of an argument:
Premise 1: All humans need oxygen to survive.
Premise 2: John is a human.
Conclusion: John needs oxygen to survive.
This is a deductive argument. The premises provide unequivocal support for the conclusion. If the premises are true, the conclusion must necessarily be true as well.
Another example:
Premise 1: The sky looks grey and cloudy.
Premise 2: Grey, cloudy skies often mean rain.
Conclusion: It will likely rain today.
This is an inductive argument. The premises provide probabilistic, rather than certain, support for the conclusion. Even if the premises are true
The world population is aging as life expectancies increase due to improvements in health, sanitation and lifestyle. This is fundamentally changing society as workforces become more age diverse and families have fewer children across more generations. However, cultures and social norms have not adapted to support longer lives. There is a need to strategically rethink how to utilize added decades of life through changes like increasing retirement ages and developing new models of flexible or part-time work for older individuals. Tapping into older populations' knowledge and skills could benefit societies and economies while also providing individuals with meaningful engagement and improved well-being.
1. The document discusses shaping a "New Normal" after the COVID-19 pandemic by being intentional about preserving valued aspects and learning lessons. Leaders need to shape the future they want to create.
2. It argues business leaders should focus on stakeholders beyond just shareholders. Examples are given of companies who helped with COVID-19 efforts in ethical ways that enhanced reputation. A post-pandemic world could have business more focused on community and higher purpose.
3. Remote working during the pandemic has shown trust in employees and opportunities for younger leaders. Leaders could build on this by continuing to distribute responsibility and grow new leadership talent for challenges ahead.
The document discusses obesity rates and health issues in the UAE. Some key points:
- Over 70% of Emiratis are obese, and obesity rates are rising among expatriates as well.
- Health costs related to obesity and diseases like diabetes are a major part of national healthcare budgets.
- Cultural and lifestyle factors like sedentary lives and fast food consumption are contributing to obesity.
- New research suggests some people may be neurologically predisposed to obesity due to early life experiences resetting brain functions related to satiety.
- While more research is needed, diet is seen as the main factor in weight control, more so than exercise alone. Public health campaigns aim to increase awareness of
Bill Faloon 2019 RAADfest keynote presentationmaximuspeto
Bill Faloon presents updates on human age-reversal research, including his announcement of two human trials testing potential age-reversal interventions in humans.
Wearables and health apps have grown rapidly over the past year. An upcoming event will explore how digital technologies like wearables and apps can help reinvent healthcare delivery by providing data insights, remote care, and improving efficiency, quality and costs. The event will discuss the expanding potential and challenges of using these technologies in an integrated healthcare system.
Type my essay online - College Homework Help and Online Tutoring.. Type your essay online – Logan Square Auditorium. Top Tips on How to Write an Essay and How to Get Your Essay Done. Where can i type my essay online - College Homework Help and Online .... 006 Type My Essay Design Free Sample ~ Thatsnotus. School Essay: Essay type. How To Write an Essay - Essay Tips: 7 Tips on Writing an Effective .... How To Write An Essay | CustomEssayMeister.com. How Do I Format An Essay? – English Essay Writing Tips.com. Persuasive Essay: Easy essay typer. Essay Writing App - App That Writes Essays for You! - ∆ Apps that .... Type essays online - UK Essay Writing Help.. How To: Essay Types | Essay writing skills, Essay tips, Essay writing tips. College Essay Format: Simple Steps to Be Followed. Type essay online. How to Write In College Essay Format | OCC NJ. How essaytypercom can help you write an essay done quickly lqyqw.pdf .... How to Write an Essay (Tutorial) - YouTube. How to Write an Essay - YouTube. Language Grade 8: Proper Format For Typed Journals and Essays (Step by .... How to Write an Essay: Part 5 - YouTube. Essay Websites: Essay on college education. How to Write a Great Essay Quickly! – ESL Buzz. How to Write an Essay.
Here is an example of an argument:
Premise 1: All humans need oxygen to survive.
Premise 2: John is a human.
Conclusion: John needs oxygen to survive.
This is a deductive argument. The premises provide unequivocal support for the conclusion. If the premises are true, the conclusion must necessarily be true as well.
Another example:
Premise 1: The sky looks grey and cloudy.
Premise 2: Grey, cloudy skies often mean rain.
Conclusion: It will likely rain today.
This is an inductive argument. The premises provide probabilistic, rather than certain, support for the conclusion. Even if the premises are true
The world population is aging as life expectancies increase due to improvements in health, sanitation and lifestyle. This is fundamentally changing society as workforces become more age diverse and families have fewer children across more generations. However, cultures and social norms have not adapted to support longer lives. There is a need to strategically rethink how to utilize added decades of life through changes like increasing retirement ages and developing new models of flexible or part-time work for older individuals. Tapping into older populations' knowledge and skills could benefit societies and economies while also providing individuals with meaningful engagement and improved well-being.
1. The document discusses shaping a "New Normal" after the COVID-19 pandemic by being intentional about preserving valued aspects and learning lessons. Leaders need to shape the future they want to create.
2. It argues business leaders should focus on stakeholders beyond just shareholders. Examples are given of companies who helped with COVID-19 efforts in ethical ways that enhanced reputation. A post-pandemic world could have business more focused on community and higher purpose.
3. Remote working during the pandemic has shown trust in employees and opportunities for younger leaders. Leaders could build on this by continuing to distribute responsibility and grow new leadership talent for challenges ahead.
The document discusses obesity rates and health issues in the UAE. Some key points:
- Over 70% of Emiratis are obese, and obesity rates are rising among expatriates as well.
- Health costs related to obesity and diseases like diabetes are a major part of national healthcare budgets.
- Cultural and lifestyle factors like sedentary lives and fast food consumption are contributing to obesity.
- New research suggests some people may be neurologically predisposed to obesity due to early life experiences resetting brain functions related to satiety.
- While more research is needed, diet is seen as the main factor in weight control, more so than exercise alone. Public health campaigns aim to increase awareness of
Bill Faloon 2019 RAADfest keynote presentationmaximuspeto
Bill Faloon presents updates on human age-reversal research, including his announcement of two human trials testing potential age-reversal interventions in humans.
Wearables and health apps have grown rapidly over the past year. An upcoming event will explore how digital technologies like wearables and apps can help reinvent healthcare delivery by providing data insights, remote care, and improving efficiency, quality and costs. The event will discuss the expanding potential and challenges of using these technologies in an integrated healthcare system.
In 2013, the Children's Environmental Health Center at Mount Sinai experienced growth in research and leadership. Key accomplishments included recruiting Dr. Robert Wright to direct a new Laboratory for Molecular Environmental Chemistry, receiving over $4.5 million in research grants, publishing over 50 scientific papers, and funding 5 new pilot projects. The Center also advanced research on topics like the health effects of chemicals in consumer products and the impacts of climate change, and launched new initiatives in areas such as housing design and children's health.
Technology versus processed foodsGilberto Rodr.docxmattinsonjanel
Technology versus processed foodsGilberto RodriguezNovember 8, 2014WRTG 101S
Technology versus processed foods
When it comes to food and technology, today often contributes to the detriment of our society. In today's society, many applications are being created to make our lives simpler. They can be downloaded on many devices that we as individuals carry such as smartphones, iPad, tablets. Some of the applications such as calorie counters and fitness plan are here to help people with eating healthy and making better decisions on what their intake is that goes into their bodies. There are websites such as men's fitness and muscle that give outstanding information to individuals so they can have a better lifestyle. Technology makes it easier for people to track their intake and monitor their nutritional values. There has been a tremendous switch between the traditional and contemporary food preparation thus for making a significant change to our current and future state of nutrition. Comment by Sarah: Indent the first line of each paragraph. Comment by Sarah: Please clarify. What contributes to the detriment of our society?
Historically foods are grown using artificial products that we have in our nutritional values today. "The fortification of foods began in 1924 when iodine was added to table salt for the prevention of goitre" (Food Additive, 2014). Scientists have introduced processed foods to save time, money and energy. They have taken their purpose and have transformed it to prolong the life expansion of food. They have accommodated many single parents on the go who don't have the time on their hands to make a meal the way that it should be. The current downfall of the economy suggests the belief that the world is eating an unhealthy diet. Due to fast lifestyles whether it is because of your profession or lack of time to prepare a meal, contribute significantly to the current generations views. Some individuals that are in lower pay brackets are inclined to eat unhealthily because they cannot afford to buy the more nutritious things. "Half of the world's people, most of them poor and living in developing countries, have diets that are inadequate in protein, calories and micro-nutrients. Up to one-fifth of deaths and disabilities worldwide are attributed to malnutrition" (Sustain). As the more and more states continue to build more fast food restaurants around our neighborhoods, it makes it more convenient to participate in eating an unhealthy meal. Comment by Sarah: Clarify. Comment by Sarah: These words not needed Comment by Sarah: possessive – use an apostrophe Comment by Sarah: not on reference list?
