1. Discuss the nursing implications of the findings of the research. Consider the following questions:
· Were the results statistically significant, if reported?
· What is the clinical significance of the findings?
· What are the risks vs. benefits to practice of the findings?
· Are the findings feasible to implement?
Work 57 (2017) 259–268
DOI:10.3233/WOR-172551
IOS Press
259
“I’ve never been able to stay in a job”:
A qualitative study of Veterans’
experiences of maintaining employment
Molly Harroda,∗, Erin M. Millerb, Jennifer Henrya and Kara Zivina,b,c,d
a VA Center for Clinical Management Research, VA Ann Arbor Health Care System, Ann Arbor, MI, USA
bDepartment of Psychiatry, University of Michigan Medical School, Ann Arbor, MI, USA
cDepartment of Health Management and Policy, University of Michigan School of Public Health,
Ann Arbor, MI, USA
dInstitute for Social Research, University of Michigan, Ann Arbor, MI, USA
Received 5 February 2016
Accepted 4 December 2016
Abstract.
BACKGROUND: Ensuring Veteran employment needs are met is a top priority for the Department of Veteran Affairs
and the United States government. However, Veterans, especially those with mental health disorders, continue to encounter
difficulties when employed. While many employment related programs offer numerous services aimed at helping Veterans
gain employment, their ability to maintain long-term employment remains unknown.
OBJECTIVE: The objective of this study was to understand factors that affect the ability of Veterans with mental health
disorders to maintain long-term employment.
METHODS: An exploratory, qualitative study design consisting of semi-structured interviews with 10 Veterans was per-
formed. Inductive thematic analysis was performed to identify salient themes.
RESULTS: We found that participants’ symptoms manifested themselves within the workplace affecting their ability to
maintain employment, participants felt as if they had been demoted from what they did in the military, and they felt unable
to relate to civilian co-workers. Strategies that helped some transition into the civilian workforce were also identified.
CONCLUSIONS: A better understanding of the difficulties some Veterans face when trying to maintain employment is
needed. Our findings suggest that increasing awareness of existing programs and ensuring that services provide resources
and skills that help Veterans maintain long-term employment is critical.
Keywords: Long-term employment, mental health, reintegration
1. Introduction
Within the United States there are approximately
5.5 million Veterans who served during the Gulf War
era (from August 1990 until present) [1]. These Vet-
erans are younger, more likely to be of working age
(18–55), and looking to secure civilian employment.
∗Address for correspondence: Molly Harrod, HSR&D (152)
P.O. Box 130170 Ann Arbor, MI 48113-0170, USA. Tel.: +1 734
845 3600; Fax: +1 734 222 7503; E-mail: [email protected]
Ensuring that V ...
Abstract— If job satisfaction is there in employees, work done by these employees is usually of better quality in comparison where the employees are not satisfied with their jobe. So this study to assess job satisfaction and influence of demographic variables on job satisfaction, this study was carried out on 105 doctors of teaching hospitals. Questionnaire method of data collection was adopted. Job satisfaction was measured by six domains: Organizational functioning, Interpersonal relationship, Financial incentives, Non-financial incentives, Physical facilities and Working conditions. Study observed that over all, doctors were moderately satisfied with their job. Domains such as Interpersonal relationship and Working conditions, doctors were highly satisfied, whereas rest of the domains: Organizational functioning, Financial incentives, Non-financial incentives, and Physical facilities doctors were moderately satisfied. It is important to note that even though overall satisfaction is moderate, there were few components, where doctors were highly satisfied were - Communication system between patients and doctors, Involvement in decision making in the department, Rules and regulations of the institution, relationship between the department colleagues and other department colleagues, Provision for leave encashment, reward given for research work, workload of clinical aspect and workload of teaching aspect. Age and sex both shown significant association on level of satisfaction where as experience, designation and marital status of the doctors have not shown significant association.
MEDSURG Nursing—November/December 2010—Vol. 19/No. 6 335
Carol Isaac MacKusick, PhD(c), MSN,
RN, CNN, is an Assistant Professor of
Nursing, Clayton State University,
Morrow, GA.
Ptlene Minick, PhD, RN, is Doctoral
Faculty and Associate Professor of
Nursing, Georgia State University,
Atlanta, GA.
Carol Isaac MacKusick
Ptlene Minick
Why Are Nurses Leaving? Findings
From an Initial Qualitative Study on
Nursing Attrition
In the United States, nursing workforce projections indicate the registerednurse (RN) shortage may exceed 500,000 RNs by 2025 (American
Association of Colleges of Nursing [AACN], 2010; Cipriano, 2006; U.S.
