The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
Flirting is Not Consent. Ask Everyone, Every Time” DesiShainaBoling829
“Flirting is Not Consent.
Ask Everyone, Every Time”
Designing, Implementing, and Evaluating a Health
Communication Campaign to Prevent Sexual Violence
CASESin PUBLIC HEALTHCOMMUNICATION & MARKETING
Peer-Reviewed Case Study
Suggested citation: Haas, E.J.; Mattson, M.; Wilkinson, K. “Flirting is Not Consent. Ask Everyone,
Every Time”: Designing, Implementing, and Evaluating a Health Communication Campaign to Prevent
Sexual Violence. Cases in Public Health Communication & Marketing. 2011;5:47-74. Available from:
www.casesjournal.org/volume5.
Volume V, Winter 2011
Emily Joy Haas, MA 1
Marifran Mattson, PhD 2
Kathlyn Wilkinson, MPH 3
www.casesjournal.org
1 Purdue University, Indiana Campus Sexual Assault Primary Prevention Project
and Brian Lamb School of Communication
2 Purdue University, Brian Lamb School of Communication
3 Purdue University, Student Health Center
Corresponding Author:
Emily Joy Haas, Purdue University Student Health Center,
601 Stadium Mall Drive, West Lafayette, IN 47907-2052. Email: [email protected]
48
www.casesjournal.org
Abstract
Research shows that sexual assault is one of the most pervasive
problems on college and university campuses. Some research also
indicates that sexual assault is the most common violent crime
committed in campus communities. This case study describes and
analyzes the development, implementation and evaluation of a
social marketing campaign for a university committed to the pri-
mary prevention of sexual violence. The Health Communication
Campaign Framework provided theoretical and practical guidance
for the working group during all phases of the campaign process.
Campaign messages were designed to educate students about what
consent is and to increase their comfort level in obtaining verbal,
sober consent before having sex. The campaign also is critically
analyzed with recommendations for how to address a sensitive is-
sue, such as sexual violence, in messages displayed throughout a
campus community.
Key Words: Social Marketing, Health Communication Campaign
Framework, Sexual Violence, Primary Prevention, Message Design
49
www.casesjournal.org
Introduction
Sexual violence is one of the most pervasive
problems on college and university cam-
puses,1 and the most common violent crime
committed in campus communities.2 Sexual
violence encompasses a range of offenses
that are perpetrated against someone’s will,
including a completed, nonconsensual sex
act; an attempted nonconsensual sex act;
and an abusive sexual contact.3 Every two
minutes someone is raped in the United
States (U.S.) and the chances of being raped
are four times greater for a female college
student than any other individual.4 Re-
search suggests that 3% of college women
are raped during a nine month academic
period and 20-25% of women experience a
completed or attempted rape during their
four to five years spent in college.5 Also,
a study of experiences among college stu-
d ...
Running head CULTURAL COMPETENCY AND TREATMENT .docxtodd271
Running head: CULTURAL COMPETENCY AND TREATMENT
CULTURAL COMPETENCY AND TREATMENT
Cultural Competency and Treatment of persons with mental illness
Alexis Lowe
Professor Patricia Coccoma
HUMN 6511- Treatment of Forensic Populations
June 16, 2019
Cultural Competency and Treatment of persons with mental illness
The culturally diverse forensic population that I chose to research is those who are mentally ill. This population is of particular interest to me because I have always wanted to work in agencies that do an intervention for members of this population and I have always felt that something should be done when I find helpless people on the streets who are mentally ill. Mentally ill persons can be described using characteristics which cut across the population but lean mostly to the side of those who have an extreme mental illness. Most of them experience financial distress, homelessness, lack of money to rent houses and dependence of social programs like social security. Others have violent behavior and remain dependent on mental services for a long time (Naylor et al., 2016). The mentally ill often commit small crimes and because of their health situation, they find themselves in difficult situations. According to Rickwood, 2006, mentally ill persons going through corrections procedures often suffer more psychological problems and this limits their chances of recovery.
The Unique Characteristics of Mentally Ill Patients
Rickwood explores the representation of the mentally ill in the criminal justice system. According to Rickwood, the mentally ill are over three times more represented in the criminal justice compared to the ordinary community and this is something of concern. In certain cultures, more persons who have a mental illness live in correction facilities compared to others. However, incarceration is seen to be a major cause of mental health problems due to some of the corrective measures that are employed. Depression among Hispanics is noted to be highest at slightly over 10%, followed by African Americans than Whites (Corin, 2017) Depression cuts across all age groups and genders in the recent past. According to Rickwood there is need to ensure that specialized and professional mental health services are provided in correctional facilities to ensure that the correction process does not negatively impact the victims. pre-release preparation and post-release follow-up are key areas that need a proper overhaul to ensure that the number of cases of relapse is reduced accordingly. Proper understanding of the cultural background of a patient is a major consideration in choosing treatment procedures and it ensures that the health service provider is cult rally aware of the implications of certain choices on certain groups of people. Cultural considerations affect beliefs about sickness, pain and where.
Assessment 7 Course Textbook Edberg, M. (2015). Essentials .docxdavezstarr61655
Assessment 7
Course Textbook: Edberg, M. (2015). Essentials of health behavior: Social and behavioral theory in public health (2nd ed.). Burlington, MA: Jones & Bartlett Learning.
Q.1 MUST BE ANSWERED ON SATURDAY, Mar. 10 NLT 10 PM EST (200 words A MUST for each question. Please provide reference for each question for each question. Keep them numbered.)
1. This unit provided the 10-step approach of putting a communication campaign together. Step 6 involves selecting the appropriate communication channels. Why would selecting the right channel or channels be so important? What would be some of the examples of those channels if you were trying to put a communication campaign together that was designed to increase awareness for young people about the need for physical exercise and better eating habits to address the problem of obesity?
2. What are some of the key components in the overall ecology of global health? Are these different from the ecological context for domestic health? If so, how? Please explain and provide supporting examples.
3. Does mobile technology and social media change the way communications theory can be applied? Or do these developments change the theory itself?
4. Imagine you are in charge of putting an anti-smoking communication campaign together (geared towards young adults) in your local community. Correctly identifying your target audience would be an important step. Who would be your target audience or audiences in this example? Are there any groups or sub-groups? Also, would you need to segment your audience in any way? Please address each of these questions and explain the overall importance of correctly identifying your target audience as part of your intended communication campaign.
Q.1 MUST BE ANSWERED ON SATURDAY, Mar. 10 NLT 10 PM EST (A PARAGRAPH ONLY)
Q. 1 Why is it important to specifically identify those individuals who are the most vulnerable in terms of getting a certain disease or diseases?
· Why do general or mainstream approaches typically not work on those high-risk populations or groups?
ARTICLE REVIEW (READ INSTRUCTIONS CAREFULLY AND PAY ATTENTION TO THE ITEM HIGHLIGHTED IN RED)
· MUST BE ANSWERED BY MONDAY, MAR. 12 NLT 10 PM EST
For this assignment, choose a peer-reviewed article to review. Use source that contains peer-reviewed articles, and find an article about a concept tied to the unit outcomes in this unit.
Write a three- to five-page review (not counting the cover page and references page) of the article that includes the following information:
Briefly introduce and summarize the article.
Identify the author’s main points.
Who is the author’s intended audience?
How does the article apply to this course? Does it support the information in your textbook?
How could the author expand on the main points?
The article must be no more than three years old. Use APA style when writing your review.
UNIT VII STUD.
From politics to marketing, from sociology to public health, surveys.docxlianaalbee2qly
From politics to marketing, from sociology to public health, surveys are routinely used for gathering information about an identified population. Surveys may cover a large swath of a population, such as the U.S. Census, or represent a microcosm of a larger population, such as a neighborhood public health survey.
In community health assessment, surveys are commonly used to explore an issue more widely than is possible through individual interviews or focus groups. Surveys may collect quantitative or qualitative data, or both. This week, you examine the use of surveys in community health assessment. Specifically, you consider the advantages and challenges of involving community members in both the design and implementation of surveys.
For this Discussion, review the Resources related to community involvement in survey design and implementation. Review the media titled
Surveys.
Consider some of the different ways that surveys were implemented and how the community was or was not involved in their design and implementation.
With these thoughts in mind:
3 pages of one advantage and one challenge of conducting community public health surveys and explain why. Describe one benefit and one limitation of involving the community in designing a survey and explain why. Then, describe one advantage and one challenge to involving the community in the implementation of a survey and explain why.
Be specific and use the Resources, media, and current literature to support your response.
.
SOCW 6311 wk 8 peer responses Respond to at least two collea.docxsamuel699872
SOCW 6311 wk 8 peer responses
Respond to at least two colleagues by doing all of the following:
Name first and references after every person
Indicate strengths of their needs assessment plan that will enable the needs assessments to yield support for the program that they want to develop.
Offer suggestions to improve the needs assessment plan in areas such as:
Defining the extent and scope of the need
Obtaining important information about the target population
Identifying issues that might affect the target population’s ability to access the program or services
Instructor wants lay out like this:
Respond to at least two colleagues ( 2 peers posts are provided) by doing all of the following:
Identify strengths of your colleagues’ analyses and areas in which the analyses could be improved.
Your response
Address his or her evaluation of the efficacy and applicability of the evidence-based practice,
Your response
[Evaluate] his or her identification of factors that could support or hinder the implementation of the evidence-based practice,
Your response
And [evaluate] his or her solution for mitigating those factors.
Your response
Offer additional insight to your colleagues by either identifying additional factors that may support or limit implementation of the evidence-based practice or an alternative solution for mitigating one of the limitations that your colleagues identified.
Your response
References
Your response
Peer 1: McKenna Bull
RE: Discussion - Week 8
COLLAPSE
Top of Form
Needs assessments are a form of research conducted to gather information about the needs of a population or a group in a community (Tutty & Rothery, 2010, p. 149). One purpose of a needs assessment is to explore in more depth whether a new program within an organization or agency is needed (Dudley, 2014, p. 117). Key questions of this type of needs assessment may revolve around: (1) whether there are enough prospective clients to warrant this type of program, (2) the different activities or programs that the respondents would be interested in using, priorities for some activities over others, (3) importance of the activities, and (4) times in which this program would be desired and used (Dudley, 2014, p. 117). Potential barriers for the implementation of a new program should also be assessed to ensure the best possible outcome. Some barriers to services could include factors such as: location, costs, potential need for fees, and possible psychological issues related to such things. The following is an assessment of an intensive outpatient program for youth, and a potential need that is currently being unmet.
Post a needs assessment plan for a potential program of your choice that meets a currently unmet need. Describe the unmet need and how current information supports your position that a needs assessment is warranted.
The intensive outpatient program (IOP) at Provo Canyon Behavioral H.
Flirting is Not Consent. Ask Everyone, Every Time” DesiShainaBoling829
“Flirting is Not Consent.
Ask Everyone, Every Time”
Designing, Implementing, and Evaluating a Health
Communication Campaign to Prevent Sexual Violence
CASESin PUBLIC HEALTHCOMMUNICATION & MARKETING
Peer-Reviewed Case Study
Suggested citation: Haas, E.J.; Mattson, M.; Wilkinson, K. “Flirting is Not Consent. Ask Everyone,
Every Time”: Designing, Implementing, and Evaluating a Health Communication Campaign to Prevent
Sexual Violence. Cases in Public Health Communication & Marketing. 2011;5:47-74. Available from:
www.casesjournal.org/volume5.
Volume V, Winter 2011
Emily Joy Haas, MA 1
Marifran Mattson, PhD 2
Kathlyn Wilkinson, MPH 3
www.casesjournal.org
1 Purdue University, Indiana Campus Sexual Assault Primary Prevention Project
and Brian Lamb School of Communication
2 Purdue University, Brian Lamb School of Communication
3 Purdue University, Student Health Center
Corresponding Author:
Emily Joy Haas, Purdue University Student Health Center,
601 Stadium Mall Drive, West Lafayette, IN 47907-2052. Email: [email protected]
48
www.casesjournal.org
Abstract
Research shows that sexual assault is one of the most pervasive
problems on college and university campuses. Some research also
indicates that sexual assault is the most common violent crime
committed in campus communities. This case study describes and
analyzes the development, implementation and evaluation of a
social marketing campaign for a university committed to the pri-
mary prevention of sexual violence. The Health Communication
Campaign Framework provided theoretical and practical guidance
for the working group during all phases of the campaign process.
Campaign messages were designed to educate students about what
consent is and to increase their comfort level in obtaining verbal,
sober consent before having sex. The campaign also is critically
analyzed with recommendations for how to address a sensitive is-
sue, such as sexual violence, in messages displayed throughout a
campus community.
Key Words: Social Marketing, Health Communication Campaign
Framework, Sexual Violence, Primary Prevention, Message Design
49
www.casesjournal.org
Introduction
Sexual violence is one of the most pervasive
problems on college and university cam-
puses,1 and the most common violent crime
committed in campus communities.2 Sexual
violence encompasses a range of offenses
that are perpetrated against someone’s will,
including a completed, nonconsensual sex
act; an attempted nonconsensual sex act;
and an abusive sexual contact.3 Every two
minutes someone is raped in the United
States (U.S.) and the chances of being raped
are four times greater for a female college
student than any other individual.4 Re-
search suggests that 3% of college women
are raped during a nine month academic
period and 20-25% of women experience a
completed or attempted rape during their
four to five years spent in college.5 Also,
a study of experiences among college stu-
d ...
Running head CULTURAL COMPETENCY AND TREATMENT .docxtodd271
Running head: CULTURAL COMPETENCY AND TREATMENT
CULTURAL COMPETENCY AND TREATMENT
Cultural Competency and Treatment of persons with mental illness
Alexis Lowe
Professor Patricia Coccoma
HUMN 6511- Treatment of Forensic Populations
June 16, 2019
Cultural Competency and Treatment of persons with mental illness
The culturally diverse forensic population that I chose to research is those who are mentally ill. This population is of particular interest to me because I have always wanted to work in agencies that do an intervention for members of this population and I have always felt that something should be done when I find helpless people on the streets who are mentally ill. Mentally ill persons can be described using characteristics which cut across the population but lean mostly to the side of those who have an extreme mental illness. Most of them experience financial distress, homelessness, lack of money to rent houses and dependence of social programs like social security. Others have violent behavior and remain dependent on mental services for a long time (Naylor et al., 2016). The mentally ill often commit small crimes and because of their health situation, they find themselves in difficult situations. According to Rickwood, 2006, mentally ill persons going through corrections procedures often suffer more psychological problems and this limits their chances of recovery.