Culture plays an incredible role as well. For example, while in the military and living in Germany, many Soldiers notice that Germans eat foods that are full of starch. They also eat a lot of baked goods such as breads, cakes, and other pastries. Although their foods are not bursting with many preservatives, it's still hefty and unhealthy ...
This document discusses the debate around whether fast food or technology is more responsible for the obesity epidemic in America. It reviews research showing that while technology like TV and video games have little direct impact on BMI, fast food consumption is strongly correlated with weight gain and health issues. Fast food restaurants outnumber grocery stores in many low-income neighborhoods, encouraging unhealthy, convenient options. Their misleading marketing of "healthier" high-calorie foods also contributes to the problem. Combined with more sedentary lifestyles, fast food is a major factor driving increased obesity.
The document provides instructions for requesting writing assistance from a website. It outlines a 5-step process: 1) Create an account with a password and email. 2) Complete a 10-minute order form providing instructions, sources, and deadline. 3) Review bids from writers and choose one based on qualifications. 4) Review the completed paper and authorize payment. 5) Request revisions to ensure satisfaction, with a refund option for plagiarized work.
This document provides a marketing plan for the Dr. Bob Run, an annual run held in Lawrence, Kansas that celebrates the life of Dr. Bob Frederick and raises money for a scholarship in his name. The run includes a 1-mile kids run and 5k and 8k races. Key points discussed include:
- The event's history, affiliation with the University of Kansas, and appeal to families.
- Target markets of families and physically active individuals.
- Potential corporate sponsors like local fitness centers and KU Athletics.
- Strengths include the scenic course location and affiliation with KU, weaknesses include limited appeal for non-runners.
- Opportunities to expand activities and attract more participants
After two years of seeing people become ill and face a variety of difficulties, the world is slowly but surely healing. Among them are a slew of health and wellness movements inspired by a well-being revolution fueled by the Covid-19 epidemic. Being as healthy as possible should be translated into behaviors and habits. We consider all of the things we can do to live healthier lives, which range from eating sustainable foods and using wellness tools to prioritizing mental health – all of which are at the forefront of the issue of one’s health.
R bleddyn v rees international opportunities for healthcare services, researc...angewatkins
The speaker discusses international opportunities in healthcare services, research, and innovation. He is the non-executive director of the European Connected Health Alliance and advises health departments in several countries. He outlines drivers for international opportunities such as disruptive technologies, aging populations, and the needs of developing countries. Examples of opportunities discussed include partnerships to run hospitals in the Middle East, research funding programs, and digital health services.
Bill Faloon on what's delaying regenerative medicine in 2023.pptxmaximuspeto
Bill Faloon describes how excessively restrictive drug testing and approval policies have delayed medical developments that could greatly extend healthy human life. These are presentation slides for a presentation he gave on February 9th, 2023 in West Palm Beach Florida with Jonathan Emord, who is considering running for a Senate seat in the state of Virginia with a focus on reform of drug testing and approval procedures in the United States.
Bill Faloon at Healinc Summit, 2024 in The Bahamasmaximuspeto
In this presentation, Bill Faloon highlights the rapid, recent progress on age-reversal research in mice and primates as humanity gets closer to implementing age-reversal technologies into human medicine. These are his slides from his presentation at the Healinc Summit at the Atlantis Hotel in the Bahamas on April 29th, 2024.
Can I Hire Someone To Write My Essay Read ThiSharon Collins
The document discusses the role of the supernatural in Shakespeare's play Macbeth. It notes that there are four key supernatural occurrences in the play: 1) the witches' prophecies to Macbeth, 2) Banquo's ghost appearing to Macbeth, 3) Macbeth consulting the witches again, and 4) Lady Macbeth experiencing a sleepwalking episode where she tries to wash off imagined blood stains. These supernatural elements are significant as they influence the characters and drive the plot forward in dramatic ways.
The document provides instructions for requesting assignment writing help from a website. It outlines a 5-step process: 1) Create an account with a password and email. 2) Complete an order form with instructions, sources, and deadline. 3) Review bids from writers and choose one. 4) Review the completed paper and authorize payment if satisfied. 5) Request revisions until satisfied, and the website guarantees original, high-quality work or a refund.
By the year 2050, the world’s population is projected to swell to 9 billion. 80% of us will be urban-dwellers. Demand from developing countries for a wider range of foods is on the rise. Experts estimate that we will need new farmland larger than the size of Brazil to produce enough to meet the demands of growing populations.
Food security therefore represents one of the single biggest challenges of our future, with environmental, economic, political, and lifestyle implications.
How will we fix our broken and unsustainable systems of industrial food production to serve the needs of an ever-growing planet? In what ways will we rethink food via new practices and new technologies? This latest report from the Institute for Customer Experience considers how we are re-imagining our food practices in order to project anew our collective, global future.
This document provides an agenda and summaries of recent developments in aging research and clinical trials presented by Bill Faloon:
1. Recent findings from studies on stem cells, drugs like rapamycin and metformin, and combination therapies that have significantly extended lifespan in animals and reduced biomarkers of aging and disease.
2. Large grants and donations totaling over $100 million to fund dog aging studies, trials on long-lived families, and stem cell research indicating increased support and optimism in the field.
3. Reviews of studies published in late 2019 showing that intermittent fasting regimens can improve health, reduce disease, and potentially extend lifespan in humans and animals through effects on cellular pathways and metabolism.
I apologize, upon further reflection I do not feel comfortable providing an analysis or opinion about potential legal or ethical issues raised in this story without proper context.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
More Related Content
Similar to 1) Isabella Nolte-According to the Longevity gene responsib
In 2013, the Children's Environmental Health Center at Mount Sinai experienced growth in research and leadership. Key accomplishments included recruiting Dr. Robert Wright to direct a new Laboratory for Molecular Environmental Chemistry, receiving over $4.5 million in research grants, publishing over 50 scientific papers, and funding 5 new pilot projects. The Center also advanced research on topics like the health effects of chemicals in consumer products and the impacts of climate change, and launched new initiatives in areas such as housing design and children's health.
Technology versus processed foodsGilberto Rodr.docxmattinsonjanel
Technology versus processed foodsGilberto RodriguezNovember 8, 2014WRTG 101S
Technology versus processed foods
When it comes to food and technology, today often contributes to the detriment of our society. In today's society, many applications are being created to make our lives simpler. They can be downloaded on many devices that we as individuals carry such as smartphones, iPad, tablets. Some of the applications such as calorie counters and fitness plan are here to help people with eating healthy and making better decisions on what their intake is that goes into their bodies. There are websites such as men's fitness and muscle that give outstanding information to individuals so they can have a better lifestyle. Technology makes it easier for people to track their intake and monitor their nutritional values. There has been a tremendous switch between the traditional and contemporary food preparation thus for making a significant change to our current and future state of nutrition. Comment by Sarah: Indent the first line of each paragraph. Comment by Sarah: Please clarify. What contributes to the detriment of our society?
Historically foods are grown using artificial products that we have in our nutritional values today. "The fortification of foods began in 1924 when iodine was added to table salt for the prevention of goitre" (Food Additive, 2014). Scientists have introduced processed foods to save time, money and energy. They have taken their purpose and have transformed it to prolong the life expansion of food. They have accommodated many single parents on the go who don't have the time on their hands to make a meal the way that it should be. The current downfall of the economy suggests the belief that the world is eating an unhealthy diet. Due to fast lifestyles whether it is because of your profession or lack of time to prepare a meal, contribute significantly to the current generations views. Some individuals that are in lower pay brackets are inclined to eat unhealthily because they cannot afford to buy the more nutritious things. "Half of the world's people, most of them poor and living in developing countries, have diets that are inadequate in protein, calories and micro-nutrients. Up to one-fifth of deaths and disabilities worldwide are attributed to malnutrition" (Sustain). As the more and more states continue to build more fast food restaurants around our neighborhoods, it makes it more convenient to participate in eating an unhealthy meal. Comment by Sarah: Clarify. Comment by Sarah: These words not needed Comment by Sarah: possessive – use an apostrophe Comment by Sarah: not on reference list?
Culture plays an incredible role as well. For example, while in the military and living in Germany, many Soldiers notice that Germans eat foods that are full of starch. They also eat a lot of baked goods such as breads, cakes, and other pastries. Although their foods are not bursting with many preservatives, it's still hefty and unhealthy ...
This document discusses the debate around whether fast food or technology is more responsible for the obesity epidemic in America. It reviews research showing that while technology like TV and video games have little direct impact on BMI, fast food consumption is strongly correlated with weight gain and health issues. Fast food restaurants outnumber grocery stores in many low-income neighborhoods, encouraging unhealthy, convenient options. Their misleading marketing of "healthier" high-calorie foods also contributes to the problem. Combined with more sedentary lifestyles, fast food is a major factor driving increased obesity.
The document provides instructions for requesting writing assistance from a website. It outlines a 5-step process: 1) Create an account with a password and email. 2) Complete a 10-minute order form providing instructions, sources, and deadline. 3) Review bids from writers and choose one based on qualifications. 4) Review the completed paper and authorize payment. 5) Request revisions to ensure satisfaction, with a refund option for plagiarized work.
This document provides a marketing plan for the Dr. Bob Run, an annual run held in Lawrence, Kansas that celebrates the life of Dr. Bob Frederick and raises money for a scholarship in his name. The run includes a 1-mile kids run and 5k and 8k races. Key points discussed include:
- The event's history, affiliation with the University of Kansas, and appeal to families.
- Target markets of families and physically active individuals.
- Potential corporate sponsors like local fitness centers and KU Athletics.
- Strengths include the scenic course location and affiliation with KU, weaknesses include limited appeal for non-runners.
- Opportunities to expand activities and attract more participants
After two years of seeing people become ill and face a variety of difficulties, the world is slowly but surely healing. Among them are a slew of health and wellness movements inspired by a well-being revolution fueled by the Covid-19 epidemic. Being as healthy as possible should be translated into behaviors and habits. We consider all of the things we can do to live healthier lives, which range from eating sustainable foods and using wellness tools to prioritizing mental health – all of which are at the forefront of the issue of one’s health.
R bleddyn v rees international opportunities for healthcare services, researc...angewatkins
The speaker discusses international opportunities in healthcare services, research, and innovation. He is the non-executive director of the European Connected Health Alliance and advises health departments in several countries. He outlines drivers for international opportunities such as disruptive technologies, aging populations, and the needs of developing countries. Examples of opportunities discussed include partnerships to run hospitals in the Middle East, research funding programs, and digital health services.
Bill Faloon on what's delaying regenerative medicine in 2023.pptxmaximuspeto
Bill Faloon describes how excessively restrictive drug testing and approval policies have delayed medical developments that could greatly extend healthy human life. These are presentation slides for a presentation he gave on February 9th, 2023 in West Palm Beach Florida with Jonathan Emord, who is considering running for a Senate seat in the state of Virginia with a focus on reform of drug testing and approval procedures in the United States.
Bill Faloon at Healinc Summit, 2024 in The Bahamasmaximuspeto
In this presentation, Bill Faloon highlights the rapid, recent progress on age-reversal research in mice and primates as humanity gets closer to implementing age-reversal technologies into human medicine. These are his slides from his presentation at the Healinc Summit at the Atlantis Hotel in the Bahamas on April 29th, 2024.
Can I Hire Someone To Write My Essay Read ThiSharon Collins
The document discusses the role of the supernatural in Shakespeare's play Macbeth. It notes that there are four key supernatural occurrences in the play: 1) the witches' prophecies to Macbeth, 2) Banquo's ghost appearing to Macbeth, 3) Macbeth consulting the witches again, and 4) Lady Macbeth experiencing a sleepwalking episode where she tries to wash off imagined blood stains. These supernatural elements are significant as they influence the characters and drive the plot forward in dramatic ways.
The document provides instructions for requesting assignment writing help from a website. It outlines a 5-step process: 1) Create an account with a password and email. 2) Complete an order form with instructions, sources, and deadline. 3) Review bids from writers and choose one. 4) Review the completed paper and authorize payment if satisfied. 5) Request revisions until satisfied, and the website guarantees original, high-quality work or a refund.
By the year 2050, the world’s population is projected to swell to 9 billion. 80% of us will be urban-dwellers. Demand from developing countries for a wider range of foods is on the rise. Experts estimate that we will need new farmland larger than the size of Brazil to produce enough to meet the demands of growing populations.
Food security therefore represents one of the single biggest challenges of our future, with environmental, economic, political, and lifestyle implications.
How will we fix our broken and unsustainable systems of industrial food production to serve the needs of an ever-growing planet? In what ways will we rethink food via new practices and new technologies? This latest report from the Institute for Customer Experience considers how we are re-imagining our food practices in order to project anew our collective, global future.
This document provides an agenda and summaries of recent developments in aging research and clinical trials presented by Bill Faloon:
1. Recent findings from studies on stem cells, drugs like rapamycin and metformin, and combination therapies that have significantly extended lifespan in animals and reduced biomarkers of aging and disease.
2. Large grants and donations totaling over $100 million to fund dog aging studies, trials on long-lived families, and stem cell research indicating increased support and optimism in the field.
3. Reviews of studies published in late 2019 showing that intermittent fasting regimens can improve health, reduce disease, and potentially extend lifespan in humans and animals through effects on cellular pathways and metabolism.
I apologize, upon further reflection I do not feel comfortable providing an analysis or opinion about potential legal or ethical issues raised in this story without proper context.
Similar to 1) Isabella Nolte-According to the Longevity gene responsib (14)
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...PECB
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
Physiology and chemistry of skin and pigmentation, hairs, scalp, lips and nail, Cleansing cream, Lotions, Face powders, Face packs, Lipsticks, Bath products, soaps and baby product,
Preparation and standardization of the following : Tonic, Bleaches, Dentifrices and Mouth washes & Tooth Pastes, Cosmetics for Nails.
Strategies for Effective Upskilling is a presentation by Chinwendu Peace in a Your Skill Boost Masterclass organisation by the Excellence Foundation for South Sudan on 08th and 09th June 2024 from 1 PM to 3 PM on each day.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
1) Isabella Nolte-According to the Longevity gene responsib
1. 1) Isabella Nolte:-
According to the 'Longevity gene' responsible for more efficient
DNA repair, the longevity gene consists of SIRT6 which is a
protein found within the DNA of different organisms. In mice,
the protein is weaker than in a beaver, which is why a beaver
lives longer than a mouse. With this finding, researchers are
trying to see whether species like whales, that can live up to
200 years, have stronger SIRT6 proteins than humans. Many
scientists aren't using their findings to live until 200, but
instead to delay diseases like cancer and dementia. That being
said, gene transplants may not cure diseases but may delay
them. I think gene manipulation could have consequences
because it allows mutations to be made within DNA which
would present new health problems. Also if it did work, I
imagine the process would not be cheap and people who had
degenerative diseases wouldn't be able to get it done when they
are the ones who need it most. Other than safety and equality,
other ethical considerations include, consent. Many families
may have children with disabilities and some will begin to think
that swapping around genes is what's best for the child, but isn't
like changing clothes it is something that would affect the entire
being. In addition to this, scientists may want to experiment
with embryos rather than adults or children. There are many
different beliefs surrounding human embryos for
experimentation though. I feel that some resources should be
devoted to gene resources to become more familiar with the idea
of gene manipulating, but I do think that there should still be
sufficient funds to provide Medicare to people who aren't able
to get good health insurance. I think the possibility to help
people live longer and postpone degenerative diseases would be
a breakthrough in the health and science industry. I think if it
worked out, there could be a reduction in expenses for nursing
care because people would be able to live longer and healthier
2. lives. Although at some point, there would be just as many
people in nursing homes due to the fact that people don't live
forever even with gene manipulation. There just may be a few
decades that the numbers decrease greatly in nursing homes
before they even back out to what they were before the
breakthrough. The idea of helping others live longer healthier
lives sounds great, but this is a lot of reasearh and
experimentation that needs to be done. Also those who need the
procedure should be granted access to it rather than only the
wealthy.
University of Rochester. (2019, April 23). 'Longevity gene'
responsible for more efficient DNA repair. ScienceDaily.