The Unique Characteristics of Mentally Ill Patients
Rickwood explores the representation of the mentally ill in the criminal justice system. According to Rickwood, the mentally ill are over three times more represented in the criminal justice compared to the ordinary community and this is something of concern. In certain cultures, more persons who have a mental illness live in correction facilities compared to others. However, incarceration is seen to be a major cause of mental health problems due to some of the corrective measures that are employed. Depression among Hispanics is noted to be highest at slightly over 10%, followed by African Americans than Whites (Corin, 2017) Depression cuts across all age groups and genders in the recent past. According to Rickwood there is need to ensure that specialized and professional mental health services are provided in correctional facilities to ensure that the correction process does not negatively impact the victims. pre-release preparation and post-release follow-up are key areas that need a proper overhaul to ensure that the number of cases of relapse is reduced accordingly. Proper understanding of the cultural background of a patient is a major consideration in choosing treatment procedures and it ensures that the health service provider is cult rally aware of the implications of certain choices on certain groups of people. Cultural considerations affect beliefs about sickness, pain and where.
Assessment 7 Course Textbook Edberg, M. (2015). Essentials .docxdavezstarr61655
Assessment 7
Course Textbook: Edberg, M. (2015). Essentials of health behavior: Social and behavioral theory in public health (2nd ed.). Burlington, MA: Jones & Bartlett Learning.
Q.1 MUST BE ANSWERED ON SATURDAY, Mar. 10 NLT 10 PM EST (200 words A MUST for each question. Please provide reference for each question for each question. Keep them numbered.)
1. This unit provided the 10-step approach of putting a communication campaign together. Step 6 involves selecting the appropriate communication channels. Why would selecting the right channel or channels be so important? What would be some of the examples of those channels if you were trying to put a communication campaign together that was designed to increase awareness for young people about the need for physical exercise and better eating habits to address the problem of obesity?
2. What are some of the key components in the overall ecology of global health? Are these different from the ecological context for domestic health? If so, how? Please explain and provide supporting examples.
3. Does mobile technology and social media change the way communications theory can be applied? Or do these developments change the theory itself?
4. Imagine you are in charge of putting an anti-smoking communication campaign together (geared towards young adults) in your local community. Correctly identifying your target audience would be an important step. Who would be your target audience or audiences in this example? Are there any groups or sub-groups? Also, would you need to segment your audience in any way? Please address each of these questions and explain the overall importance of correctly identifying your target audience as part of your intended communication campaign.
Q.1 MUST BE ANSWERED ON SATURDAY, Mar. 10 NLT 10 PM EST (A PARAGRAPH ONLY)
Q. 1 Why is it important to specifically identify those individuals who are the most vulnerable in terms of getting a certain disease or diseases?
· Why do general or mainstream approaches typically not work on those high-risk populations or groups?
ARTICLE REVIEW (READ INSTRUCTIONS CAREFULLY AND PAY ATTENTION TO THE ITEM HIGHLIGHTED IN RED)
· MUST BE ANSWERED BY MONDAY, MAR. 12 NLT 10 PM EST
For this assignment, choose a peer-reviewed article to review. Use source that contains peer-reviewed articles, and find an article about a concept tied to the unit outcomes in this unit.
Write a three- to five-page review (not counting the cover page and references page) of the article that includes the following information:
Briefly introduce and summarize the article.
Identify the author’s main points.
Who is the author’s intended audience?
How does the article apply to this course? Does it support the information in your textbook?
How could the author expand on the main points?
The article must be no more than three years old. Use APA style when writing your review.
UNIT VII STUD.
From politics to marketing, from sociology to public health, surveys.docxlianaalbee2qly
From politics to marketing, from sociology to public health, surveys are routinely used for gathering information about an identified population. Surveys may cover a large swath of a population, such as the U.S. Census, or represent a microcosm of a larger population, such as a neighborhood public health survey.
In community health assessment, surveys are commonly used to explore an issue more widely than is possible through individual interviews or focus groups. Surveys may collect quantitative or qualitative data, or both. This week, you examine the use of surveys in community health assessment. Specifically, you consider the advantages and challenges of involving community members in both the design and implementation of surveys.
For this Discussion, review the Resources related to community involvement in survey design and implementation. Review the media titled
Surveys.
Consider some of the different ways that surveys were implemented and how the community was or was not involved in their design and implementation.
With these thoughts in mind:
3 pages of one advantage and one challenge of conducting community public health surveys and explain why. Describe one benefit and one limitation of involving the community in designing a survey and explain why. Then, describe one advantage and one challenge to involving the community in the implementation of a survey and explain why.
Be specific and use the Resources, media, and current literature to support your response.
.
SOCW 6311 wk 8 peer responses Respond to at least two collea.docxsamuel699872
SOCW 6311 wk 8 peer responses
Respond to at least two colleagues by doing all of the following:
Name first and references after every person
Indicate strengths of their needs assessment plan that will enable the needs assessments to yield support for the program that they want to develop.
Offer suggestions to improve the needs assessment plan in areas such as:
Defining the extent and scope of the need
Obtaining important information about the target population
Identifying issues that might affect the target population’s ability to access the program or services
Instructor wants lay out like this:
Respond to at least two colleagues ( 2 peers posts are provided) by doing all of the following:
Identify strengths of your colleagues’ analyses and areas in which the analyses could be improved.
Your response
Address his or her evaluation of the efficacy and applicability of the evidence-based practice,
Your response
[Evaluate] his or her identification of factors that could support or hinder the implementation of the evidence-based practice,
Your response
And [evaluate] his or her solution for mitigating those factors.
Your response
Offer additional insight to your colleagues by either identifying additional factors that may support or limit implementation of the evidence-based practice or an alternative solution for mitigating one of the limitations that your colleagues identified.
Your response
References
Your response
Peer 1: McKenna Bull
RE: Discussion - Week 8
COLLAPSE
Top of Form
Needs assessments are a form of research conducted to gather information about the needs of a population or a group in a community (Tutty & Rothery, 2010, p. 149). One purpose of a needs assessment is to explore in more depth whether a new program within an organization or agency is needed (Dudley, 2014, p. 117). Key questions of this type of needs assessment may revolve around: (1) whether there are enough prospective clients to warrant this type of program, (2) the different activities or programs that the respondents would be interested in using, priorities for some activities over others, (3) importance of the activities, and (4) times in which this program would be desired and used (Dudley, 2014, p. 117). Potential barriers for the implementation of a new program should also be assessed to ensure the best possible outcome. Some barriers to services could include factors such as: location, costs, potential need for fees, and possible psychological issues related to such things. The following is an assessment of an intensive outpatient program for youth, and a potential need that is currently being unmet.
Post a needs assessment plan for a potential program of your choice that meets a currently unmet need. Describe the unmet need and how current information supports your position that a needs assessment is warranted.
The intensive outpatient program (IOP) at Provo Canyon Behavioral H.
PowerPoint Presentation #1TOPIC- Mental health illness in adults w.docxIRESH3
PowerPoint Presentation #1
TOPIC- Mental health illness in adults with substance abuse
The
Assessment
must include epidemiological methods including, but not limited to the following items:
Descriptive information on the target population (e.g., age, gender, culture, ethnicity) and location (e.g., city, town, state).
Identification through assessment means of the health issue/problem and how it has affected the target population (information on impact could come from mortality and morbidity reports, academic research, etc. Avoid using online sources such as WebMD. Government sources are fine, but the Ashford Library’s journal collection is the best means to discover data on health impact.)
Risk factors as outlined by epidemiological means (risk factors include social and behavioral determinants within the community or among the population that contributes to or ameliorates this problem).
Other demographic information outlined by epidemiological assessment measures.
Explain how the two essential services that revolve around assessment are applied to this health problem: 1) Monitor Health and 2) Diagnose and Investigate. These two services ensure that a community’s health assessment is accurate.
Policy Development Actions
Describe what has been done in general to address the issue (e.g. resources, facilities, organizations). Locate scholarly sources from the Ashford University Library to help you address what has already been done to address the issue.
Describe what has been done specifically in the community/city/town/state your team is researching to address this issue (e.g., programs and interventions or the creation of organizations to address the issue).
Existing Policies. Analyze the policies that currently exist to resolve the problem. For example: seatbelts were required by car manufacturers to reduce injuries and deaths from car accidents.
Policy Development. Discuss new policies that should or could be developed to better address the issue. For example: some communities do not fluoridate their water systems and developing such a policy could help reduce dental caries.
Identify Stakeholders and potential facilitators. Are there leaders and/or organizations within this community that can be identified and assist with the policy development? Who are they and why would you specifically select them?
Explain how the three essential services that fall into the Policy Development category are applied to your health problem: 3) Inform, Educate and Empower; 4) Mobilize Community Partnerships; and 5) Develop Policies.
PowerPoint Presentation #2
Assurance Activities
: Now that the assessment and policy development actions have been outlined, provide assurances to the affected community that what has been or will be done will be effective and sustaining. With each of the four essential services associated with assurance, analyze how these factors will be applied to the selected health problem for this population. The key terms in eac.
Promoting Health Equity A Resource to Help Communities Add.docxbriancrawford30935
Promoting Health Equity
A Resource to Help Communities Address
Social Determinants of Health
Cover art is based on original art by Chris Ree developed for the Literacy for Environmental Justice/Youth
Envision Good Neighbor program, which addresses links between food security and the activities of
transnational tobacco companies in low-income communities and communities of color in San Francisco. In
partnership with city government, community-based organizations, and others, Good Neighbor provides
incentives to inner-city retailers to increase their stocks of fresh and nutritious foods and to reduce tobacco
and alcohol advertising in their stores (see Case Study # 6 on page 24. Adapted and used with permission.).
Promoting Health Equity
A Resource to Help Communities Address
Social Determinants of Health
Laura K. Brennan Ramirez, PhD, MPH
Transtria L.L.C.
Elizabeth A. Baker, PhD, MPH
Saint Louis University School of Public Health
Marilyn Metzler, RN
Centers for Disease Control and Prevention
This document is published in partnership
with the Social Determinants of Health
Work Group at the Centers for Disease
Control and Prevention, U.S. Department of
Health and Human Services.
1
Suggested Citation
Brennan Ramirez LK, Baker EA, Metzler M. Promoting Health Equity: A Resource
to Help Communities Address Social Determinants of Health. Atlanta: U.S.
Department of Health and Human Services, Centers for Disease Control and
Prevention; 2008.
For More Information
E-mail: [email protected]
Mail: Community Health and Program Services Branch
Division of Adult and Community Health
National Center for Chronic Disease Prevention and Health Promotion
Centers for Disease Control and Prevention
4770 Buford Highway, Mail Stop K–30
Atlanta, GA 30041
E-mail: [email protected]
Mail: Laura Brennan Ramirez, Transtria L.L.C.
6514 Lansdowne Avenue
Saint Louis, MO 63109
Online: This publication is available at
http://www.cdc.gov/nccdphp/dach/chaps
and http://www.transtria.com.
Acknowledgements
The authors would like to thank the following people for their valuable contributions to
the publication of this resource: the workshop participants (listed on page 5), Lynda
Andersen, Ellen Barnidge, Adam Becker, Joe Benitez, Julie Claus, Sandy Ciske, Tonie
Covelli, Gail Gentling, Wayne Giles, Melissa Hall, Donna Higgins, Bethany Young
Holt, Jim Holt, Bill Jenkins, Margaret Kaniewski, Joe Karolczak, Leandris Liburd, Jim
Mercy, Eveliz Metellus, Amanda Navarro, Geraldine Perry, Amy Schulz, Eduardo
Simoes, Kristine Suozzi and Karen Voetsch. A special thanks to Innovative Graphic
Services for the design and layout of this book.
This resource was developed with support from:
> National Center for Chronic Disease Prevention and Health Promotion
Division of Adult and Community Health
Prevention Research Centers
Community Health and Program Services Branch
> National Center f.
Chapter 16 Community Diagnosis, Planning, and InterventionSergEstelaJeffery653
Chapter 16 Community Diagnosis, Planning, and Intervention
Sergio Osegueda Acuna MSN-FNP-BC
MRC
Nursing Process with communities
Population-focused health planning
Health planning is a continuous social process by which data about clients are collected and analyzed for the purpose of developing a plan to generate new ideas, meet identified client needs, solve health problems, and guide changes in health care delivery.
To date, you have been responsible primarily for developing a plan of care for the individual client.
History of U.S. Health Planning
The history of health planning in the United States has alternated between the federal and state governments.
Before the 1960s, health planning occurred primarily at the state level.
In the 1960s, health planning became a federal effort.
In 1966, the Comprehensive Health Planning and Public Health Service Amendment was passed to enable states and local communities to plan for better health resources.
In the 1980s, President Reagan aimed to reduce both the size of the federal government and the influence the federal government had on states. His administration eliminated the federal budget and planning requirements while encouraging states to make their own planning decisions.
History of U.S. Health Planning
In 1980, the Omnibus Budget Reconciliation Act encouraged the use of noninstitutional services, such as home health care, to fight escalating costs.
In 1983 the Prospective Payment System drastically changed hospital reimbursement, resulted in shorter hospital stays for patients, shifted care into the community, and placed greater responsibilities for care of relatives on family members
The federal Patient Protection and Affordable Care Act (Affordable Care Act) of 2010 requires access to health care for most Americans.
Rationale for Nursing Involvement in the Health Planning Process
Florence Nightingale and Lillian Wald pioneered health planning based on an assessment of the health needs of the communities they served
Both the American Nurses Association (ANA) (2007) and the American Public Health Association (APHA) (1996) state that the primary responsibility of community/public health nurses is to the community or population as a whole and that nurses must acknowledge the need for comprehensive health planning to implement this responsibility.
Nurses spend a greater amount of time in direct contact with their clients than do any other health care professionals.
Nursing Role in Program Planning
Planning for change at the community level is more complex than at the individual level.
Components to the client system have been increased, and more people and more complex organizations are involved.
Baccalaureate-prepared community/public nurses are expected to apply the nursing process with subpopulations or aggregates with limited supervision (American Association of Colleges of Nursing, 1986; ANA, 2007)
Planning for community change
To plan and implement programs at a commu ...
OverviewPrepare a 3–4 page report on a critical health issue in .docxaman341480
Overview
Prepare a 3–4 page report on a critical health issue in a community or state. Describe the factors that contribute to the health issue and interventions that have been implemented. Explain the scope and role of nursing in the interventions, and recommend ways the scope of the interventions might be expanded.
By successfully completing this assessment, you will demonstrate your proficiency in the following course competencies and assessment criteria:
· Competency 1: Explain the factors that affect the health of communities.
. Explain the factors that contribute to a critical health care issue within a specific community.
· Competency 2: Apply evidence-based interventions to promote health and disease prevention and respond to community health issues.
. Describe current interventions to target a critical health care issue within a specific community.
. Describe the scope and role of nursing in current interventions that target a critical health care issue.
. Recommend evidence-based ways to expand the scope of interventions to target a critical health care issue.
· Competency 4: Communicate in a manner that is scholarly, professional, and consistent with expectations of a nursing professional.
. Describe a critical health care issue within a specific community.
. Write content clearly and logically with correct use of grammar, punctuation, and mechanics.
. Correctly format citations and references, using current APA style.
Context
Community/public health nursing is nursing care that is population-focused and occurs in non-hospital settings. Numerous nursing theories can provide the structure for community/public health nursing; however, nursing theories that incorporate components of the general systems theory frequently provide the framework for the practice of community/public health nursing.
Historically, nurses have made significant contributions to the field of public health. From providing maternal-child care to poor women in the late 1800s, to promoting hygiene among school aged children in the early 1900s, to providing environmental and safety care to industrial workers during World War I, nurses have been instrumental in shaping health policies (Maurer & Smith, 2013). Today, community/public health nurses have a key role in identifying and developing plans of care to address local, national, and international health issues.
Many factors influence the health of communities and populations, including national policies that focus on health promotion. Healthy People, a major national health promotion program issued by the U.S. Surgeon General, identifies major health problems of the nation and sets national goals and objectives targeting health promotion (Maurer & Smith, 2013). If adopted, activities that target health promotion can result in disease prevention.
Reference
Maurer, F. A., & Smith, C. M. (2013). Community/public health nursing practice: Health for families and populations (5th ed.). St. Louis, MO: W. B. Saunder.
WORLD HEALTH COMMUNICATION ASSOCIATES Campaign Develo.docxambersalomon88660
WORLD HEALTH COMMUNICATION ASSOCIATES
Campaign Development Workshop
Izhevsk
22-24 SEPTEMBER 2009
Background Paper and Planning Template
Franklin Apfel
World Health Communication Associates Ltd
- 2 -
Background
Coordinators and key stakeholders from Cherepovets, Dimitrovgrad, Izhevsk and
Stavropol are being were convened in this third training session of the We Choose Life
Youth Against HIV AIDS Project to explore ways in which they can develop campaigns
that will address identified needs and gaps in current HIV /AIDS communications,
enhance HIV/AIDS literacy amongst key target groups, especially youth; “engage the
unengaged”; overcome obstacles and strengthen the reach and impact of current
prevention and treatment services.
This campaign development workshop builds on the Stakeholder and Youth Volunteer
Network activities to date; in particular the youth behavioural surveys.
The workshop will serve to help each of the cities finalise campaign plans and will utilize
data collected by each city prior to the meeting see campaign development
planning questions below. The three day workshop will be include sessions on
communications as a determinant of health, formative communication research, issue
framing, an advocacy framework , practical campaign planning exercises, issues
related to social marketing, working with media, media advocacy, and campaign
evaluation. There will be both lectures, group work and discussion sessions.
Workshop Objectives
The overall aim of the project is to reduce the disease burden related to HIV/AIDS
amongst youth in participating cities.
The key objective of the workshop is to assist each city stakeholder team to agree and
finalise plans for a youth focused HIV/AIDS communication campaign that will raise
awareness and stimulate healthy behaviors, choices and policies.
As a secondary benefit of this process the workshop aims to enhance participants’
capacities in health communications, communication related research, advocacy,
social marketing as well as working with media.
It is further anticipated that the skills developed for this specific project should be
generalisable to other key public health communication challenges.
Pre-workshop activities- Some questions to answer
Each city is asked to carry out a series of tasks that is aimed at collecting data needed
for effective campaign planning. Reach city will customize their own campaign plans
aimed at enhancing HIV/AIDS prevention and treatment information, education and
public awareness (and supportive policies) by stimulating demand for information and
engaging and strengthening the capacity of health leaders, people living with
HIV/AIDS (PLWHA) and information mediators, e.g. health professionals, media, policy
spokespeople, NGO advocates, and private sector advertisers, to respond effectively.
- 3 -
The reason communications is being emphasized relates to the fac.
Health Communication in the United StatesCase Studies and Less.docxpooleavelina
Health Communication in the United States
Case Studies and Lessons from the Field
Chapter 15
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Overview/Objectives
Review case studies and draw lessons that can be learned through the process of designing, implementing and evaluating a health communication intervention
Provide materials that can be used as a framework for discussion, applied to professional experience, and be used to identify other suitable communication approaches, strategies and activities
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Case Studies
WhyWellness: Communicating about mental health within a gaming community
BodyLove
New Media and the VERB campaign
Health Equity Exchange: Using an integrated multimedia communication approach to engage US communities on health equity
Raising awareness of sustainable food issues and building community via the integrated use of new media with other communication approaches
What do sidewalks have to do with health?
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Emerging Trends and Lessons
Reach people how and where they want to be reached or find themselves frequently
Use multisectoral partnership as a key approach
Understand social support as an emerging theme associated with helping people adopt and maintain healthy behaviors
Consider peer-to-peer communication as an important strategy in reaching out to older children, tweens, teens, and other vulnerable or at-risk groups
Engage communities, their leaders, and other community mobilization partners
Integrate different media and communication areas at the very outset of the communication program
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Emerging Trends and Lessons
Be aware that online and new media-based interventions have a longer lifespan that goes beyond program funding and duration
Recognize that many complex issues are community-specific and should be addressed by community-driven solutions
Consider policymakers not only as key decision makers for policy change, but also as key partners in community mobilization and public engagement
Look for links among different fields and issues in addressing health and social issues
Increase the appeal of messages and materials via the strategic use of videos, animation, and other graphic or visual devices that contribute to message simplicity
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Case Study 1
WhyWellness: Communicating about mental health within a gaming community
Case Study Discussion
What do you know about online virtual worlds and how does your knowle ...
httphpp.sagepub.comHealth Promotion Practice http.docxMARRY7
http://hpp.sagepub.com/
Health Promotion Practice
http://hpp.sagepub.com/content/10/1/24
The online version of this article can be found at:
DOI: 10.1177/1524839906289048
2009 10: 24Health Promot Pract
Katz
Kari A. Hartwig, Richard Louis Dunville, Michael H. Kim, Becca Levy, Margot M. Zaharek, Valentine Y. Njike and David L.
Promoting Healthy People 2010 Through Small Grants
Published by:
http://www.sagepublications.com
On behalf of:
Society for Public Health Education
can be found at:Health Promotion PracticeAdditional services and information for
http://hpp.sagepub.com/cgi/alertsEmail Alerts:
http://hpp.sagepub.com/subscriptionsSubscriptions:
http://www.sagepub.com/journalsReprints.navReprints:
http://www.sagepub.com/journalsPermissions.navPermissions:
http://hpp.sagepub.com/content/10/1/24.refs.htmlCitations:
What is This?
- Dec 30, 2008Version of Record >>
at WALDEN UNIVERSITY on December 8, 2014hpp.sagepub.comDownloaded from at WALDEN UNIVERSITY on December 8, 2014hpp.sagepub.comDownloaded from
http://hpp.sagepub.com/
http://hpp.sagepub.com/content/10/1/24
http://www.sagepublications.com
http://www.sophe.org
http://hpp.sagepub.com/cgi/alerts
http://hpp.sagepub.com/subscriptions
http://www.sagepub.com/journalsReprints.nav
http://www.sagepub.com/journalsPermissions.nav
http://hpp.sagepub.com/content/10/1/24.refs.html
http://hpp.sagepub.com/content/10/1/24.full.pdf
http://online.sagepub.com/site/sphelp/vorhelp.xhtml
http://hpp.sagepub.com/
http://hpp.sagepub.com/
Promoting Healthy People 2010
Through Small Grants
Kari A. Hartwig, DrPH
Richard Louis Dunville, MPH
Michael H. Kim, MPH
Becca Levy, PhD
Margot M. Zaharek, MS
Valentine Y. Njike, MD, MPH
David L. Katz, MD, MPH
objectives (U.S. Department of Health and Human
Services [DHHS], 2000a). Today’s Healthy People 2010
(HP 2010) goals and objectives build on the previous
two decades’ accomplishments and set national targets
for reducing disease and disability and promoting
healthier, longer lives (DHHS, 2000b). Led by the U.S.
DHHS, the overarching goals of the current initiative
are to increase quality and years of life and to eliminate
health disparities (Davis, 2000; DHHS, 2003). DHHS
(2001) encourages working through communities and
local organizations to influence individual behavior
and the promotion and maintenance of environments
conducive to healthier lifestyles.
>>BACKGROUND
Building on the health promotion premise that orga-
nizations and communities are instruments of change
(McLeroy, Bibeau, Steckler, & Glanz, 1988; Stokols,
1992), the DHHS Office of Disease Prevention and
Health Promotion (ODPHP) initiated a pilot study in
October 2001 to develop a national model for engaging
community organizations in health promotion and dis-
ease prevention activities that reflect the national HP
2010 goals and objectives. ODPHP awarded the Healthy
People 2010 Microgrant Project, one of two pilot stud-
ies, to Yale Univer ...
A Public Health Approach to Mental Health Care: Taking Transformation to ScaleMHTP Webmastere
This presentation was given by Kathryn Power, Director, Center for Mental Health Services at SAMHSA, at the May 13, 2008 Prevention Policy Summit. Transcript of Kathryn Power\'s opening remarks.
Budget RESEARCHBudget Template - page 1 of 2GRANT(For Internal Use.docxAASTHA76
Budget RESEARCHBudget Template - page 1 of 2GRANT(For Internal Use Only - see specific sponsoringTitle:Union County of Georgia cancer prevention programagency for the proper forms)Date:12-May-17RFA no.PI:Project Period:2017/2018Budget Period:2017-2018Year 1Field researchResearch assitants( Salaries & benefits)250,000Transport120,000Research tools( questionaires and interviews)50,000420,000Screening actvitiesLocal hospital staff service fees80,000Electricity consumed by equipment20,000Maintenace expenses40,000140,000MarketingNutrionists service fees150,000Local gym service15,000Formation of chamber fo commerce180,000Education workshops ( schools and community centers)50,000395,000
pasterme:
rate as of 7/1/05
subject to change
confirm with the SPH
Business Office
pasterme:
part-time student rate as of 7/1/04 subject to change confirm with the SPH Business Office
pasterme:
rate subject to change Please review all budgets with the SPH
Business Office.
Running head: COMMUNITY COALITION 1
COMMUNITY COALITION 3
Community Coalition
Kimberly Crawford
Kaplan University
January 8, 2018
Community Coalition
1. Choose 5 partnerships to engage and explain why you would invite each of these people//organizations to be a part of the coalition.
The creation of community health promotion and education programs takes into consideration several agencies or parties who help in the achievement of the desired health goals. Each of the partners will address its roles using different approaches depending on their area of expertise. This is an important factor to consider as different institutions address health promotion using different approaches and perspectives. The overall outcome from the contribution of every partner should be able to restore and promote the physical, emotional, spiritual, psychological, and social wellness of the community in relation to the health issue being suffered (Minelli, & Breckon, 2009). Chronic diseases are currently the leading causes of death in the community due to their complexity and the severe effects on human health. The community health promotion and education program will be provided by the ‘Health Concerns Coalition’ which will be made up of the following partners; community religious groups, Cancer Supportive Care Foundation, an association of cancer-survivor patients, nutritional organizations, and the local authority.
1. Cancer Supportive Care Foundation – This is an important part of the coalition as it will offer technical expertise in education and diagnosis of chronic diseases. The foundation team will include medical experts who will diagnose the community members of any chronic illnesses. Examinations for diseases such as breast cancer, prostate cancer, diabetes and blood pressure will be conducted by this partner as they will provide modern machines needed for the diagnosis of chronic illnesses.
2. Community religious groups – Community religious groups ca ...
Running Head ENVIRONMENTAL HEALTH1ENVIRONMENTAL HEALTH8.docxtodd271
Running Head: ENVIRONMENTAL HEALTH 1
ENVIRONMENTAL HEALTH 8
Environmental Health
Student Name: Kusum Syangbo
Instructor Name: Elizabeth Wachira
Course no: HHPH- 382-01W
Date: April 5, 2020
Texas A&M University, Commerce
Abstract
Environmental health is both a public health and social justice issue. This paper will describe how environmental health is both a public health and social injustice issue and some of the environmental injustices in the United States. It will also explain the functions of environmental health movements in the US. Finally, the paper will describe some of the intervention opportunities in curbing environmental injustices including health education, advocacy, policy, leadership opportunities, and community focus and give my future leadership role as far as environmental health is concerned.
Keywords
Environmental health, public health, social injustice, minority groups
Section 1: Topic Description
The topic that I chose is Environmental Health. This topic is a public health issue because the environment in which we live in shapes our health every moment of every day. Our health can be affected by what we eat, where we live, and how we interact with the world around us. That is where environmental health professionals, programs and policies, all come into play. Environmental health is a large field in public health because of the numerous ways exterior factors can impact how we live, grow and, even eat. These factors concern how we address our natural environment like sanitation and clean water, but they are also the consequences of our actions as human beings (Krometis et al, 2017).
Environmental Health is also a social justice issue because all the conversations about protecting habitats, mitigating climate change and recycling are not just about saving and protecting the earth, they are more about the struggle for protecting and providing basic human rights to good health. Every human being is entitled to quality air, clean water, and sanitation (Marmot, 2017).
Section 2: Social Injustice
Two Environmental Social Injustices
One major environmental social injustice is the disproportional placing of dangerous waste amenities in poor and largely ethnic and racial minority localities. Research shows that there are ethnic and racial discrepancies in the locations of dangerous waste across the United States. As a result of these injustices people living in such an environment have developed diseases like cancer.
Another social injustice is the environmental influence on healthy eating, physical activity, and obesity in ethnic and racial minority communities with low income. The principal concern here is the deprivation amplification such that in locations where have little individual resources, the local amenities that help people to live healthily, are poorer than those in non-socially and non-impoverished deprived places. Research has shown that t.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1. This week, we learned about the balanced scorecard and dashboar
PowerPoint Presentation #1TOPIC- Mental health illness in adults w.docxIRESH3
PowerPoint Presentation #1
TOPIC- Mental health illness in adults with substance abuse
The
Assessment
must include epidemiological methods including, but not limited to the following items:
Descriptive information on the target population (e.g., age, gender, culture, ethnicity) and location (e.g., city, town, state).
Identification through assessment means of the health issue/problem and how it has affected the target population (information on impact could come from mortality and morbidity reports, academic research, etc. Avoid using online sources such as WebMD. Government sources are fine, but the Ashford Library’s journal collection is the best means to discover data on health impact.)
Risk factors as outlined by epidemiological means (risk factors include social and behavioral determinants within the community or among the population that contributes to or ameliorates this problem).
Other demographic information outlined by epidemiological assessment measures.
Explain how the two essential services that revolve around assessment are applied to this health problem: 1) Monitor Health and 2) Diagnose and Investigate. These two services ensure that a community’s health assessment is accurate.
Policy Development Actions
Describe what has been done in general to address the issue (e.g. resources, facilities, organizations). Locate scholarly sources from the Ashford University Library to help you address what has already been done to address the issue.
Describe what has been done specifically in the community/city/town/state your team is researching to address this issue (e.g., programs and interventions or the creation of organizations to address the issue).