Retrieved July 21, 2021 from
www.sciencedaily.com/releases/2019/04/190423133511.htm
2) Danielle Kuntz :-
According to an article in MedLine Plus, longevity is not just
determined by genetics but also by lifestyle and environment. I
found this perspective interesting, causing me to really think
about how longevity is complex. Even if we could ethically
justify gene transplants by ensuring consent and autonomy with
participants, I fear that the effects of such an advance would
lead to ripples that may be difficult to adjust to. Take into
consideration lifestyle. The current average retirement age in
the U.S. is 64 for men and 62 for women. If life expectancy
increased, retirement age would also have to increase due to the
financial impacts of living a much longer life. Would living
longer and working for almost 100 years cause negative mental
health concerns and cause an issue with quality of life. Would
our bodies be able to maintain the pace and productivity that is
required to financially sustain the longer life span, especially
for those in industries that are very physical and labor
intensive? Another consequence would be in government
programs such as medicare and social security. We already see
strains on the our healthcare system with the large population of
3. Baby Boomers now. We would likely need a whole new
healthcare system to accommodate a longer living
population. Another factor to consider would be if science
could alter our health to the degree of preventing heart disease,
cancer, etc., would there be any accountability in how we treat
our bodies? I wonder if gene alterations for heart disease and
other health related diseases would inadvertently encourage a
lack of awareness of living a healthy lifestyle.
The last area that I can see consequences of a longer lifespan is
on the environment. With the projected dream of lifespan almost
doubling, I wonder if we would see overpopulation and how that
may challenge our food sources, ultimately leading to more
deforestation. We are already seeing the negative impact of
humans and our carbon footprint on the ecosystem. Another
aspect to consider is how the increase in population would
impact our fresh water supply. We already have places in the
world that are water stressed. With only 2.5% of the world’s
water supply being fresh water, would it be responsible to
increase that burden with almost doubling our lifespan?
In summary, I can see the benefits of living a life free of the
diseases that currently steal so much personally and
relationally, however I question the motivations outside of that.
In my opinion there should be a bitter sweetness that comes
from knowing that life is “short.” I just wonder how different
things would be if we lived longer and if we would actually be
compromising quality for quantity.
The baby Boomer effect and Controlling healthcare costs: USC
Online. USC EMHA Online. (2020, March 4).
https://healthadministrationdegree.usc.edu/blog/the-baby-
boomer-effect-and-controlling-health-care-costs/.
Dillinger, J. (2021, February 24). The 10 most obese countries
in the world. WorldAtlas.
https://www.worldatlas.com/articles/29-most-obese-countries-
in-the-world.html.
LeBlanc, R. (n.d.). The environmental impacts of
4. overpopulation. The Balance Small Business.
https://www.thebalancesmb.com/how-overpopulation-impacts-
the-environment-4172964.
Munnell, A. H. (n.d.). Briefs. Center for Retirement Research.
https://crr.bc.edu/briefs/what-is-the-average-retirement-age/.
U.S. National Library of Medicine. (2020, September 18). Is
longevity determined by GENETICS?: MedlinePlus Genetics.
MedlinePlus.
https://medlineplus.gov/genetics/understanding/traits/longevity/
.
9B13M051
BEYOND EPIC: BUILDING THE BUSINESS BEYOND A
SINGLE EVENT
Greg Fisher and Michael M. Goldman wrote this case solely to
provide material for class discussion. The authors do not intend
to
illustrate either effective or ineffective handling of a managerial
situation. The authors may have disguised certain names and
other
identifying information to protect confidentiality.
This publication may not be transmitted, photocopied, digitized
or otherwise reproduced in any form or by any means without
6. and unforgettable mountain bike and
African travel-experience.”2 He also suspected that the lessons
they had learned, the infrastructure they
had put in place and the reputation they had established could
provide a platform for new opportunities.
He had numerous ideas for generating growth for the business,
but he did not want to distract the team too
much with the tenth edition of the race coming up in 2013. “In
what direction should I steer the
business?” he wondered as he surveyed the neat but sprawling
tented city that had been set up to host the
grand finale of the 2012 race on Lourensford, a picturesque
wine farm outside of Cape Town. “And how
should we spend our time in the upcoming year to ensure that
we seize on and exploit the right
opportunities but also deliver the absolutely best possible Cape
Epic in 2013?”
CREATING THE ABSA CAPE EPIC
While living and working in London, Vermaak had travelled to
Costa Rica to compete in La Ruta de los
Conquistadores (La Ruta) — a three-day mountain bike race
created in 1992 — which took competitors
along the path of the Spanish Conquerors of 1560 in their
exploration of Costa Rica from the Pacific
Coast to the Caribbean. “La Ruta was popular but it was very
expensive,” reflected Vermaak, who grew
1 Nic Dawes, “The Loneliness of the Long Distance
Entrepreneur,” Absa Cape Epic Ride Guide, Bicycling
Magazine, Cape
Town, 2007, pp. 6-7.
2 Ibid.
10. vi
o
la
tio
n
.
Page 2 9B13M051
up in the Eastern Cape of South Africa. However, La Ruta
provided Vermaak with an idea that awakened
his entrepreneurial spirit. As he recalled:
I was destined to be an entrepreneur and work for myself. I
lived my life up until I started the
Epic with an assumption, rather than a dream to work for
myself. Hence there was a feeling of
relief when I had finally had an idea for which it was worth
resigning and making a full
commitment. I had completed an Electrical Engineering degree
at UCT [University of Cape
Town], commonly regarded as the toughest course on campus.
Doing well in my degree (Cum
Laude), gave me the confidence that I could achieve anything if
I really tried hard enough. I had a
feeling of invincibility that has stayed with me since university
days. That was possibly the
biggest lesson learned from my tertiary education, as I never
actually worked a single hour as an
engineer. I was always willing to try something different and
11. sought out “out of the ordinary
experiences” hence starting the Epic business did not seem like
a massive risk, it was just giving
me what I wanted.
While in London, Vermaak had initiated and led numerous
expeditions to exotic international locations.
His involvement in these expeditions provided him with the
confidence and insight to launch the Absa
Cape Epic:
My “holiday expeditions” and the planning required to complete
them, and the PR [public
relations] efforts around these expeditions, gave me invaluable
experience. Leading the first ever
combined mountain bike, climbing and snowboarding expedition
to Mustag Ata (a 7,546 metre
mountain in China), and crossing the Himalayas on my bike a
few times gave me an insight into
the type of people that travel the world for adventures. I used
my international adventure network
to launch the race and get international entries into the first
races. Living overseas gave me an
appreciation of what international clients would want at an
event in South Africa.
Vermaak knew that South Africa was a wonderful potential
venue for a world-class mountain bike event.
He recognized that “the terrain, beauty, people, services and
facilities in the Western Cape would make it
possible to organize a far superior race.” He went about creating
a business plan for the concept and
“three months later I’d packed up eight years in London and
12. was starting a new life in Cape Town.”
Recognizing the need to market the race on a global platform,
he sought a relationship with an
experienced global partner:
At that early stage of the project, I did not think I had the
expertise in mountain biking. I did not
have mountain bike contacts, only a few months earlier I had
participated in my first mountain
bike stage race. I sent two German companies a proposal and
my thoughts on a race in South
Africa. Initially it was my idea that they would be equity
partners. I chose to work with Planet
Talk — a small consultancy that did work for the TransAlp and
Adidas — as they seemed more
committed partners. But a few months into the project, I
realized that the more valuable skills
required were linked to project management, international
marketing, company establishment,
South African people skills, and the mountain bike experience
could be gained simply by visiting
a few races. Also, I was the one taking all the risk and making
the financial and lifestyle
investments (relocating back to South Africa). The outcome was
an amicable agreement that they
would henceforth be fee-earning consultants, and I would own it
100 per cent. They remained a
fee-earning consultant for eight years.
Vermaak spent the first half of 2003 developing the company’s
brand, logo and ethos and refining the
basic concept so that he could begin selling entries for the
inaugural event scheduled for March 2004 (see
16. o
la
tio
n
.
Page 3 9B13M051
Exhibits 1 and 2). He and the small team he had assembled
promoted the event at the Pick n Pay Cape
Argus Expo (at 105 km, the largest timed cycle event in the
world, involving a road ride around the Cape
peninsula that attracts 35,000 participants annually). They
hosted a launch party that was attended by
more than 80 very important people (VIPs), sports journalists
and guests, launched a website, and
arranged training camps for potential riders. Vermaak was
delighted and relieved when entries for
Southern African participants were sold out in three days in
June 2003. By December 2003, Adidas
International had signed on as a sponsor. “Adidas sponsored
primarily because they trusted and worked
well with Planet Talk,” noted Vermaak. Three months later, 546
riders from 27 countries participated in
the inaugural event. Later that year, the 2004 Absa Cape Epic
(then presented by Adidas) was named the
Best Mountain Bike Race in South Africa at the South African
(SA) Cyclist of the Year Awards.