Existing Policies. Analyze the policies that currently exist to resolve the problem. For example: seatbelts were required by car manufacturers to reduce injuries and deaths from car accidents.
Policy Development. Discuss new policies that should or could be developed to better address the issue. For example: some communities do not fluoridate their water systems and developing such a policy could help reduce dental caries.
Identify Stakeholders and potential facilitators. Are there leaders and/or organizations within this community that can be identified and assist with the policy development? Who are they and why would you specifically select them?
Explain how the three essential services that fall into the Policy Development category are applied to your health problem: 3) Inform, Educate and Empower; 4) Mobilize Community Partnerships; and 5) Develop Policies.
PowerPoint Presentation #2
Assurance Activities
: Now that the assessment and policy development actions have been outlined, provide assurances to the affected community that what has been or will be done will be effective and sustaining. With each of the four essential services associated with assurance, analyze how these factors will be applied to the selected health problem for this population. The key terms in eac.
Promoting Health Equity A Resource to Help Communities Add.docxbriancrawford30935
Promoting Health Equity
A Resource to Help Communities Address
Social Determinants of Health
Cover art is based on original art by Chris Ree developed for the Literacy for Environmental Justice/Youth
Envision Good Neighbor program, which addresses links between food security and the activities of
transnational tobacco companies in low-income communities and communities of color in San Francisco. In
partnership with city government, community-based organizations, and others, Good Neighbor provides
incentives to inner-city retailers to increase their stocks of fresh and nutritious foods and to reduce tobacco
and alcohol advertising in their stores (see Case Study # 6 on page 24. Adapted and used with permission.).
Promoting Health Equity
A Resource to Help Communities Address
Social Determinants of Health
Laura K. Brennan Ramirez, PhD, MPH
Transtria L.L.C.
Elizabeth A. Baker, PhD, MPH
Saint Louis University School of Public Health
Marilyn Metzler, RN
Centers for Disease Control and Prevention
This document is published in partnership
with the Social Determinants of Health
Work Group at the Centers for Disease
Control and Prevention, U.S. Department of
Health and Human Services.
1
Suggested Citation
Brennan Ramirez LK, Baker EA, Metzler M. Promoting Health Equity: A Resource
to Help Communities Address Social Determinants of Health. Atlanta: U.S.
Department of Health and Human Services, Centers for Disease Control and
Prevention; 2008.
For More Information
E-mail: [email protected]
Mail: Community Health and Program Services Branch
Division of Adult and Community Health
National Center for Chronic Disease Prevention and Health Promotion
Centers for Disease Control and Prevention
4770 Buford Highway, Mail Stop K–30
Atlanta, GA 30041
E-mail: [email protected]
Mail: Laura Brennan Ramirez, Transtria L.L.C.
6514 Lansdowne Avenue
Saint Louis, MO 63109
Online: This publication is available at
http://www.cdc.gov/nccdphp/dach/chaps
and http://www.transtria.com.
Acknowledgements
The authors would like to thank the following people for their valuable contributions to
the publication of this resource: the workshop participants (listed on page 5), Lynda
Andersen, Ellen Barnidge, Adam Becker, Joe Benitez, Julie Claus, Sandy Ciske, Tonie
Covelli, Gail Gentling, Wayne Giles, Melissa Hall, Donna Higgins, Bethany Young
Holt, Jim Holt, Bill Jenkins, Margaret Kaniewski, Joe Karolczak, Leandris Liburd, Jim
Mercy, Eveliz Metellus, Amanda Navarro, Geraldine Perry, Amy Schulz, Eduardo
Simoes, Kristine Suozzi and Karen Voetsch. A special thanks to Innovative Graphic
Services for the design and layout of this book.
This resource was developed with support from:
> National Center for Chronic Disease Prevention and Health Promotion
Division of Adult and Community Health
Prevention Research Centers
Community Health and Program Services Branch
> National Center f.
Chapter 16 Community Diagnosis, Planning, and InterventionSergEstelaJeffery653
Chapter 16 Community Diagnosis, Planning, and Intervention
Sergio Osegueda Acuna MSN-FNP-BC
MRC
Nursing Process with communities
Population-focused health planning
Health planning is a continuous social process by which data about clients are collected and analyzed for the purpose of developing a plan to generate new ideas, meet identified client needs, solve health problems, and guide changes in health care delivery.
To date, you have been responsible primarily for developing a plan of care for the individual client.
History of U.S. Health Planning
The history of health planning in the United States has alternated between the federal and state governments.
Before the 1960s, health planning occurred primarily at the state level.
In the 1960s, health planning became a federal effort.
In 1966, the Comprehensive Health Planning and Public Health Service Amendment was passed to enable states and local communities to plan for better health resources.
In the 1980s, President Reagan aimed to reduce both the size of the federal government and the influence the federal government had on states. His administration eliminated the federal budget and planning requirements while encouraging states to make their own planning decisions.
History of U.S. Health Planning
In 1980, the Omnibus Budget Reconciliation Act encouraged the use of noninstitutional services, such as home health care, to fight escalating costs.
In 1983 the Prospective Payment System drastically changed hospital reimbursement, resulted in shorter hospital stays for patients, shifted care into the community, and placed greater responsibilities for care of relatives on family members
The federal Patient Protection and Affordable Care Act (Affordable Care Act) of 2010 requires access to health care for most Americans.
Rationale for Nursing Involvement in the Health Planning Process
Florence Nightingale and Lillian Wald pioneered health planning based on an assessment of the health needs of the communities they served
Both the American Nurses Association (ANA) (2007) and the American Public Health Association (APHA) (1996) state that the primary responsibility of community/public health nurses is to the community or population as a whole and that nurses must acknowledge the need for comprehensive health planning to implement this responsibility.
Nurses spend a greater amount of time in direct contact with their clients than do any other health care professionals.
Nursing Role in Program Planning
Planning for change at the community level is more complex than at the individual level.
Components to the client system have been increased, and more people and more complex organizations are involved.
Baccalaureate-prepared community/public nurses are expected to apply the nursing process with subpopulations or aggregates with limited supervision (American Association of Colleges of Nursing, 1986; ANA, 2007)
Planning for community change
To plan and implement programs at a commu ...
OverviewPrepare a 3–4 page report on a critical health issue in .docxaman341480
Overview
Prepare a 3–4 page report on a critical health issue in a community or state. Describe the factors that contribute to the health issue and interventions that have been implemented. Explain the scope and role of nursing in the interventions, and recommend ways the scope of the interventions might be expanded.
By successfully completing this assessment, you will demonstrate your proficiency in the following course competencies and assessment criteria:
· Competency 1: Explain the factors that affect the health of communities.
. Explain the factors that contribute to a critical health care issue within a specific community.
· Competency 2: Apply evidence-based interventions to promote health and disease prevention and respond to community health issues.
. Describe current interventions to target a critical health care issue within a specific community.
. Describe the scope and role of nursing in current interventions that target a critical health care issue.
. Recommend evidence-based ways to expand the scope of interventions to target a critical health care issue.
· Competency 4: Communicate in a manner that is scholarly, professional, and consistent with expectations of a nursing professional.
. Describe a critical health care issue within a specific community.
. Write content clearly and logically with correct use of grammar, punctuation, and mechanics.
. Correctly format citations and references, using current APA style.
Context
Community/public health nursing is nursing care that is population-focused and occurs in non-hospital settings. Numerous nursing theories can provide the structure for community/public health nursing; however, nursing theories that incorporate components of the general systems theory frequently provide the framework for the practice of community/public health nursing.
Historically, nurses have made significant contributions to the field of public health. From providing maternal-child care to poor women in the late 1800s, to promoting hygiene among school aged children in the early 1900s, to providing environmental and safety care to industrial workers during World War I, nurses have been instrumental in shaping health policies (Maurer & Smith, 2013). Today, community/public health nurses have a key role in identifying and developing plans of care to address local, national, and international health issues.
Many factors influence the health of communities and populations, including national policies that focus on health promotion. Healthy People, a major national health promotion program issued by the U.S. Surgeon General, identifies major health problems of the nation and sets national goals and objectives targeting health promotion (Maurer & Smith, 2013). If adopted, activities that target health promotion can result in disease prevention.
Reference
Maurer, F. A., & Smith, C. M. (2013). Community/public health nursing practice: Health for families and populations (5th ed.). St. Louis, MO: W. B. Saunder.
WORLD HEALTH COMMUNICATION ASSOCIATES Campaign Develo.docxambersalomon88660
WORLD HEALTH COMMUNICATION ASSOCIATES
Campaign Development Workshop
Izhevsk
22-24 SEPTEMBER 2009
Background Paper and Planning Template
Franklin Apfel
World Health Communication Associates Ltd
- 2 -
Background
Coordinators and key stakeholders from Cherepovets, Dimitrovgrad, Izhevsk and
Stavropol are being were convened in this third training session of the We Choose Life
Youth Against HIV AIDS Project to explore ways in which they can develop campaigns
that will address identified needs and gaps in current HIV /AIDS communications,
enhance HIV/AIDS literacy amongst key target groups, especially youth; “engage the
unengaged”; overcome obstacles and strengthen the reach and impact of current
prevention and treatment services.
This campaign development workshop builds on the Stakeholder and Youth Volunteer
Network activities to date; in particular the youth behavioural surveys.
The workshop will serve to help each of the cities finalise campaign plans and will utilize
data collected by each city prior to the meeting see campaign development
planning questions below. The three day workshop will be include sessions on
communications as a determinant of health, formative communication research, issue
framing, an advocacy framework , practical campaign planning exercises, issues
related to social marketing, working with media, media advocacy, and campaign
evaluation. There will be both lectures, group work and discussion sessions.
Workshop Objectives
The overall aim of the project is to reduce the disease burden related to HIV/AIDS
amongst youth in participating cities.
The key objective of the workshop is to assist each city stakeholder team to agree and
finalise plans for a youth focused HIV/AIDS communication campaign that will raise
awareness and stimulate healthy behaviors, choices and policies.
As a secondary benefit of this process the workshop aims to enhance participants’
capacities in health communications, communication related research, advocacy,
social marketing as well as working with media.
It is further anticipated that the skills developed for this specific project should be
generalisable to other key public health communication challenges.
Pre-workshop activities- Some questions to answer
Each city is asked to carry out a series of tasks that is aimed at collecting data needed
for effective campaign planning. Reach city will customize their own campaign plans
aimed at enhancing HIV/AIDS prevention and treatment information, education and
public awareness (and supportive policies) by stimulating demand for information and
engaging and strengthening the capacity of health leaders, people living with
HIV/AIDS (PLWHA) and information mediators, e.g. health professionals, media, policy
spokespeople, NGO advocates, and private sector advertisers, to respond effectively.
- 3 -
The reason communications is being emphasized relates to the fac.
Health Communication in the United StatesCase Studies and Less.docxpooleavelina
Health Communication in the United States
Case Studies and Lessons from the Field
Chapter 15
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Overview/Objectives
Review case studies and draw lessons that can be learned through the process of designing, implementing and evaluating a health communication intervention
Provide materials that can be used as a framework for discussion, applied to professional experience, and be used to identify other suitable communication approaches, strategies and activities
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Case Studies
WhyWellness: Communicating about mental health within a gaming community
BodyLove
New Media and the VERB campaign
Health Equity Exchange: Using an integrated multimedia communication approach to engage US communities on health equity
Raising awareness of sustainable food issues and building community via the integrated use of new media with other communication approaches
What do sidewalks have to do with health?
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Emerging Trends and Lessons
Reach people how and where they want to be reached or find themselves frequently
Use multisectoral partnership as a key approach
Understand social support as an emerging theme associated with helping people adopt and maintain healthy behaviors
Consider peer-to-peer communication as an important strategy in reaching out to older children, tweens, teens, and other vulnerable or at-risk groups
Engage communities, their leaders, and other community mobilization partners
Integrate different media and communication areas at the very outset of the communication program
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Emerging Trends and Lessons
Be aware that online and new media-based interventions have a longer lifespan that goes beyond program funding and duration
Recognize that many complex issues are community-specific and should be addressed by community-driven solutions
Consider policymakers not only as key decision makers for policy change, but also as key partners in community mobilization and public engagement
Look for links among different fields and issues in addressing health and social issues
Increase the appeal of messages and materials via the strategic use of videos, animation, and other graphic or visual devices that contribute to message simplicity
Schiavo, R. Health Communication: From Theory to Practice, San Francisco: Jossey-Bass, Second Edition, 2013.
All rights reserved.
Case Study 1
WhyWellness: Communicating about mental health within a gaming community
Case Study Discussion
What do you know about online virtual worlds and how does your knowle ...
httphpp.sagepub.comHealth Promotion Practice http.docxMARRY7
http://hpp.sagepub.com/
Health Promotion Practice
http://hpp.sagepub.com/content/10/1/24
The online version of this article can be found at:
DOI: 10.1177/1524839906289048
2009 10: 24Health Promot Pract
Katz
Kari A. Hartwig, Richard Louis Dunville, Michael H. Kim, Becca Levy, Margot M. Zaharek, Valentine Y. Njike and David L.
Promoting Healthy People 2010 Through Small Grants
Published by:
http://www.sagepublications.com
On behalf of:
Society for Public Health Education
can be found at:Health Promotion PracticeAdditional services and information for
http://hpp.sagepub.com/cgi/alertsEmail Alerts:
http://hpp.sagepub.com/subscriptionsSubscriptions:
http://www.sagepub.com/journalsReprints.navReprints:
http://www.sagepub.com/journalsPermissions.navPermissions:
http://hpp.sagepub.com/content/10/1/24.refs.htmlCitations:
What is This?
- Dec 30, 2008Version of Record >>
at WALDEN UNIVERSITY on December 8, 2014hpp.sagepub.comDownloaded from at WALDEN UNIVERSITY on December 8, 2014hpp.sagepub.comDownloaded from
http://hpp.sagepub.com/
http://hpp.sagepub.com/content/10/1/24
http://www.sagepublications.com
http://www.sophe.org
http://hpp.sagepub.com/cgi/alerts
http://hpp.sagepub.com/subscriptions
http://www.sagepub.com/journalsReprints.nav
http://www.sagepub.com/journalsPermissions.nav
http://hpp.sagepub.com/content/10/1/24.refs.html
http://hpp.sagepub.com/content/10/1/24.full.pdf
http://online.sagepub.com/site/sphelp/vorhelp.xhtml
http://hpp.sagepub.com/
http://hpp.sagepub.com/
Promoting Healthy People 2010
Through Small Grants
Kari A. Hartwig, DrPH
Richard Louis Dunville, MPH
Michael H. Kim, MPH
Becca Levy, PhD
Margot M. Zaharek, MS
Valentine Y. Njike, MD, MPH
David L. Katz, MD, MPH
objectives (U.S. Department of Health and Human
Services [DHHS], 2000a). Today’s Healthy People 2010
(HP 2010) goals and objectives build on the previous
two decades’ accomplishments and set national targets
for reducing disease and disability and promoting
healthier, longer lives (DHHS, 2000b). Led by the U.S.