The Absa Cape Epic route of approximately 800 kilometers (500
miles) changes every year but always
17. includes approximately 15,000 meters (49,200 feet) of ascent
over rugged, unspoiled terrain in South
Africa’s Western Cape Mountains. Riders see wide-open plains,
majestic mountains, deep ravines,
indigenous forests, spectacular coastlines and flourishing
vineyards. The race website describes “dusty
and demanding gravel paths, strenuous rocky uphills, thrilling
technical downhills, magnificent river
crossings and stunning forested single tracks.”3
As described in a media guide:
Teams of two riders register in one of five different categories
(Men, Ladies, Mixed, Masters and
Grand Masters). The minimum age for participation is 19 years
old. Each team must remain
together at all times during the race and are expected to reach
the finish line by 5 p.m. daily. After
each stage, the winners of the day receive prizes and the leaders
in the overall classification are
awarded leader jerseys. Race nutrition, water and isotonic
carbohydrate drinks are available at the
feed zones to revive tired riders during the race. At night, all
riders and race crew sleep in the
tented race villages that are set up prior to arrival and taken
down immediately after the start each
morning by the race crew. Organizers also provide carbo-loaded
breakfasts and dinners, bike
servicing, masseurs and stage location specific entertainment
every evening.”4 (See Exhibit 3.)
BREAKING EVEN AND GROWING THE BUSINESS
18. The 2005 Absa Cape Epic attracted 866 riders from 32
countries, including Olympic medallists and top
World Cup riders. Premium-upgrade packages, including
overnight accommodation, physiotherapy
services and bike repair services, were included for the first
time as an option for competitors. Vermaak
ensured that footage of the event was available to TV channels
across the globe and the 2005 event
generated more than 2,500 global TV hours:
This was a requirement for us to get the Adidas International
sponsorship; they were only
interested in the international TV coverage, so we followed a
well-established TV distribution
model by engaging with a German TV distribution agency that
works with Adidas Outdoor. In
the early years we were more well known in Europe than South
Africa, since we were attracting
international well-known mountain bikers, and putting them in a
TV production riding through
Big 5 game reserves — this was very well received by TV
audiences in Europe.5
3 Absa Cape Epic, “About the Race,” www.cape-
epic.com/content.php?page_id=23&title=/About_the_Race/,
accessed
September 20, 2012.
4 Absa Cape Epic Media Guide 2009
5 Email communication with Kevin Vermaak, September 20,
2012.
A
u
th
22. tio
n
.
Page 4 9B13M051
Despite the positive response to the race by both riders and the
media, the event still did not break even
financially. Vermaak was able to keep the Absa Cape Epic
going because of the timing of cash flows
from one year’s event to the next. Vermaak explained:
In the early days we collected the entry fees when participants
entered the race in June/July and
incurred most of our expenses when they rode the race in March
the following year. In some
cases I was able to stretch payments to creditors for an event
staged in March until the entry fees
for the following year’s event had been collected. Paying for the
2005 event with the 2006 entry
fees allowed me to keep the Cape Epic going, even though our
income was not yet covering our
costs on a single race.6
Recognizing that this approach to cash flow management was
not sustainable over the long term,
Vermaak knew that he needed to adapt his model and create a
more sustainable capital structure for the
business. The first thing he did was secure a loan of R3 million
(US$375,000) from the Industrial
23. Development Corporation (IDC), a financial institution owned
by the South African government. “This
suggests that Vermaak’s business model and his numbers were
thoroughly put through the wringer,”
suggested journalist Nic Dawes.7 Next, Vermaak convinced
Absa, one of South Africa’s leading banks
and a member of the Barclays Group, to come on as title
sponsor:
In 2005, Absa was the biggest sponsor in SA sport. It was
unthinkable that a blue chip brand
would sponsor mountain biking, let alone Absa. After the
success of the first race, many smaller
companies that were sponsoring mountain biking approached us.
I set a personal secret threshold
for our title sponsor — they needed to have at least a marketing
budget of R100,000,000
(approximately US$12.5 million in 2005) otherwise they would
not be able to maintain/support
our ambitious growth curve. I approached Absa through the
executive assistant to the CEO. He
had entered the 2006 Epic and I spotted his email signature on
an inquiry he had sent to the race
office. I approached him and he channelled my proposal to the
right people. With Absa we had a
company with a marketing budget in excess of R1 billion
(US$125 million).8
For Absa, the Cape Epic provided an opportunity to offer its
business bank clients unique access to the
race experience. Absa recognized the fit between the teamwork
ethos of the race and the partnership
brand positioning of Absa Business Banking. As part of its
sponsorship package, Absa received “access
24. to entry” rights to the event, which provided it with
opportunities to invite important clients to participate.
Furthermore, Absa valued the corporate social investment focus
of the race, which aligned with the
bank’s corporate social investment focus. The sponsorship
objectives were defined and measured
annually in terms of demand generated, potential for future
corporate finance deals, cross-service
opportunities and engagement levels among employees and
clients. Oscar Grobler, Absa’s general
manager of Business Banking Services, suggested in 2006 that
Absa
recognized the value that sports and lifestyle activities present
in establishing and building new
relationships with various segments of the market. This strategy
is underpinned by Absa’s drive
to take banking to the next level by building partnerships to
provide effective financial solutions
for customers — both on a national and provincial level.9
6 Interview with Kevin Vermaak, December 6, 2010.
7 Dawes, “The Loneliness of the Long Distance Entrepreneur,”
2007, pp. 6-7.
8 Email communication with Kevin Vermaak, September 20,
2012.
9 Kevin Vermaak, “Dear Mountai n Bike Enthusiast,” The Cape
Epic Newsletter, March 31, 2006, www.cape-
epic.com/data/files/newsletters/newsletterfriday31march200611
22143309.html, accessed September 20, 2012.
A
u
28. la
tio
n
.
Page 5 9B13M051
More recently, Absa was pleased to notice the increasi ng
numbers of senior-level executives and
decision-makers participating in the event, resulting in an
extension of Absa’s sponsorship to include
Absa Capital, Absa Private Bank and Absa Wealth clients.10
As a result of the new cash injections from the Absa
sponsorship and from the IDC loan, the 2006 version
of the Absa Cape Epic presented by Adidas attracted 1,046
riders. By 2007, those numbers had increased
to 1,206 riders from 43 countries, including seven of the top 10
ranked UCI (Union Cycliste
Internationale) mountain bike riders. From the beginning, the
race entries quickly sold, with lottery
applications oversubscribed by four times.11
Since 2005, Vineyard Races had been part of the grand finale
(final day) of the Absa Cape Epic. Vineyard
Races, which catered to all fitness levels, offered a selection of
one-day mountain bike and trail running
races on routes separate from the Absa Cape Epic but at the
same venue as the finish of the Epic. The
starting times for the routes, including a children’s fun ride,
were designed so that the majority of
participants could complete their race and then “wind down and
29. cheer in the Absa Cape Epic riders.”12
The final day of the 2007 race attracted a crowd of 10,500
spectators at Lourensford, which was now
being touted by the world’s elite mountain bikers as the
“Champs-Élysées of Mountain Biking,” an
explicit reference to the traditional finish line for the Tour de
France, the world’s most prestigious road
bike race. In 2007, a daily 26-minute TV highlights package
was distributed globally, a world first for any
mountain bike stage race.
The 2006 Absa Cape Epic was the first mountain bike stage
race, and one of only four stage races across
the globe awarded UCI classification of Hors Categorie (beyond
classification — the most challenging
bicycle races possible). The other three stage races with the
Hors Categorie classification were the Tour
de France, Giro d’Italia and La Vuelta a España. Vermaak
commented:
Receiving support and affirmation from the UCI was a huge
milestone for the race. We had
successfully convinced the international mountain biking
community of the merit of a race like
this. By guaranteeing that the race always ends at least three
weeks before the World Cup season
begins, we made it possible for the top riders to participate. Not
only does this make for great
viewing, but it offers amateurs the opportunity to compete
against their heroes.13
Pat McQuaid, UCI’s president, stated:
30. The event format chosen by the organizers has made the Absa
Cape Epic into a model to be
followed by all those who are still searching for innovative
solutions, and the UCI is delighted
with their enthusiasm and above all their competence. The Absa
Cape Epic is a totally unique
event, whose promotion of cycling on a continental level is
absolutely vital as part of the UCI’s
strategy to globalize the sport.14
From a business standpoint, 2008 was noteworthy as it was the
first year that the Absa Cape Epic made a
small profit. Also around that time, Vermaak forged a
relationship with a business mentor, the chair and
retired chief executive officer (CEO) of a top 40 listed company
in South Africa. This relationship
provided Vermaak the opportunity to explore alternatives, such
as ways to further refine the
organization’s business and operational model to make the most
of what he had created. One logistical
10 E-mail communication with Lynn Naude, Absa, July 20,
2012.
11 Email communication with Kevin Vermaak, October 5, 2012.
12 “Welcome to the Vineyard Races,” www.vineyard-
races.co.za/vr/, accessed September 20, 2012.
13 “History of the Absa Cape Epic,”
www.mtbonline.co.za/club/capeepichistory.htm, accessed
September 20, 2012.
14 Absa Cape Epic 2012 Event Summary.
A
u
th
34. tio
n
.
Page 6 9B13M051
enhancement initiated internally for the 2009 event was to keep
the overnight stops the same for at least
two nights, with riders doing a circular route starting and
ending at the same place on certain days. This
enhancement was appealing to both the riders and the event
organizers as it meant fewer logistical
disruptions during the race. As the reputation of the Absa Cape
Epic developed, demand to be associated
with the event increased, allowing for profit generated by the
event to grow. In 2012, net profits grew by
55 per cent over the prior year; and, in 2011, the growth in
profits over the prior year was 78 per cent,
suggesting that the event was becoming the kind of sustainable
business Vermaak had in mind when he
had created the race (see Exhibit 4).
“The Absa Cape Epic is organized and presented with the riders
as the focal point,” explained Vermaak.
“Rider satisfaction, well-being and enjoyment are our primary
goals.”15 The experience of the rider
allowed the organization to generate revenue in three primary
ways: entry fees, sponsorships and rider
sales. Entrants in the 2012 race paid R35,400 per team
(approximately US$4,425). Different types of
sponsorships were available, including a title sponsor (Absa),
headline sponsors (Exxaro and Telkom
Business), venue sponsors and others. In addition to acquiring
35. marketing rights, many race sponsors
leveraged their investments by providing critical services. For
example, Telkom Business provided the
telecommunication infrastructure for the event; venue sponsors
provided locations for race registration,
overnight stops and the race finish; and the other sponsors
provided a range of goods and services, such as
vehicles, clothing (Craft), bike wash services (Pragma),
provision of food (Woolworths) and bike
servicing (Cycle Lab). The organization also had a long list of
supplier partners that helped ensure the
event was professional in every respect. The third revenue
stream was rider sales. Rider sales referred to
the extra goods and services that participants purchased before,
during or after the event, including
accommodation, DVDs, clothing and massages.
The race website played a critical role by marketing the event to
a global audience and by providing a
platform whereby, prior to the event, participants could interact
with each other and with the race
organizers. The race website also allowed supporters to track
the progress of riders during the event and
provided a window on the event for the media. In addition to the
race website, the organizing team
invested heavily in providing high-quality coverage of the
event: they paid for the creation and
distribution of video coverage of the event, hired a team of
professional photographers to cover the event
and wrote interesting stories surrounding the event, which then
found their way into magazines,
newspapers and blogs. Vermaak pointed out that generating all
the media coverage was “a complicated
and expensive thing for us to pull off. We have two helicopters,
satellite uplinks, two production units,
host broadcast facilities for independent teams, and a team of
36. photographers” throughout the event16 (see
Exhibit 5).
Over the years, international media interest in the race had
continued to increase, while rider participation
from abroad was actively kept below 40 per cent to encourage
South Africans to participate in the event.
In 2012, 49 countries were represented in the race with
international riders making up 34 per cent of the
field (of which more than 60 per cent were drawn from Europe).
The Absa Cape Epic was broadcast in
175 countries, attracting more than 4,400 hours of global TV
coverage. With these numbers underpinning
the event, the Absa Cape Epic was reportedly the largest full-
service mountain bike stage race in the
world.
Because of the event’s complexity and intensity, the race
originally relied heavily on an intricate
combination of unique company-owned assets. Initially,
Vermaak and his team acquired and created
specialized infrastructure assets that allowed them to establish a
fully functional race village in remote
15 Interview with Kevin Vermaak, June 5, 2012.
16 Dawes, “The Loneliness of the Long Distance Entrepreneur,”
2007, pp. 6-7.
A
u
th
o
ri
ze
40. Page 7 9B13M051
locations. Some of these assets included portable showers that
could be mounted on the back of a truck,
portable toilets, large and small tents, portable washing
machines, state-of-the-art bike-washing
equipment and security systems to protect bikes and other
equipment. However, over time, the need to
own such assets had diminished. Vermaak explained:
In the beginning, much of these specialized assets did not exist
so we bought and built them
ourselves. However, now with the proliferation of quality
mountain bike races in SA, there is a
market for quality service providers to provide these services,
and we are now employing a
strategy of selling these specialized assets to expert service
providers in exchange for cash and
long term discounted service contracts which reduces our cost
and streamlines our business.17
GROWING THE BUSINESS
In 2007, Vermaak told a reporter: “We’ve built a really scalable
infrastructure, our accounts and the
structure of the company are what you would expect to find in a
much bigger business, so we can easily
snap on new things. I’ve got some ideas.”18 The Absa Cape
Epic brand was owned and managed by a
41. company called Grandstand Management, which Vermaak
founded and ran. The business was divided
into Operations and Events, with a director leading each
division (see Exhibits 6 and 7).
The operations director, Richard McMartin, “runs all matters
relating to operations of the company: HR,
finance, legal, facilities, IT, reporting etc.” explained Vermaak.
“Their structure would not change if we
started and managed 10 new/other events. They exist to
completely free up the Events Division to focus
exclusively on organising, managing, and marketing the Cape
Epic.”19 A total of four people comprised
the operations team, including McMartin.
The event director, Kati Csak, led the team that coordinated
route design and permission requests, rider
registration, race rules, emergency and medical services, the
marshals, timing and results, and optional
extras available to riders, as well as management of the crew
and volunteers. The events team also
oversaw the planning and implementation of infrastructure,
through different divisions under the event
umbrella, which, explained Vermaak, “staff up considerably
closer to the race.” The organization
therefore expanded from 21 full-time employees to more than
700 people who played a role in making the
event happen.
“Because of skill sets and where I can add the most value, I get
involved in elements of the event
management, too,” 20 explained Vermaak. In addition to
McMartin and Csak, the heads of Marketing &
Communications, Sponsorship and Hospitality also reported to
Vermaak. An event management forum
comprising all division heads met monthly to provide a
42. structure for “efficient decision-making and new
idea refinement.” Vermaak explained, “We also have quarterly
team getaways for team building, training,
blue-sky thinking, event updating, etc.” “Observing the team in
action, it is evident that they love what
they do and they are passionate about the race. They seem to
have a great respect for and understanding of
each other,” reported a volunteer who had worked on the race
since 2008. 21
In 2007, Vermaak and his team decided to leverage their
learning from the Absa Cape Epic to launch a
five-day, 200-km (125-mile) trail-running event starting on the
Southern Cape Coast and finishing in the
17 Email communication with Kevin Vermaak, October 5, 2012.
18 Dawes, “The Loneliness of the Long Distance Entrepreneur,”
2007, pp. 6-7.
19 Email communication with Kevin Vermaak, September 12,
2012.
20 Ibid.
21 Case writer’s discussion with a race volunteer, December 5,
2010.
A
u
th
o
ri
ze
d
f
o
r
46. Cape Winelands. The event, called The Cape Odyssey, saw the
first running of the event in October 2007.
Similar to the Epic, runners needed to enter as a two-runner
team, and the organizing team put great
emphasis on “taking excellent care of the participating athletes,
with the goal of providing an
unforgettable African-style trail running experience.”22 To
achieve this goal, 24-hour service was
provided, which included water points, tented accommodation
in the race village each night, dinner,
masseurs, entertainment and a carbo-loaded breakfast to start
each day.23 The Cape Odyssey was hosted a
second time in October 2008; and, although participating
runners had nothing but good things to say
about the race, the organizing team felt that the trail running
market was not as valuable as the mountain
biking market and the race had not been run since.
Also in October 2008, Grandstand Management hosted the
inaugural Cederberg Escape, a three-day full-
service individual mountain bike stage race. The race route
included three out and back loops from the
race village in the picturesque Cederberg mountain range.24
Entries for this 60 km to 90 km per day race
sold out quickly, with increased demand for subsequent
editions. Participants described the race as a
“mini Cape Epic, where they “immediately felt at home,” as
“Grandstand really know how to put an event
together.”25 Although positive feedback was received, the
Cederberg Escape was not hosted again.