DHHS, the overarching goals of the current initiative
are to increase quality and years of life and to eliminate
health disparities (Davis, 2000; DHHS, 2003). DHHS
(2001) encourages working through communities and
local organizations to influence individual behavior
and the promotion and maintenance of environments
conducive to healthier lifestyles.
>>BACKGROUND
Building on the health promotion premise that orga-
nizations and communities are instruments of change
(McLeroy, Bibeau, Steckler, & Glanz, 1988; Stokols,
1992), the DHHS Office of Disease Prevention and
Health Promotion (ODPHP) initiated a pilot study in
October 2001 to develop a national model for engaging
community organizations in health promotion and dis-
ease prevention activities that reflect the national HP
2010 goals and objectives. ODPHP awarded the Healthy
People 2010 Microgrant Project, one of two pilot stud-
ies, to Yale Univer ...
A Public Health Approach to Mental Health Care: Taking Transformation to ScaleMHTP Webmastere
This presentation was given by Kathryn Power, Director, Center for Mental Health Services at SAMHSA, at the May 13, 2008 Prevention Policy Summit. Transcript of Kathryn Power\'s opening remarks.
Budget RESEARCHBudget Template - page 1 of 2GRANT(For Internal Use.docxAASTHA76
Budget RESEARCHBudget Template - page 1 of 2GRANT(For Internal Use Only - see specific sponsoringTitle:Union County of Georgia cancer prevention programagency for the proper forms)Date:12-May-17RFA no.PI:Project Period:2017/2018Budget Period:2017-2018Year 1Field researchResearch assitants( Salaries & benefits)250,000Transport120,000Research tools( questionaires and interviews)50,000420,000Screening actvitiesLocal hospital staff service fees80,000Electricity consumed by equipment20,000Maintenace expenses40,000140,000MarketingNutrionists service fees150,000Local gym service15,000Formation of chamber fo commerce180,000Education workshops ( schools and community centers)50,000395,000
pasterme:
rate as of 7/1/05
subject to change
confirm with the SPH
Business Office
pasterme:
part-time student rate as of 7/1/04 subject to change confirm with the SPH Business Office
pasterme:
rate subject to change Please review all budgets with the SPH
Business Office.
Running head: COMMUNITY COALITION 1
COMMUNITY COALITION 3
Community Coalition
Kimberly Crawford
Kaplan University
January 8, 2018
Community Coalition
1. Choose 5 partnerships to engage and explain why you would invite each of these people//organizations to be a part of the coalition.
The creation of community health promotion and education programs takes into consideration several agencies or parties who help in the achievement of the desired health goals. Each of the partners will address its roles using different approaches depending on their area of expertise. This is an important factor to consider as different institutions address health promotion using different approaches and perspectives. The overall outcome from the contribution of every partner should be able to restore and promote the physical, emotional, spiritual, psychological, and social wellness of the community in relation to the health issue being suffered (Minelli, & Breckon, 2009). Chronic diseases are currently the leading causes of death in the community due to their complexity and the severe effects on human health. The community health promotion and education program will be provided by the ‘Health Concerns Coalition’ which will be made up of the following partners; community religious groups, Cancer Supportive Care Foundation, an association of cancer-survivor patients, nutritional organizations, and the local authority.
1. Cancer Supportive Care Foundation – This is an important part of the coalition as it will offer technical expertise in education and diagnosis of chronic diseases. The foundation team will include medical experts who will diagnose the community members of any chronic illnesses. Examinations for diseases such as breast cancer, prostate cancer, diabetes and blood pressure will be conducted by this partner as they will provide modern machines needed for the diagnosis of chronic illnesses.
2. Community religious groups – Community religious groups ca ...
Running Head ENVIRONMENTAL HEALTH1ENVIRONMENTAL HEALTH8.docxtodd271
Running Head: ENVIRONMENTAL HEALTH 1
ENVIRONMENTAL HEALTH 8
Environmental Health
Student Name: Kusum Syangbo
Instructor Name: Elizabeth Wachira
Course no: HHPH- 382-01W
Date: April 5, 2020
Texas A&M University, Commerce
Abstract
Environmental health is both a public health and social justice issue. This paper will describe how environmental health is both a public health and social injustice issue and some of the environmental injustices in the United States. It will also explain the functions of environmental health movements in the US. Finally, the paper will describe some of the intervention opportunities in curbing environmental injustices including health education, advocacy, policy, leadership opportunities, and community focus and give my future leadership role as far as environmental health is concerned.
Keywords
Environmental health, public health, social injustice, minority groups
Section 1: Topic Description
The topic that I chose is Environmental Health. This topic is a public health issue because the environment in which we live in shapes our health every moment of every day. Our health can be affected by what we eat, where we live, and how we interact with the world around us. That is where environmental health professionals, programs and policies, all come into play. Environmental health is a large field in public health because of the numerous ways exterior factors can impact how we live, grow and, even eat. These factors concern how we address our natural environment like sanitation and clean water, but they are also the consequences of our actions as human beings (Krometis et al, 2017).
Environmental Health is also a social justice issue because all the conversations about protecting habitats, mitigating climate change and recycling are not just about saving and protecting the earth, they are more about the struggle for protecting and providing basic human rights to good health. Every human being is entitled to quality air, clean water, and sanitation (Marmot, 2017).
Section 2: Social Injustice
Two Environmental Social Injustices
One major environmental social injustice is the disproportional placing of dangerous waste amenities in poor and largely ethnic and racial minority localities. Research shows that there are ethnic and racial discrepancies in the locations of dangerous waste across the United States. As a result of these injustices people living in such an environment have developed diseases like cancer.
Another social injustice is the environmental influence on healthy eating, physical activity, and obesity in ethnic and racial minority communities with low income. The principal concern here is the deprivation amplification such that in locations where have little individual resources, the local amenities that help people to live healthily, are poorer than those in non-socially and non-impoverished deprived places. Research has shown that t.
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
1. The company I chose was Amazon
2.
3.
4.
1) Keep in mind that the data includes Amazon and competitors
2) Example(For reference only)
Table showing FedEx’s stock quote
Item
Value
Interpretation and brief explanation
Current market price
$274.48
This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock.
Market capitalization
$72.076 Billion
This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding
Beta
1.39 (5 year Monthly)
Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%).
PE Ratio
40.41
In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued.
EPS
$6.79
This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79.
Earning date
December 16th 2020
This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying.
Forward Dividend Yield
2.60 (0.93%)
This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
1. Read the story first.2. Bold Face TermsMake a separate lAbbyWhyte974
1. Read the story first.
2. Bold Face Terms:
Make a separate list of all the definitions of the bold face terms in the story first from your reference sources like a medical dictionary or website etc.
Start by listing all the bold face medical terms and their definitions and cite your sources of reference. Example: appendectomy: the surgical excision of the organ known as the appendix which is a vestigial organ (Webster, 2010)
Then list all your full references at the bottom of your work.
Submit this list as part of your work.
3. Translate definitions into simple terms and insert them into the story:
Next, translate all of the bold faced medical terms into simple language as if you are explaining it to a patient or to someone who may not understand medical terminology and incorporate these simple translations into your story.
This means you should remove the actual medical terms in bold face print but leave the meaning in place with your translated explanations of these terms.
Your finished work should be easily understood. It is OK to alter the sentence structure to accomodate your translations.
Remember to use simple basic language to explain these complicated medical terms to another person.
Highlight your new translation either by bold facing or capitalizing the words.
Do not just insert the definitions. You will not get credit for this and points will be taken off.
The goal here is for you to learn how make the complicated sound simple.
Example:
Initial sentence with medical term in place: The patient is having an appendectomy.
Translation into simple terms in your story: The patient is have his appendix cut out and removed.
In other words, rewrite the story completely in layman's terms or plain English so that someone without a medical or science background would be able to understand.
Your translation must be clear and easy to understand.
Take into account the context of how the terms were used.
You must use all the bold faced terms "translated meanings" in your story.
So when you are complete you will have a list of terms plus definitions (with sources cited) plus a rewritten story in plain English.
4. Submitting Your Completed Work:
Submit your work on a Microsoft Word document using the attachment tool.
Submit all work as one WORD document.. Your file name should end in .doc or .docx or you can use a plain text file format ending in .rtf
If unsure how to do this please contact tech support.
Include your list of definitions and your translated story and your references.
Be sure to run a spell check on your work before submitting.
If you have any difficulty using the attachment tool please call tech support for help.
Exams may be worked on any time during the week but must be submitted on or before the due date.
Submit your exam by clicking on the title of this section "Exam I -Due..." then scroll to the bottom of the page to submit your work.
Exam 2 – part 1
Morticia was particularly interested in entering cosmetolog ...
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
1. This week, we learned about the balanced scorecard and dashboar
1. 1. This week, we learned about the balanced scorecard and
dashboard reporting, performance measurement, sources of
revenues for different types of healthcare organizations, and
financial and strategic planning initiatives. For your Unit 3
Complete assignment, write a narrative essay (minimum 1,200
words) in which you first discuss the use of the income
statement, in general, for decision-making. Then, calculate the
net operating income and operating margin for this year and last
year using the table information below and discuss what these
figures mean for the company (i.e. what ‘story’ do they tell the
reader). Use at least three scholarly sources and remember to
demonstrate a thorough understanding of the READ and
ATTEND sections in your essay. Cite your sources using APA
format.
Table 3
HEALTH CAMPAIGNS:
CREATING & EVALUATING
Day 33
Review
Ch. 8 Review
Activity
Homework
AGENDA:
2. 1.
2.
3.
4.
Public Health
Public health: prevention of disease and illness among groups of
people.
Creation of public policy regarding health issues and tracks
diseases
_________________
Public health services (CDC)
(Lillie; Mattson & Hall, 2011)
Health Campaigns
Health campaign
Seeks to promote public health
Targets beliefs, attitudes, or behaviors
________- acceptance of something as
true or not
______- positive or negative feeling
about something
________-actions
____________
Goes beyond health education to involve
health information and environmental
3. support/resources for health
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
4 phases of the health campaign process
1. Establish a working group and ____________
2. Strategic planning from____________
3. _________________ and evaluation
4. ______________on process evaluation and outcome
evaluation
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
(Mattson & Hall, 2011, p. 253)
Phase 1: Establish a
Working Group
_________: core team for
strategic planning and advising
Includes stakeholders, health
experts, organizational
officials, community partners
4. _________: orgs and
businesses who have an interest in
the campaign
Provide resources:
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
Strategic plan: campaign goal and
plan of action
_______ analysis:
S_______ and
w______of campaign team
(internal to team)
O_____ and t______
(external to campaign)
Ex. grassroots support or
resistant audience
__________: research to
form strategies, select target
audiences, and develop marketing
strategies
(Lillie; Mattson & Hall, 2011)
5. Phase 2: Strategic
Planning
CONT.
Needs assessment: process to
understand and determine a
community’s/population’s
health issues
Pre-campaign gather info from
Key informants
community forum
survey
_________: already
existing statistics
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Messaging process: after determining
baseline attitudes, beliefs, and behaviors of
target groups, the team can design messages
Messages should be:
______: encourage the intended
audience to notice
_______: encourage the audience to
act or not
__________: determine if suggested
behavior can be done successfully in
his/her community
6. Response-efficacy: promotes that a
strategy works
Self-efficacy: promotes an individual’s
confidence in their ability to perform
a recommended task
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning: Messages
should be (CONT.)....
Environmental, con’t
________: what individuals
believe other people normally think
or do
_________: refers to the
impact of norms on behavior; most
prefer to fit in
________: message have to be
culturally sensitive and encourage
behaviors that the population accept
__________: considers if the team
has resources to create and
disseminate the message
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning (CONT.)....
7. Testing & Retesting Messages
Once designed, you need to test
the message
Then tweak
Then redesign
Message strategies:
_______: messages pushed
out to the audience; all info
provided
_______: messages
designed to entice the audience
to seek more info “for more
info, call XXXX”
(Lillie; Mattson & Hall, 2011)
Phase 3:
Implementation &
Evaluation
Implementation activities:
Message production
Message dissemination
Campaign team meetings
with staff, working groups,
and partners
_________: ongoing
tracking and evaluation of
campaign activity
8. Outcome evaluation
(Lillie; Mattson & Hall, 2011)
Phase 4: Correction
Loop
The team reflects on
what went well, what
could be improved
How the campaign is
evaluated should be part
of _____ in that phase,
they should determine
what are important
markers of success;
actually do that
measurement in _____
(Lillie; Mattson & Hall, 2011)
Wednesday
Read
Haas et al. (2011)
RA 19 Due
April 7th (WED) by 11:59 pm ET
9. “Flirting is Not Consent.
Ask Everyone, Every Time”
Designing, Implementing, and Evaluating a Health
Communication Campaign to Prevent Sexual Violence
CASESin PUBLIC HEALTHCOMMUNICATION &
MARKETING
Peer-Reviewed Case Study
Suggested citation: Haas, E.J.; Mattson, M.; Wilkinson, K.
“Flirting is Not Consent. Ask Everyone,
Every Time”: Designing, Implementing, and Evaluating a
Health Communication Campaign to Prevent
Sexual Violence. Cases in Public Health Communication &
Marketing. 2011;5:47-74. Available from:
www.casesjournal.org/volume5.
Volume V, Winter 2011
Emily Joy Haas, MA 1
Marifran Mattson, PhD 2
Kathlyn Wilkinson, MPH 3
www.casesjournal.org
1 Purdue University, Indiana Campus Sexual Assault Primary
Prevention Project
and Brian Lamb School of Communication
2 Purdue University, Brian Lamb School of Communication
3 Purdue University, Student Health Center
Corresponding Author:
10. Emily Joy Haas, Purdue University Student Health Center,
601 Stadium Mall Drive, West Lafayette, IN 47907-2052.
Email: [email protected]
48
www.casesjournal.org
Abstract
Research shows that sexual assault is one of the most pervasive
problems on college and university campuses. Some research
also
indicates that sexual assault is the most common violent crime
committed in campus communities. This case study describes
and
analyzes the development, implementation and evaluation of a
social marketing campaign for a university committed to the
pri-
mary prevention of sexual violence. The Health Communication
Campaign Framework provided theoretical and practical
guidance
for the working group during all phases of the campaign
process.
Campaign messages were designed to educate students about
what
consent is and to increase their comfort level in obtaining
verbal,
sober consent before having sex. The campaign also is critically
analyzed with recommendations for how to address a sensitive
is-
sue, such as sexual violence, in messages displayed throughout
a
campus community.