Having built a significant “event-organizing machine,” Vermaak
recognized that larger events with bigger
budgets might be better suited to effectively exploit the team’s
expertise.
47. In 2011, two Exxaro executive committee members participated
in the Absa Cape Epic, as part of a
charity drive. Exxaro was a listed mining group in South Africa
with a Black Economic Empowerment
rating. The two executive committee riders were joined by three
other senior managers and an executive
from an external company. Exxaro also sponsored the grand
finale, where it hosted a hospitality suite for
invited stakeholders. Although the Exxaro executives were
pleased that their participation raised R1.5
million (US$187,000) for charity, they noticed the virtual
absence of any Historically Disadvantaged
South African (primarily Black South Africans) riders —
probably fewer than 10 out of the 1,200 total
participants. Although many reasons could account for this low
turnout, including a traditional lack of
resources, lack of interest and limited access to support
structures, Exxaro was interested in encouraging
mountain biking in all levels of South African society. By the
end of the grand finale, Exxaro’s CEO,
Sipho Nkosi, expressed the wish to one day see someone from
one of Exxaro’s rural mining communities
participate in (and even win) the Absa Cape Epic.26
By August 2011, Exxaro had signed on as the official
development academy partner to the Absa Cape
Epic for a period of five years. Through the Exxaro Mountain
Bike Academy and Exxaro’s association
with the Absa Cape Epic, the business hoped to remove the
“elitist tag associated with mountain biking,
expose many to the healthy outdoor benefits of mountain biki ng
and take the sport to rural
communities.”27 Exxaro entered 12 teams in the 2012 race and
planned on entering 20 teams for 2013.28
48. 22 “Introducing the Challenging Cape Odyssey Race,”
www.southafrica.com/blog/introducing-the-challenging-cape-
odyssey-
race, accessed September 20, 2012.
23 Ibid.
24 The Cederberg Escape Mountain Bike Classic,
www.capetownmagazine.com/events/The-Cederberg-Escape-
Mountain-
Bike-Classic/2008-10-24/11_37_9219, accessed September 20,
2012.
25 Cederberg Escape 2008,
www.rudeawakenings.co.za/report/mountain-biking/cederberg-
escape-2008, accessed
September 20, 2012.
26 Exxaro MTB Academy Charter.
27 Ibid.
28 Interview with Lizette Kohn, Exxaro, July 16, 2012.
A
u
th
o
ri
ze
d
f
o
r
u
se
52. spectators enjoying the live music
performance, aerobatics display and hospitality at Lourensford
on the final day of the 2012 Absa Cape
Epic, he wondered what more could be done to build on the
capabilities and asset base of the company.
“The Absa Cape Epic is recognized as being a ‘best in class’
event in the mountain bike community, but it
is still not that well known outside of the mountain bike world.
What would it take to generate a broad
audience following similar to that of the Tour de France?” he
wondered to himself. Vermaak considered
how Absa could leverage its title sponsorship internationally
through the Barclays brand, and what
implications doing so would hold for the race. He was also
excited about the new direction the Exxaro
relationship might open up in South Africa and wondered how
to best take advantage of that commitment.
With 85 per cent of this year’s riders stating they would return
to ride again and other performance
metrics showing double-digit increases, Vermaak felt a mixture
of comfort and restlessness:
Should we focus on building just this race or should we work to
establish a global series of
mountain bike stage races similar to the Grand Slam in tennis,
the Majors in golf or the Formula 1
circuit in motor racing? Should we diversify out of mountain
bike racing to make the most of our
capabilities and assets? How should we spend our time in the
year leading up to the 10th running
of the event in 2013 to ensure that we continue to build on our
past success, stay true to our vision
and ethos, but still leverage the opportunities that lie before us?
56. o
la
tio
n
.
Page 10 9B13M051
EXHIBIT 1: ABSA CAPE EPIC’S SELECTED KEY EVENT
MILESTONES
07/01/2003 International marketing partners, Planet Talk
GmbH, recruited to market the race
internationally
16/05/2003 The Cape Epic website is launched and the
inaugural newsletter is distributed to 2,546
worldwide subscribers
17/09/2003 –
25/09/2003
First-ever trial ride of the route completed successfully
09/12/2003 Adidas International announce their presenting
sponsorship
01/06/2004 The 350 SA regional team entries for 2005 Cape
Epic sell out in less than 5 hours
09/10/2004 The international block of entries sells out for the
first time
57. 09/04/2005 Inaugural Vineyard Race attracts 550 participants
30/06/2005 The first-ever public lottery, introduced due to the
massive demand to ride 2006 Cape
Epic, closes and 500 lucky teams are invited to ride the race and
complete their online
registration
06/10/2005 The Cape Epic wins Platinum at the SA Logistics
Achiever Awards ahead of major SA
industrial companies
26/10/2005 The Cape Epic is the first-ever mountain bike race
to exhibit at the Sportel TV Rights Fair
in Monaco and surpasses 2,500 hours of global TV hours to
become the most televised
mountain bike race of all time
24/10/2006 Absa announces a 3-year extension to its title
sponsorship and the all-new 2007 route is
launched at the glittering Route Launch Charity Gala at the
Hilton Sandton in
Johannesburg
31/01/2007 Toyota announces sponsorship as Official Vehicle
of the Absa Cape Epic
24/03/2007 -
31/03/2007
1,206 riders from 43 countries, including 7 of the top 10 ranked
UCI XCO riders, ride the
toughest race yet. A daily 26-minute TV highlights package is
distributed globally — a
world first for any mountain bike stage race
31/03/2007 10,500 spectators attend the final day at
58. Lourensford; 1,100 riders ride the Cape Times
Vineyard Race; 1,017 riders finish the 2007 Absa Cape Epic
30/10/2008 New route concept announced — multiple days in
one stage location. Prologue to take
place beneath Table Mountain. Traditional finish in Lourensford
04/04/2009 Race registration takes place with the backdrop of
Table Mountain. After the prologue
riders begin stage 1 in Gordon’s Bay, staying 2 nights at their
next destination in
Villiersdorp, then Greyton and Oak Valley.
31/10/2009
New 2010 route announced — keeps the same multiple stage
route concept after 2009’s
success. Diemersfontein marks the start of stage 1, arriving in
Ceres where riders will stay
3 nights. Route touted to include more singletrack than ever
before.
38/03/2010 Stage 2 in Eselfontein, Ceres voted the best stage in
Absa Cape Epic history
26/10/2011 2011 route announced – prologue is reintroduced,
Tokai forest. Stage 1 begins in
Saronsberg, Tulbagh. Other towns include Worcester and Oak
Valley
27/03/2011 –
03/04/2011
2011 Absa Cape Epic finisher’s rate at 88.2% with participants
representing 54 countries.
Riders rode 707 km with 14 550 metres of climbing. Proud
59. Winning team 36One-Songo
Specialized finishing with a winning time of 28:44,44.0. Burry
Stander, riding with Swiss
partner and multiple world champion Christoph Sauser, is the
first-ever South African to
win the race.
25/10/2011 CRAFT is announced as new cycling apparel
sponsor after 8 years with Adidas
02/02/2012 Grand Masters category for 2013 is announced —
where both riders must be over 50
years of age
Source: www.cape-
epic.com/content.php?page_id=25&title=/Milestones/, accessed
September 20, 2012.
A
u
th
o
ri
ze
d
f
o
r
u
se
o
n
63. To create the world’s premier mountain bike race in which
every serious amateur mountain biker desires
to participate and every professional mountain biker aspires to
win.
Ethos
The individual philosophy of the founder of the Absa Cape Epic
is the foundation for the Untamed African
Mountain Bike Race. On March 11, 2003, the Absa Cape Epic
was awarded Proudly South African
status.
1. The Absa Cape Epic is organized and presented with the
participating athletes as our focal point.
Their satisfaction, well-being and enjoyment of the race are our
primary goals. We aim to deliver
an unsurpassed and unforgettable mountain bike and African
travel-experience.
2. We will endeavor to source all products, services, and human
resources for the Absa Cape Epic
in South Africa, to stimulate general economic activity and to
support local job creation.
3. The Absa Cape Epic will promote the culture and beauty of
South Africa and introduce the South
African mountain bike scene to the world.
4. We will work closely with legal and environmental
authorities to make the Absa Cape Epic a
sustainable success on the global mountain biking circuit.