11. Key Words: Social Marketing, Health Communication
Campaign
Framework, Sexual Violence, Primary Prevention, Message
Design
49
www.casesjournal.org
Introduction
Sexual violence is one of the most pervasive
problems on college and university cam-
puses,1 and the most common violent crime
committed in campus communities.2 Sexual
violence encompasses a range of offenses
that are perpetrated against someone’s will,
including a completed, nonconsensual sex
act; an attempted nonconsensual sex act;
and an abusive sexual contact.3 Every two
minutes someone is raped in the United
States (U.S.) and the chances of being raped
are four times greater for a female college
student than any other individual.4 Re-
search suggests that 3% of college women
are raped during a nine month academic
period and 20-25% of women experience a
completed or attempted rape during their
four to five years spent in college.5 Also,
a study of experiences among college stu-
dents found that 27% of females reported
unwanted sexual attention and 5% reported
unwanted sexual contact in their lifetime.6
12. Often, campus sexual violence is associated
with high-risk drinking and other drug
use.7
The “Clery Act,” originally known as the
Campus Security Act, requires that Insti-
tutions of Higher Education (IHE) disclose
information about crime on and around
their campuses.8 However, since these
sex offenses are underreported,9 the issue
sometimes is not warranted as problematic.
The following survey data provides a more
specific, localized indication of this problem.
In spring 2006, 13 campuses in Indiana
participated in the Core Survey (n=6,000).10
In the results, 5.2% of the respondents re-
ported forced sexual touching, 3% unwanted
sex, and 1.9% both forced sexual touching
and unwanted sex. In another survey in-
volving eight Indiana campuses (n=7,530),11
7.3% of respondents reported being sexu-
ally touched without their consent while
enrolled as a student on their campus; 2.8%
an attempted or completed sexual penetra-
tion without their consent; and 4.2% report-
ed being taken advantage of sexually while
drinking or using drugs. These surveys
render consistent results regarding sexual
offenses within IHE in the state.
Recently, IHE were encouraged to adopt
policies and other prevention efforts to end
sexual violence.5,9 To help address violence
comprehensively, Centers for Disease Con-
trol and Prevention (CDC), in partnership
13. with the state’s health department, provides
funding in the form of a Rape Prevention
and Education (RPE) grant to prevent
the occurrence of sexual violence on cam-
puses.12 Recognizing that beliefs and atti-
tudes regarding sexual violence are formed
early,12 CDC encourages a focus on promot-
ing healthy relationships and non-violent
norms. Besides federal funding to support
sexual violence prevention, a modification to
current legislation, the Campus SaVE Act,
was introduced in April 2011.13 If passed,
this legislation will mandate that IHE cre-
ate and implement a comprehensive strat-
egy to both prevent and respond to sexual
violence.13 The Act is calling for awareness
campaigns as a best practice to prevent
sexual violence,13 indicating the timeliness
of this case study.
This case study demonstrates how health
communication provides a foundation for
primary prevention campaigns by discuss-
50
www.casesjournal.org
ing the development, implementation, and
initial evaluation of a campus-based social
marketing campaign to prevent sexual
violence. Primary prevention efforts aim to
prevent first-time perpetration and vic-
timization.3,9,12 In accordance with CDC
14. philosophy, more health campaigns are
emphasizing primary prevention strate-
gies instead of secondary and tertiary
prevention approaches.12 Social marketing
campaigns are one method to create large,
behavior-changing initiatives on cam-
puses.14 Social marketing and media cam-
paigns have been used as prevention tools
for a variety of health behaviors including
bystander intervention14 and motorcycle
safety.15 Social marketing campaigns work
particularly well on campuses because they
are designed to reach large numbers of
people with targeted messages.16-17
51
www.casesjournal.org
Background: Framing a Sexual Violence
Primary Prevention Campaign
The Sexual Violence Primary Prevention
Campaign (SVPPC), which targets college
students, is framed by an adapted version
of the Health Communication Campaign
Framework (HCCF) shown in Figure 1 (next
page).18-19 The objectives of this case study
include: analysis of the SVPPC campaign
as it progressed from initial steps in forma-
tive research, to reveal a primary problem
contributing to sexual violence on campus,
15. into developing its strategic plan to address
the problem, through the message develop-
ment and implementation of the campaign,
culminating with initial evaluation and
lessons learned. Following is a summary of
the HCCF’s four phases which are further
addressed with respect to the SVPPC.
Health Communication Campaign Framework
The SVPPC was framed by an extension of
Mattson and Basu’s18-19 Message Develop-
ment Tool (MDT) which utilizes messag-
ing elements derived from communication
theory and is consistent with social market-
ing.20 The first phase includes convening a
working group and strategy development,
which sets the foundation for the cam-
paign.14,18-19 The second phase consists of
a needs assessment followed by developing
and testing of messages and materials for
proven messaging elements including be-
ing stimulating, motivational, contextually
and culturally consistent, and concordant
with the constraints of organizational
resources.18-24 The third phase involves
implementing the campaign to the target
audience through appropriate communica-
tion channels and events. The final phase
is to evaluate the campaign’s effectiveness,
and if necessary, make corrective or mid-
course changes, at relevant points in the
campaign’s lifecycle, usually by measuring
audience knowledge, attitudes, and behav-
iors. Now that the theoretical framework
16. has been summarized, we illustrate how
it was applied in practice to design, imple-
ment, and initially evaluate the SVPPC at a
university.
52
www.casesjournal.org
Figure 1. Health Communication Campaign Framework
(Adapted from the
Message Design Tool by Mattson & Basu; 2010a, 2010b)18-19
Phase 3 – Implementation & Evaluation
(Re)Implement Strategy/Disseminate Campaign Messages
Process Evaluation-tracking system to assess program deliv-
ery and utilization
Outcome Evaluation-comprehensive assessment of campaign
effectiveness
• Pre-test/Post-test surveys
Phase 4 –
Correction Loop
“Correct” Campaign
based on Process and
Outcome evaluation
and cycle back through
Phases 2 and 3.
Phase 1 – Convene Working Group/Committee
Who?
17. • Health Issue Experts
• Public Health/Communication Specialists
• Community Partners
• Funding Sources
What?
• Create Problem Statement
Correction
loop
Phase 2 – Strategic Planning from Formative Research
Needs Assessment
• Research
• Statistics
• Target Audience(s)
-Pre-test-existing knowledge, attitudes, and behaviors
Messaging Process
• Develop/revise campaign messages taking into account
proven messaging elements including:
• Stimulating - attention-getting, salient
• Motivational - risks, susceptibility, fear
• Contextually Consistent - response efficacy and self-
efficacy,
subjective norms, costs/benefits
• Culturally Consistent - values, traditions, roles,
rules, power structure
• Resource-Dependent - quality, reach
• Pre-test DRAFT messages using focus groups with target
audience
• Revise messages according to feedback
Marketing Mix
• Product
• Price
18. • Placement
• Promotion
53
www.casesjournal.org
Methods
Phase One: SVPPC Working Group
Phase 1 of the HCCF involved convening
a working group that was concerned about
or had an interest in the issue being ad-
dressed. The SVPPC working group con-
tained several people from the university
and surrounding community. The group
consisted of the project director, the leader
of the group, who recruited relevant part-
ners on campus including representatives
from the university’s Student Wellness Of-
fice (SWO), Women’s Resource Office, Cam-
pus Safety, Residence Life, the community’s
Rape Crisis Center, and students. Their
first task was to write a problem statement
that would guide the group to develop a
campaign after which a needs assessment
was conducted to inform the problem and
target audience.14,18-19,25
Needs Assessment
Before finalizing a targeted, accurate prob-
lem statement, needs assessment research
was conducted. The needs assessment gath-
19. ered specific University and state data to
better understand sexual violence locally,
including who the problem affected and
what behavior changes were needed.26 The
working group examined University data
from the Student Wellness Survey,27 campus
safety data, and solicited student input in
several diverse classes. Results of the Stu-
dent Wellness Survey,27 implemented online
to the University student population, in-
cluded questions about violence experienced
on campus. Of the participants (n=4,264),
1.9% experienced a sexual assault on cam-
pus within the past 12 months and more
than 15% were forced to have sexual contact
within the past 12 months. National data
discussed previously indicated the preva-
lence of sexual violence in the U.S., and
although higher than the local data gath-
ered, both signify that sexual violence is
common on college campuses.7,28-29 Further,
the campus’s safety data revealed that the
majority of reports from students regarding
rape were acquaintance rapes. Discussions
with students after sexual health presenta-
tions, requested by instructors and residence
life staff, indicated that alcohol contributed
to the lack of consent exchanged before sex,
and that alcohol was involved in almost all
of the assaults reported.
The needs assessment revealed that stu-
dents on campus support a date rape cul-
ture, i.e., an environment that fosters rape
attitudes and increase risk factors for
20. sexual violence.30 Date rape cultures form
as a result of rape myths, which are preva-
lent on many campuses. The perpetuation
of rape myths foster victim blaming and
minimization of injuries experienced by vic-
tims.31 Examples of rape myths perpetuated
on college campuses include: the type of
clothing people wear suggests how willing
they are to have sex; when someone is raped
it often is because the way they said “no”
was unclear; if a woman engages in kiss-
ing or lets things get out of hand, she wants
to have sex; and someone who is sexually
assaulted while drunk is somewhat re-
sponsible.32 Some of these rape myths were
assessed in Indiana’s College Relationship
54
www.casesjournal.org
Survey (n=7,530),11 which found that 42.4%
of participants agreed or strongly agreed
that someone who is sexually assaulted
while drunk is somewhat responsible and
28.7% agreed or strongly agreed that the
type of clothing people wear suggests how
willing they are to have sex. This assess-
ment supported the need to focus on rape
myths, specifically the concept of consent,
to prevent acquaintance rapes and assaults
that occur on campus. The working group
gathered, reviewed, and analyzed enough
relevant information to formulate the fol-
21. lowing problem statement:
A majority of students on campus do
not ask for consent before engaging
in sexual activity. They do not ask
for consent because they are either
embarrassed to ask, or do not know
what consent is and is not. The lack
of obtaining consent is contributing
to a portion of acquaintance sexual
assaults on campus. In response, it
is necessary that students on campus
become more familiar with what con-
sent is, and become more comfortable
obtaining and communicating verbal,
sober consent before proceeding to
sex.
Focusing on consent among the target audi-
ence has also been a method used among
speakers and other campaigns to prevent
sexual violence, such as The Date Safe
Project33 and The Consensual Project.34 In
addition, sexual activity among late ado-
lescents without clear consent is an aspect
of violence that needs to be addressed on
campuses.35 Often sexual activity is never
clearly given or verbally stated and instead,
implied.35-36 Therefore, the working group’s
problem statement aligned with current
practices to prevent sexual violence by
focusing on strengthening the communica-
tion between two people before engaging in
sexual activity.
22. Strategic Planning
Based on the problem statement, the work-
ing group created a strategic plan to guide
their activities. After consulting University
data and talking with students after the
presentations referenced above, the working
group realized that the SVPPC needed to
target the entire undergraduate population
on campus. Representatives of the student
population, i.e., first-year students through
fifth-year students, student-athletes, fra-
ternity and sorority members, and health-
related majors, provided consistent feedback
and stories about their friends’ experiences
regarding sexual violence on campus, fur-
ther confirming the need to target everyone.
Strategic planning was enhanced by us-
ing CDCynergy,37 an online tool that in-
cludes a step-by-step process of creating
social marketing campaigns starting with
a detailed timeline. The timeline for the
SVPPC spread across a calendar year, with
deadlines corresponding to each phase of
the HCCF. First, the project director, who
was awarded the grant, participated in a
social marketing and focus group train-
ing provided by a RPE grant coordinator.
The training allowed the project director to
develop a timeline, with deadlines sensitive
to the academic calendar. After the fall 2009
training, the remainder of the semester was
55
23. www.casesjournal.org
spent conducting the formative research and
needs assessment previously discussed. Dur-
ing the spring 2010 semester, the working
group drafted messages, tested those mes-
sages in focus groups, revised the messages,
and tested them again. During the summer,
the messages were finalized, the visual im-
ages desired by students were purchased,
and proofs were requested from the printing
company. Because students are most suscep-
tible to sexual assaults in the first six weeks
of the academic year,38-40 it was imperative
to have the campaign implemented when
students arrived on campus in August 2010.
Finally, initial evaluations of the campaign
were conducted at the end of both the fall
2010 and spring 2011 semesters.
A precise budget for campaign activities
was developed by using the marketing mix,
i.e., product, price, placement, and promo-
tion.20 Although the promotional aspect
of the marketing mix expanded during
campaign implementation, other aspects of
the marketing mix were determined early
during strategic planning. For example,
the working group decided what products
and mediums would be used to disseminate
the campaign message, within the $2,000
budget provided. Additional aspects of the
marketing mix are discussed during the
implementation section.
24. Phase Two: Drafting and Testing Messages
The messaging process within Phase 2 of
the HCCF consisted of three stages. First,
the working group drafted messages based
on the needs assessment and the message
effectiveness elements. Second, the drafted
messages were tested in focus groups with
the target audience. Third, based on itera-
tive feedback, messages and promotional
items were revised and finalized.
Stage One
In the first stage of the messaging process,
the working group drafted 12 messages
that not only were aligned with the problem
statement, but were also in keeping with
effective messaging elements in that they
were stimulating, motivational, consistent
with the context and environment, and
culturally appropriate.21-24 When drafting
messages, the working group paid attention
to the recommendations of the HCCF by
making the messages stimulating in order
to break through the clutter of messages
students receive. Forming a message that
attracted attention may motivate students
to change their behavior and begin asking
for consent.
In terms of the cultural consistency of the
messages, the working group drafted mes-
sages that might appeal to both men and
women on campus. It was important not to
put all of the pressure to obtain consent on
25. one gender within the interaction. Besides
being an equal responsibility, the working
group did not want to depict men as being
56
www.casesjournal.org
in a position of greater power. Instead, a
goal of the campaign messages was to put
men and women on a level playing field, be-
ing able to respectfully communicate with
each other.
Stage Two
After a variety of messages were drafted
based on effective messaging elements, they
were tested. Two focus groups41 were con-
ducted to test the written messages without
images. The working group did not want to
contaminate student’s initial viewpoints of
the written messages by biasing them with
images. However, feedback was requested
from participants regarding what images
might resonate with students and comple-
ment the written messages.
Students were recruited to participate in
one-hour focus groups via the University’s
electronic flier board system, the Univer-
sity television network, and by members
of the working group personally recruiting
students. One focus group of communica-
tion majors was offered extra credit by their
26. instructor for their participation. The other
focus group was provided dinner for their
participation and were student members of
the campus safety department. The focus
groups occurred between March 31 and
April 4, 2010, with 8-15 students participat-
ing in each discussion which is a typical
number of participants.41 The first focus
group was facilitated by the grant coordina-
tor so that the project director could observe
the facilitation process and lead subsequent
discussions. The note taker for each focus
group was a graduate assistant in SWO who
was in the SVPPC working group. Student
participants were asked a series of ques-
tions about each of the 12 draft messages,
e.g., “Would the message stand out on cam-
pus?”; “What do you like/dislike about the
message?”; “Who does the message target?”;
“Will the message change personal behav-
ior?”; and, “How can we make the message
more clear?”. Since the second focus group
provided similar feedback to the first focus
group and was a different student demo-
graphic, the working group felt confident to
move forward with revising the messages.
Stage Three
The third stage of the messaging process
was iterative and involved taking the focus
group feedback and revising draft messag-
es. To illustrate this process, examples are
provided in the following sections.
Draft Message 1. The working group draft-
27. ed the message, “Consent? [email protected]? Flirting is
not consent. We ALL have the right to say
yes,” using text message lingo. Some mem-
bers of the working group thought that uti-
lizing text messaging language would appeal
to students and attract attention over other
messages. To their surprise, focus group
participants said that the text language was
difficult to understand. Specifically, they
thought the “Consent? [email protected]?” was confusing.
Some working group members were sur-
prised while others thought the message was
confusing, but because they did not text, did
not comment on the initial draft. However,
participants communicated that the last part
of the message was powerful and should be
used without the first part of the message.
57
www.casesjournal.org
Draft Message 2. Because the needs assess-
ment found that students often are embar-
rassed to ask for consent, the working group
thought that infusing the messages with hu-
mor may help ease the tension in situations
where consent is necessary. So, a series of
messages were drafted which played off
the concept of Global Positioning Systems
(GPS). One draft message was, “There’s
no GPS for sex. Ask for consent every step
of the way.” This message was perceived
as too silly. Participants commented that
28. it would become a joke on campus. Others
expressed that the message had a connota-
tion of getting lost, which is not an enjoy-
able experience. Participants expressed
dislike for linking sex with getting or need-
ing directions. Although some participants
thought the message could be modified to
resonate better with students, the risk of
consent being laughed at instead of taken
seriously prompted the working group to
table these messages. Because these drafts
required extensive modifications, they could
not be utilized during this grant period
and campaign. However, the working group
liked this series of messages and based on
some positive student feedback, stored these
drafts for potential modification, testing,
and future use.
Draft Message 3. The needs assessment
revealed that students often interpret other
signs or nonverbal cues, such as flirting,
as consent. With this in mind, several
drafts targeted these behaviors as not
being consent. Many draft messages con-
tained phrases such as, “Flirting is not
consent,” and “Not sure if he/she’s into it?
Ask!” Participants unanimously liked the
message “Flirting is not consent” stating it
was strong, simple, direct, accurate, and a
powerful statement. They also appreciated
that this shorter message could be read as
they frequented campus buildings. Working
group members also appreciated the suc-
cinctness of this message.
29. Draft Message Slogan
Development of the campaign slogan serves
as another example of the messaging pro-
cess. The draft slogan was, “Everybody,
Every time, Everywhere” indicating the im-
portance of always asking for consent, even
if consent was previously gained. Partici-
pants liked the concept of this message but
felt that it lacked a call to action and was
too long. After revisions and feedback from
the second focus group, the final campaign
slogan informed by students became “Ask
everyone, every time.” This message was
shorter and had a blatant call to action that
students could remember.
Unanticipated Message Barriers
The working group encountered construc-
tive feedback that had to be addressed.
For example, an unanticipated barrier to
developing and testing these messages was
that several of the original drafts were
interpreted as promoting sex, as well as
promoting consent. The working group did
not initially notice this contradiction until
alerted by focus group participants. When
testing phrases such as, “It may not be easy
but it’s worth it! Get consent.” and “Nothing
gets things started like getting consent,”
participants stated that these messages im-
plied people would eventually say yes to sex.
After noticing this aspect, messages that
30. 58
www.casesjournal.org
were interpreted this way were not used
in the final message testing since others
tested much better and were not perceived
as promoting sex. The working group was
cognizant of this issue during the remain-
der of the messaging process.
Images
After the text was finalized, images were
needed. The first two focus groups recom-
mended that two people, i.e., a couple, were
needed to clearly depict the consent mes-
sage. Participants insisted that the concept
of consent becomes confusing when alcohol
is involved in the scenario, so a bar-like
setting with alcohol needed to be present in
at least one image. Because the needs as-
sessment also showed that alcohol impairs
the ability to obtain and provide consent,
the working group agreed. However, par-
ticipants also said that images of couples
talking and playfully flirting would assist
in depicting the message. Images without
alcohol also were necessary because half of
the target population is under age 21 and
not legally allowed to drink alcohol.
Based on this feedback, images were found
on istockphoto.com and tested with a new
focus group of eight participants recruited
and facilitated through the same methods
described previously. These participants
31. provided feedback, including: the couples
appeared to be too old or too young; it was
not evident if they were flirting; they ap-
peared to be too far into the physical in-
teraction and consent already should have
been obtained; the image complemented
the message and reflected the students on
campus.
Final Message
Towards the end of the third stage of the
messaging process, participants approved
several messages and images. However, the
working group decided to implement one,
consistent message. One call to action was
deemed appropriate to change this specific
behavior and also tied the campaign togeth-
er. The SVPPC message became, “Flirting
is not consent. Ask everyone, every time.”
To resonate with the entire target audience,
students recommended depicting a variety
of couples to represent the main demo-
graphic groups on campus. The three rep-
resentative istockphoto images chosen for
the campaign, coupled with the same mes-
sage included a Caucasian couple flirting
at a bar (Figure 2), an African American
couple flirting (Figure 3), and a homosexual
couple flirting (Figure 4). Drafting, test-
ing, revising, and finalizing messages was
a time-consuming process but the iterative
feedback from students assisted in creat-
ing campaign messages specifically for the
target audience.
32. 59
www.casesjournal.org
Figure 2. Flirting is Not Consent Message
with Bar Couple
60
www.casesjournal.org
Figure 3. Flirting is Not Consent Message with
African American Couple
61
www.casesjournal.org
Figure 4. Flirting is Not Consent Message
with Homosexual Couple
62
www.casesjournal.org
Campaign Implementation
After the messages were completed, the
33. working group consulted the budget and
decided how they could implement the
campaign. Before classes began in August
2010, 750 campaign posters were ordered
from printing services for $436.00 and dis-
seminated to every residence hall, sorority,
fraternity, campus building, athletic locker
rooms, community apartments, and city
bars. The distribution of these posters was
carefully considered. Consistent with the
concept of audience segmentation empha-
sized in the HCCF18-19 and CDCynergy,37
the working group targeted which campaign
posters would be delivered to each building.
For example, the African American frater-
nity only received the poster with the Afri-
can American couple and the homosexual
fraternity only received the poster with the
homosexual couple. The bars surrounding
campus received posters of the couple at a
bar. Working group members placed posters
in their respective buildings and monitored
their exposure. To the group’s knowledge,
no posters were vandalized. However, one
11x17 poster was stolen from a board in the
health center and replaced. All of the uni-
versity’s electronic advertising systems were
used to disseminate the posters, including
exposure before movies for three months at
the University’s Union for $60.
The messages also were advertised during
October 2010 within the city’s public trans-
portation bus system. Three tail signs were
purchased for the back of busses that navi-
34. gated the campus and surrounding commu-
nity for $705. Also, 120 interior bus signs
were displayed in all 60 busses of the public
transportation company for $773. Univer-
sity students use these busses frequently as
they travel throughout the campus and to
and from their apartments and houses. The
final cost to print and disseminate the mes-
sages totaled $1,974.00.
The working group determined it was es-
sential not only to post messages around
campus, but to also be available to discuss
the campaign face-to-face with students.
The project director stayed alert for events
occurring around campus during which
distributing campaign posters would be ap-
propriate and attended these events. Collab-
oration increased the campaign’s exposure
and the direct communication with students
provided outlets to discuss the campaign’s
message and answer questions. Venues
where the campaign message was present
included Take Back the Night, National
Preparedness Safety Day, Pan-Hellenic
Council meetings, Campus/Community Bar
Retail Coalition Meetings, and YWCA com-
munity events. Through all these methods
of implementation and message distribution,
the scope of the campaign continued to have
considerable breadth and depth. The cam-
paign continued for the remainder of the
academic year knowing that a target audi-
ence member must recognize a message up
to three times before they keep it in mind.42
35. 63
www.casesjournal.org
Initial Evaluation
Campaign evaluations typically measure
the effectiveness of the campaign and
provide feedback for making mid-course
corrections to the campaign.18-19,26 This
case study highlights two initial campaign
evaluations; a survey that was conducted 12
weeks after the SVPPC was implemented
in December 2010 and then again in April
2011. The purpose of these surveys was to
fulfill requirements of the granting agency,
which included a report discussing satura-
tion and any potential behavior change 12
weeks after implementation and again dur-
ing the spring semester. The project direc-
tor used one student worker and one student
volunteer from SWO to survey their peers.
The working group avoided conducting the
evaluations in order to prevent social desir-
ability bias among the respondents.
The volunteers randomly surveyed students
they did not know who were walking alone
on campus in various locations, e.g., resi-
dence halls, academic buildings, fraternity/
sorority houses, athletic locker rooms, and
agreed to be surveyed. Although not sys-
tematic, this approach of surveying students
who were alone was selected to avoid any
36. potential social desirability biases associ-
ated with asking questions among a group
of friends and to minimize any pressures or
time constraints while answering questions.
Students were surveyed on four separate
occasions during each one-month evaluation
period.
In December 2010, 117 students were
randomly intercepted and if available,
answered questions while the volunteers
checked off their peer’s responses on an Ex-
cel tracking sheet. The number of students
originally approached was not recorded.
However, the surveyors did not experience
resistance from students to participate in
the survey. Each participant was shown the
series of messages and asked if they saw the
messages. If the participants had not seen
the messages prior to the survey, they were
done with the survey. If participants had
seen the message, the following questions
were asked: “Where did you see the mes-
sage?”, “Did you read the message when you
saw it?”, “What is the message about?”, and
“Will this message contribute to behavior
change of students on campus?” Each par-
ticipant’s year in school and gender were
also requested, which demonstrated a wide
range of students, i.e., 45% males, 55% fe-
males, 24% first-year, 23% sophomore, 32%
junior, and 21% senior. Students reported
seeing the messages in a variety of places
including the student health center, movie
ads, residence halls, fraternity houses, the
37. bus, campus events, and staff offices. The
diversity of outlets for this message was
successful in reaching students, illustrating
the importance of planning the marketing
mix.
Of the 117 students surveyed, 76% (n=89)
both saw and read the campaign message,
indicating a broad reach. Further, 81%
(n=72) of those 89 students who saw and
read the message answered “yes” to the
question, “Do you think this campaign will
contribute to behavior change on campus?”
Although the measure of behavior change
only is a prediction among students, the
campaign message was viewed as accurate
in addressing a campus health issue and
64
www.casesjournal.org
persuasive enough to alter students’ behav-
ior. Although 117 is not a large sample (un-
der 1% of the total student population), this
initial evaluation encouraged the continua-
tion of the campaign.
Short, qualitative responses to the evalua-
tion question “Briefly, what is the message
about?” indicated comprehension of the
campaign message. Students’ responses con-
sisted of a few words and therefore, could
easily be coded into themes by the project
38. director and grant director and then quan-
tified. Thirty-four percent (n=40) stated
the message is about asking for sex; 14%
(n=16) stated it is about being aware and
protecting yourself; 14% (n=16) stated don’t
interpret flirting as “yes”; 8% (n=9) stated
it is about communicating consent; 4% (n=5)
stated it is about safer sex; and 3% (n=3)
said it is about being careful when drinking
alcohol.
In April 2011, the same student volunteers
assessed the comprehension of the message
again through the exact intercept meth-
ods described above. Of the participants
(n=113), 28% were males, 72% females, 16%
first-year, 13% sophomore, 41% junior, 27%
senior, and 3% were graduate status. Of the
113 students, 48% (n=54) both saw and read
the campaign message. Further, 27% (n=16)
of those 54 students who saw and read the
message answered “yes” to the question,
“Did this message change your behavior?”
This question was an assessment of behav-
ior change whereas the initial evaluation in
December inquired if the students thought
the message would change behavior. The
lower number of students who saw the mes-
sage was not surprising, since the budget
for the campaign allowed for three months
of advertising, which ended in December
2010. During the spring 2011 semester, only
the posters were displayed in print and elec-
tronically as described previously.
39. Of the 113 participants, 91 (80%) answered
the question, “Briefly, what is this mes-
sage about?” These short responses were
again coded. Forty percent (n=36) stated the
message was about rape or rape awareness;
31% (n=28) stated don’t interpret flirting as
“yes”; 18% (n=16) stated it is about commu-
nicating consent; 7% (n=6) stated it is about
alcohol and sex; 2% (n=2) said it is about
sex at parties; 1% (n=1) said safer sex; one
said it is about respecting boundaries, and
one said sexual harassment.
These qualitative responses during both
evaluations indicated a general understand-
ing of the campaign message, providing
additional support for the HCCF strategy
of thoroughly testing messages for clarity
before implementation. The campaign will
be re-implemented through new media out-
lets in Fall 2011, and in Spring 2012, will
undergo an impact evaluation.
In addition to the initial evaluations con-
ducted, a relevant event occurred on cam-
pus that merits mention. At the beginning
of the semester during which the SVPPC
was implemented, a sex position of the week
cartoon was printed in the campus newspa-
per titled The Prestige. The cartoon showed
a couple having sex doggy-style, when the
man sneaks out and, without the woman’s
knowledge, is replaced by another man.
40. 65
www.casesjournal.org
This cartoon promoted non-consensual sex
which, by definition, is rape. Many students
expressed being appalled to see this car-
toon in the newspaper. The editor stated
in an apology the following week that she
received and responded to multiple angry
e-mails and phone calls regarding the car-
toon.43 In addition, students sent editorials
in response to the cartoon, of which over
a dozen were published. For example, one
student wrote the following: “…This comic
essentially portrays sexual assault; engag-
ing in intercourse with someone who is for
whatever reason not able to consent (intoxi-
cated, or in this situation, not able to see) is
sexual assault...”.44 Another student wrote,
“This week’s sex position is in all actuality,
sexual assault. If two people are having sex
and one of those people switches out with
someone else, without the other’s consent,
that is rape…”.44 All editorials had a simi-
lar theme. Although we cannot be certain, it
is possible that the campaign message about
consent cued students to act on and com-
plain about the printing of the cartoon.
www.casesjournal.org
66
41. Lessons Learned for Campaign Practice
After progressing through the HCCF to de-
velop, implement, and initially evaluate the
SVPPC, there are three recommendations
for campus health practitioners and working
groups to consider during their own cam-
paign processes. The first recommendation is
to apply the HCCF as a systematic process to
develop a health campaign in order to avoid
and/or address unanticipated barriers. Ap-
plying this framework may help proactively
address an issue before it becomes a problem.