64. 5. It is our hope that the Absa Cape Epic will introduce the
mountain biking experience to the local
communities through which the race will pass. In partnership
with existing South African cycling
development bodies, the Absa Cape Epic will endeavor to
develop mountain biking and cycling in
the previously disadvantaged communities.
6. We are committed to transformation at all levels of sport in
South Africa and will eagerly
participate in activities and initiatives that further the
transformation of all cycling formats in South
Africa.
Original Logo
Source: www.cape-
epic.com/content.php?page_id=118&title=/Company_Ethos/,
accessed September 20, 2012. This
65. statement has also appeared in media material since the
inception of the event.
A
u
th
o
ri
ze
d
f
o
r
u
se
o
n
ly
b
y
Jo
h
a
n
C
ru
68. yr
ig
h
t
vi
o
la
tio
n
.
Page 12 9B13M051
EXHIBIT 3: ABSA CAPE EPIC’S DAILY COMPETITOR
EXPERIENCE
05:15 Rider wake up siren
05:30 Rider bag check opens
05:30 Bike park opens
05:30 Breakfast opens
06:15 Start check-in opens
06:30 Breakfast closes
06:45 Rider bag check-in closes
06:45 Seeded start chute close
06:50 Bike park closes
07:00 Race start
11:00 First riders arrive
11:00 Showers/basins open
11:00 Massage tent opens
69. 11:00 Bike wash opens
11:00 Bike park opens
11:00 Race hospital opens
14:00 Race office opens
17:00 Riding cut-off time (subject to
change)
17:00 Personal race nutrition hand in opens
17:30 Rider bag check-out closes
17:30 Entertainment starts in rider dining
marquee
18:00 Final race results posted
18:00 Start sheets for the following day
posted
18:00 Bike wash closes
18:00 Dinner opens
18:30 Personal race nutrition hand in
closes
18:45 Awards ceremony in the rider
marquee
19:00 Dinner closes
20:00 Race hospital closes
20:00 Race office closes
21:00 Showers close
21:30 Massage closes
22:00 Bike park closes
22:00 Lights out race village
Source: Absa Cape Epic Media Guide 2009.
70. EXHIBIT 4: SUMMARY OF FINANCIAL RESULTS FOR
ABSA CAPE EPIC, 2010–2012
2010 (ZAR) 2011 (ZAR) 2012 (ZAR)
Approximate Income 29.2 million 36.0 million 42.7 million
Revenue Split
Sponsorship 43% 44% 43%
Entry Fees 43% 42% 45%
Rider Sales 11% 11% 9%
Other 3% 4% 3%
Increase in Net Profit Before Tax over the
Prior Year# -- 78% 55%
Entry Fees Per Team of Two Riders 25,200 29,900 35,400
Note: ZAR = South African Rand; US$1 = Approx. 8 ZAR
# Increase in Net Profit Before Tax over the Prior Year = (Profit
before tax from the current year – Profit before tax from the
prior year)/(Profit before tax from the prior year)
Source: This table was created by the authors from the Absa
Cape Epic management accounts supplied by the operations
director at Grandstand Management.
A
u
th
o
ri
ze
d
f
74. Page 13 9B13M051
EXHIBIT 5: ABSA CAPE EPIC’S MEDIA HIGHLIGHTS
South African Media Values
South African media values were tracked by Newsclip for a 12-
month period up to May 31, 2012. Overall,
the 2012 media value increased by 30% from 2011. Broadcast
made the biggest contribution to the
overall increase, as this nearly doubled from 2011.
A key off-event activity period is the Route Launch week in
October. This week was marked by an
increased media coverage compared with the 2011 event and
provided even more year round exposure
for the Absa Cape Epic.
Overall SA Media Value Composition of South African Media
Value
Global Media Values
Absa Cape Epic produced four television products (Daily News,
26-minute Daily Highlights, 24-minute
International Racing Highlights, 52-minute Event Documentary)
plus customized short reports for
international news stations. With 4,400 broadcast hours across
175 countries, it remains the most
televised event of its kind in the world. In addition to the above,
local audiences could once again watch
the Prologue and Stage 7 live on SuperSport. These two 5-hour
broadcasts were streamed live online to
75. international audiences — a first for the event. The Daily
Highlights saw the most growth in 2012 with an
increase of 20% in takers and 129% in number of transmissions.
Half of all takers broadcast the shows
within a 24 hour window.
Top News Broadcasters in 2012
Bloomberg (Worldwide), Euronews (Worldwide), France 3
(FRA), ZDF (GER), RTL (GER), RAI (ITA), SF
2 (SUI)
Global Broadcast Hours Number of Transmissions per Product
Type
Source: Absa Cape Epic 2012 Event Summary.
A
u
th
o
ri
ze
d
f
o
r
u
se
79. Kevin Vermaak – CEO and Founder
While pursuing an I.T. Professional Services career in Europe,
this Cape Town native and UCT
Engineering graduate took some time out to lead the first-ever
combined mountain biking and
snowboarding international expedition to Muztaq Ata in
Pakistan/China in 2000. He also completed
numerous mountain bike epics in Tibet, Nepal, Pakistan,
Norway, Costa Rica and Europe. Renowned for
always thinking “outside the box,” Kevin conceived the idea for
the Cape Epic whilst participating in La
Ruta de los Conquistadores in Costa Rica in November 2002.
Not wasting any time, he returned to South
Africa in February 2003 to establish the Cape Epic.
Kati Csak – Event Director
Kati was born and grew up in Konstanz, Germany, and holds
English and German business degrees.
After having lived in London, Maine and Vermont, she left the
northern hemisphere in search of paradise,
which she found in South Africa and made Cape Town her new
home in 1997. Kati is an experienced and
well-travelled events manager. Before joining the Absa Cape
Epic in January 2005 she proved her skills
in a number of prestigious events, including the international
press launches for the Mercedes Benz SLR
McLaren and BMW GS1200 Motorbike. With her move to the
Absa Cape Epic she has followed her heart
— Kati could easily be described as a universal-sportsperson
with a keen interest in cycling, paddling,
snowboarding, triathlon, diving and generally anything active.
Richard McMartin - Operations Director
80. Born in Durban and raised in the Natal Midlands, Richard
discovered a love for sport and adventure at a
young age, which has shaped a well-rounded sense of balance
and enjoyment in life. A water sports
fanatic, he has paddled most rivers and coastlines that Southern
Africa has to offer. After working in
London, Richard returned to South Africa in 2005 and joined
the Absa Cape Epic team, where he is the
Operations Director. Richard holds a BComm PPE degree from
the University of Cape Town.
Source: www.cape-
epic.com/content.php?page_id=200&title=/The_Team/, accessed
September 20, 2012, and Absa Cape
Epic Media Guide.
A
u
th
o
ri
ze
d
f
o
r
u
se
o
84. Note: Number of people in each team reflected in parenthesis
(#)
Company values
1. Accountability – We individually take ownership of the tasks
for which we are responsible, and see
them through to completion before and during the event
2. Attention to Detail – We tirelessly focus on the detail – this
is our key organisational trait
3. Build on Experience – we implement processes to embed
learnings and innovations from previous
races
4. Candour – we tell it like it is. We don’t sugar-coat
constructive criticism, and team members expect to
receive communication in this fashion. Candour must always be
executed with respect.
5. Communication – Our unique business environment, where
every team member’s work impacts on
other teams’ work, requires robust, pro-active communication.
It is acceptable that pro-active
communication is sometimes at the expense of personal
productivity.
6. Customer Focus – We provide unrivalled customer service to
our riders, sponsors, suppliers and
crew
7. Efficiency – we train, we mentor, we challenge and we
85. inspire ourselves and our colleagues to work
as efficiently as possible
8. Integrity – Don’t be a chop
9. Pioneering – We’re creating something without precedent in
the sport of mountain biking and
therefore are always willing to explore new ideas
10. Premium – We work with premium-quality brands and
suppliers to emphasise our status as the
world’s premier mountain bike race
11. Relationships – we seek to create and maintain personable
relationships between team members
with all our current and past partners including sponsors,
suppliers and crew.
12. Relentless Quest for Perfection – since our mission is to be
the premier race in the world, only
perfection is good enough, which negates the requirement for
comparison
13. Respect – We respect the function, input and time of every
other staff member. We respect every
team member for his or her contribution to our overall success
14. Results – We recognise effort, but results are king
15. Sports Participation – we love participating in sport, be it
ballet, karate, yoga or mountain biking.
Source: Constructed by authors based on discussion with staff at
Grandstand Management and email communica tion with
Kevin Vermaak, October 5, 2012.
A
u