A systematic framework, such as the HCCF,
may also provide credibility when responding
to administration concerns, which is ad-
dressed in the next recommendation.
The second recommendation concerns the
ability to effectively address a sensitive
campus health issue through messaging.
Addressing sexual violence can be challeng-
ing. The reason for this often is two-fold.
First, when using prevention messages
that specifically state the words “rape” or
“sexual assault” students may tune-out be-
cause the message may not seem applicable
to them. For example, a message that says,
“Sexual assault- not understanding no”
is persuading students to obtain consent,
much like the SVPPC messages. However,
using the term sexual assault might cause
students to ignore the message, thinking
that it does not apply to them, particularly
if they never assaulted anyone or were
42. sexually assaulted. Second, even if students
responded to these types of messages, it is
possible to experience backlash from cam-
pus administration who may not perceive
sexual violence to be a significant issue
on campus. Although this type of feedback
did not occur on this campus, the work-
ing group was prepared with current data
collected during the needs assessment to
demonstrate that sexual violence occurs.
In response to the challenges that can occur
when attempting to design and implement a
sexual violence campaign, softer language
may initially be used to create messages
and images that appropriately address the
problem. For example, instead of referring
to negative aspects of relationships, such
as not committing a sexual assault, mes-
sages can focus on positive aspects of rela-
tionships, such as communicating about or
respecting relationship boundaries. Rein-
forcing these positive behaviors through
messaging may help frame sexual violence
as an issue that can be talked about and
prevented in campus communities. Students
and administration may be more receptive
to messages that encourage keeping com-
munication lines open, maintaining healthy
relationships, and being aware of their
actions. Even though the vocabulary in the
messages may differ, the same behaviors
are targeted as messages that use more con-
troversial terms, such as rape. For working
groups that are similarly trying to combat a
43. negative health behavior that may be sensi-
tive to address, thinking creatively in terms
of messaging is recommended.
The final recommendation is to take advan-
tage of any opportunity to promote the cam-
paign whenever and wherever appropriate.
For example, after the newspaper printed
the cartoon described above, the project
director contacted the newspaper, framing
this situation as a teachable moment. The
newspaper accepted the invitation to print
67
www.casesjournal.org
a cover story about the SVPPC, discussing
the connection between consent and sexual
assault. Relevant incidents and events such
as the one just described may occur on
campus during campaign implementation.
It is the responsibility of the working group
to remain vigilant and consider ways to
collaborate with others to further reinforce
and promote campaign messages.
Limitations
We are aware that steps can be taken to
improve the campaign and ensure the mes-
sage is truly having an impact on behavior.
First, the selection of focus group partici-
pants was not random nor representative
44. of the entire campus body; a convenience
sample of students from one communica-
tion course and a campus safety department
participated. The importance of identify-
ing ways to ensure broader representation
in future formative research is recognized.
Second, the survey format was not an ideal
evaluation method and could have obtained
biased feedback about the effectiveness of the
messages. For example, although the student
volunteers who conducted the initial evalua-
tions were instructed to select students who
were walking alone at random, it is possible
that they approached students more selec-
tively, for example, based upon an assess-
ment of a students’ potential receptivity. It
is also possible that although the intercept
interviews were anonymous, and the students
who participated did not know the surveyors,
their responses may have been biased either
by wanting to provide a socially desirable
response, or potentially by the interviewers.
Lastly, asking students who were exposed to
a campaign message whether it will or did
change behavior is not a true evaluation of
the effectiveness of the campaign messages.
These are acknowledged limitations that will
be improved upon in a more formal impact
evaluation planned for April 2012. As cur-
rently envisioned the impact evaluation will
utilize an online survey and focus groups
to more formally evaluate the visibility and
effectiveness of the SVPPC and if necessary,
engage in the correction loop of the HCCF.
45. Finally, future modifications of the cam-
paign will include formative research about
the gender differences present in sexual
violence experiences, including the issue of
power and control in relationships. Previous
research on sexual violence shows that gen-
der-related norms and power and control in
relationships are influential factors in de-
termining sexual violence perpetration.45-46
Power and dominance are more common in
intimate partner relationships and stranger
rapes.46-47 However, since in the college
population acquaintance assaults are more
likely to occur, mainly because of the pres-
ence of alcohol7 and implied consent,35-36
this campaign focused on these aspects of
prevention. In the future, attention to gen-
der and power may result in an expanded
campaign that additionally targets couples
or students in longer term intimate partner
relationships, thus, reaching out to prevent
sexual violence in another campus audience.
68
www.casesjournal.org
Conclusions
This case study serves several objectives
from a pragmatic perspective, while being
grounded in communication theory. The
HCCF guided the working group through
the necessary phases to design, implement,
46. and initially evaluate a health communi-
cation campaign by highlighting crucial
steps, such as needs assessment and mes-
sage testing. As this case study illustrates,
even those who are social marketing novices
can come together and learn how to prog-
ress through a theoretical model to help
ensure a targeted and effective campaign
that addresses a pervasive health issue for
students.
69
www.casesjournal.org
Acknowledgements
This social marketing campaign was funded by the Indiana
Cam-
pus Sexual Assault Primary Prevention Project and the Indiana
State Department of Health through a CDC cooperative
agreement.
The authors wish to thank Dr. Nancy Maylath, the Director for
the
Indiana Campus Sexual Assault Primary Prevention Project, for
her assistance in this campaign.
70
www.casesjournal.org
47. References
1. Fisher BS, Cullen FT, Turner MG. The sexual victimization
of college women: Findings from
two national-level studies. Washington, DC: National Institute
of Justice and Bureau of Justice
Statistics; 2000.
2. Fisher BS, Sloan JJ, Cullen FT. Final report: Understanding
crime victimization among col-
lege students: Implications for crime prevention. Washington,
DC: US Department of Justice,
Office of Justice Programs; 1995.
3. Basile KC, Saltzman LE. Sexual violence surveillance:
uniform definitions and recommend-
ed data elements version 1.0. Atlanta: Centers for Disease
Control and Prevention, National
Center for Injury Prevention and Control; 2002.
http://www.cdc.gov/ ViolencePrevention/pub/
SV_surveillance.html. Accessed November 9, 2011.
4. Rape, Abuse, and Incest National Network. Statistics.
http://www.rainn.org/statistics. Ac-
cessed June 7, 2011.
5. Karjane HK, Fisher BS, Cullen FT. Campus sexual assault:
How America’s institutions of
higher education respond. Newton, MA: Education Development
Center, Inc; 2005.
6. Frazier P, Anders S, Perera S, Tomich P, Tennen H, Park C,
Tashiro T. Traumatic events
among undergraduate students: Prevalence and associated
symptoms. J Couns Psychol.
48. 2009;56:450-460.
7. Abbey A. Alcohol-related sexual assault: A common problem
among college students. J Stud
Alcohol. 2002;14:118-128.
8. Security on Campus, Inc. Complying with Jeanne Cleary Act.
http://www.securityoncampus.
org/index.php?option=com_content&view=article&id=271&Ite
mid=60. Accessed October 17,
2010.
9. Gonzales AR, Schofield RB, Schmitt GR. Sexual assault on
campus: What colleges and uni-
versities are doing about it. Washington, DC: US Department of
Justice, Office of Justice Pro-
grams; 2005. http://www.ncjrs.gov/pdffiles1/nij/205521.pdf.
Accessed October 28, 2010.
10. Indiana Collegiate Action Network. Core alcohol and drug
survey. 2006.
11. Indiana Campus Sexual Violence Primary Prevention
Project. State College Student Rela-
tionships Survey. 2009.
71
www.casesjournal.org
12. Centers for Disease Control and Prevention. CDC’s rape
prevention and education grant
program: Preventing sexual violence in the United States: 2004.
http://www.cdc.gov/ncipc/pub-
49. res/pdf/RPE%20A AG.pdf. Accessed October 10, 2010.
13. Text of S. 834: Campus SaVE Act.
http://www.govtrack.us/congress/billtext.
xpd?bill=s112-834. Accessed June 6, 2011.
14. Potter SJ, Stapleton JG, Moynihan MM. Designing,
implementing, and evaluating a media
campaign illustrating the bystander role. J Prevent Intervent
Comm. 2008;36:39-55.
15. Kosmoski C, Mattson M, Hall J. Reconsidering motorcycle
safety at Purdue: A case study
integrating campaign theory and practice. Cases in Public
Health Communication & Market-
ing. 2007;
http://www.gwumc.edu/sphhs/departments/pch/phcm/casesjourn
al/volume1/peer-
reviewed/cases_1_07.cfm. Accessed November 9, 2011.
16. Wandersman A, Florin P. Community interventions and
effective prevention. Am Psychol.
2003;58:441-448.
17. Nation M, Crusto C, Wandersman A, et al. What works in
prevention: Principles of effective
prevention programs. Am Psychol. 2003;58:449-456.
18. Mattson M, Basu A. Centers for Disease Control’s DES
Update: A case for effective opera-
tionlization of messaging in social marketing practice. Health
Promot Pract. 2010a;11:580-588.
19. Mattson M, Basu A. The message development tool: A case
for effective operationalization
of messaging in social marketing practice. Health Market Q.
50. 2010b;27:275-290.
20. Kotler P, Lee NR. Social marketing: Influencing behaviors
for good. 3rd ed. Thousand
Oaks, CA: Sage; 2008.
21. Murray-Johnson L, Witte K. Looking toward the future:
Health message design strategies.
In Thompson TL, Dorsey AM, Miller KI, Parrott R, eds.
Handbook of health communication.
Mahwah, NJ: Lawrence Erlbaum; 2003:473-495.
22. Kiwanuka-Tondo J, Snyder LB. The influence of
organizational characteristics and cam-
paign design elements on communication campaign quality:
Evidence from 91 Ugandan AIDS
campaigns. J Health Commun. 2002;7:59-77.
23. Airhihenbuwa, CO. Health and culture: Beyond the Western
paradigm. Thousand Oaks, CA:
Sage; 1995.
72
www.casesjournal.org
24. Airhihenbuwa CO, Obregon R. A critical assessment of
theories/models used in health com-
munication for HIV/AIDS. J Health Commun. 2000;5(supp):5-
15.
25. Potter SJ, Stapleton J. Bringing in the target audience in
bystander social marketing mate-
rials for communities: Suggestions for practitioners.” Violence
51. Against Women. 2011;17:797-812.
26. Making Health Communication Programs Work. Bethesda,
MD: U.S. Department of Health
and Human Services, National Cancer Institute; 2002.
27. Purdue University Student Wellness Office. Student
Wellness Survey. 2007.
28. Abbey A, Ross LT, McDuffie D, McAuslan P. Alcohol and
dating risk factors for sexual as-
sault among college women. Psychol Women Quart.
1996;20:147-169.
29. Abbey A, McAuslan P, Ross LT. Sexual assault perpetration
by college men: The role of
alcohol, misperception of sexual intent, and sexual beliefs and
experiences. J Clin Psychol.
1998;17:167-195.
30. Sanday PR. Fraternity gang rape: Sex, brotherhood, and
privilege on campus. (2nd ed). New
York, NY: New York University Press; 2007.
31. Carmody DC, Washington LM. Rape myth acceptance
among college women: The impact of
race and prior victimization. J Interpers Violence. 2001;16:424-
436.
32. Burt M. Cultural myths and supports for rape. J Pers Soc
Psychol. 1980;38:23-38.
33. The Date Safe Project.
http://www.canikissyou.com/schools/. Accessed June 11, 2011.
34. The Consensual Project: Connecting through consent.
52. http://www.theconsensualproject.
com/?int=close. Accessed June 11, 2011.
35. Fantasia HC. Really not even a decision any more: Late
adolescent narratives of implied
sexual consent. J Forensic Nurs. 2011;7:120-129.
36. Blythe MJ, Fortenberry D, Tamkit M, Tu W, Orr DP.
Incidence and correlates of unwanted
sex in relationships of middle and late adolescent women. Arch
Pediat Adol Med. 2006;160:591-
595.
37. Centers for Disease Control and Prevention. CDCynergy.
Atlanta, GA; 2003.
73
www.casesjournal.org
38. Sampson R. Acquaintance rape of college students.
Washington, DC: U.S. Department of
Justice, Office of Community Oriented Policing Services; 2002.
http://www.cops.usdoj.gov/pdf/
e03021472.pdf. Accessed on October 30, 2010.
39. Schwartz M, DeKeseredy W. Sexual assault on the college
campus: The role of male peer
support. Thousand Oaks, CA: Sage Publications; 1997.
40. Ostrander C, Schwartz J. Crime at college: The student
guide to personal safety. Ithaca, NY:
New Strategist Publications; 1994.
53. 41. Krueger RA, Casey MA. Focus groups: A practical guide for
applied research. 3rd ed. Thou-
sand Oaks, CA: Sage; 2000.
42. Levinson J, Godin S. The guerilla marketing handbook.
Chicago, IL: Enterprise Danborn;
1994.
43. Hayes Z. Editor-in-chief issues apology for graphic. The
Exponent. September 20, 2010: np.
http://archive.purdueexponent.org/?module=article&story_id=22
566. Accessed June 10, 2011.
44. Letters to the editor 9/20: ‘Sex position of the week’
graphic elicits angry response. The
Exponent. September 20, 2010: np.
http://archive.purdueexponent.org/?module=article&story_
id=22567. Accessed June 11, 2010.
45. Groth AN, Burgess W, Holmstrom LL. Rape: power, anger,
and sexuality. Am J Psychiatry.
1977;134:1239-1243.
46. Connell R. Gender and power: society, the person, and
sexual politics. Stanford University
Press, CA: 1987.
47. Smith PH, Thornton GE, Devellis R, Earp J, Coker AL.
Prevalence and distinctiveness of
battering, physical assault and sexual assault in a population-
based sample. Violence Against
Women. 2002;8:1209-1232.
74
54. www.casesjournal.org
Author Information
Emily Haas is a PhD candidate studying health communication
at Purdue University and a coordinator for the Indiana Campus
Sexual Assault Primary Prevention Project. Emily contributed to
the conceptual design of the social marketing campaign, as well
as
guided and provided technical assistance during each phase of
the
HCCF, particularly the analysis of data collected, and
manuscript
writing.
Marifran Mattson is a professor of communication at Purdue
Uni-
versity. Marifran contributed to the conceptual design of the
social
marketing campaign, offering expertise in how the HCCF can
guide
the creation of a social marketing campaign, and manuscript
writ-
ing.
Kathlyn Wilkinson is the Sexual Health Educator at Purdue Uni -
versity and the project director for the Sexual Violence Primary
Prevention Campaign. Kathlyn progressed through and guided
the
campaign working group through the HCCF, which included
gath-
ering local data, drafting, testing, and finalizing messages, and
eventually implementing the campaign on campus. She served
as
the campaign practitioner and was the point of contact if anyone