Department of Health and Human Services, 2002). In 2008, the national RN
vacancy rate in the United States was greater than 8% (AACN, 2010).
Evidence suggests experiences as a newly licensed RN directly impact indi-
vidual perceptions related to the profession (Cowin & Hengstberger-Sims,
2006). An estimated 30%-50% of all new RNs elect either to change positions
or leave nursing completely within the first 3 years of clinical practice
(AACN, 2003; Aiken, Clarke, Sloane, Sochalski, & Silber, 2002; Cipriano, 2006;
Cowin & Hengstberger-Sims, 2006). While an abundance of data exist regard-
ing the RN who stays at the bedside, few studies have explored the percep-
tions of the RN who decides to leave clinical nursing. Understanding factors
associated with RNs’ practice decisions is the first step necessary in devel-
oping effective nursing-retention strategies.
Purpose
The purpose of this study was to identify the factors influencing the
decision of RNs to leave clinical nursing practice. Nurses who had elected
to leave clinical nursing were interviewed at the setting of their choice.
Previous clinical nursing experience included a variety of clinical practice
settings. For this study, the term clinical nursing is defined as providing
direct patient care in the hospital setting.
Background
Limited data exist about individuals no longer employed in nursing; no
literature was found about the perceptions or decision-making processes of
RNs no longer in clinical practice. A review of the literature was conducted
searching nursing, medical, labor, and psychological/sociological databas-
es. Years of search ended with 2007, the year of the interviews. A broad
search began with GoogleScholar® and was narrowed to include CINAHL,
MEDline, PsycINFO, and LexisNexis. Several issues concerning practice
decisions are associated with the current nursing shortage, including job
dissatisfaction (Aiken et al., 2002; Buerhaus, Donelan, Ulrich, Norman, &
Dittus, 2005), an aging workforce coupled with increased demands
(Auerbach, Buerhaus, & Staiger, 2007), and problematic relationships
among members of the health care team (Aiken et al., 2002). While these fac-
tors may lead to increased nursing attrition, they have not been explored
from the perspective of the former RN. A thorough examination of RNs’ per-
ceptions regarding the decision to ...
401JRRDJRRD Volume 51, Number 3, 2014Pages 401–414Rece.docxgilbertkpeters11344
401
JRRDJRRD Volume 51, Number 3, 2014Pages 401–414
Receipt of employment services among Veterans Health Administration
users with psychiatric diagnoses
Kristen M. Abraham, PhD;1–3* Dara Ganoczy, MPH;4 Matheos Yosef, PhD;2 Sandra G. Resnick, PhD;5–6
Kara Zivin, PhD2,4,7
1Department of Psychology, University of Detroit Mercy, Detroit, MI; 2Department of Psychiatry, University of Michi-
gan Medical School, Ann Arbor, MI; 3Department of Veterans Affairs (VA) Serious Mental Illness Treatment Resource
and Evaluation Center, Ann Arbor, MI; 4VA Center for Clinical Management Research, Ann Arbor, MI; 5Department of
Psychiatry, Yale University School of Medicine, New Haven, CT; 6VA New England Mental Illness Research, Educa-
tion, and Clinical Center, West Haven, CT; 7Department of Health Management and Policy, School of Public Health;
and Institute for Social Research, University of Michigan, Ann Arbor, MI
Abstract—This study examined the population-based reach of
Veterans Health Administration (VHA) employment services
to VHA patients with psychiatric diagnoses. Reach of services
includes the percentage and characteristics of people who
accessed services compared with those who did not. Using
clinical administrative data, we identified patients with a psy-
chiatric diagnosis among a random sample of all patients who
received VHA services in 1 yr. Among VHA patients with psy-
chiatric diagnoses, we examined their likelihood of receiving
any VHA employment services and specific types of employ-
ment services, including supported employment, transitional
work, incentive therapy, and vocational assistance. We identi-
fied clinical and demographic characteristics associated with
receiving employment services. Results indicated that 4.2% of
VHA patients with a psychiatric diagnosis received employ-
ment services. After adjusting for clinical and demographic
characteristics, VHA patients with schizophrenia and bipolar
disorder were more likely to receive any employment services
and to receive supported employment than were patients with
depression, PTSD, or other anxiety disorders. VHA patients
with depression and PTSD were more likely to receive transi-
tional work and vocational assistance than patients with
schizophrenia. Future studies should examine system-level
barriers to receiving employment services and identify types of
employment services most appropriate for Veterans with dif-
ferent psychiatric diagnoses.
Key words: access, anxiety disorders, bipolar disorder
employment services, depression, mental illness, psychiatric
diagnosis, PTSD, schizophrenia, supported employment, tran-
sitional work, veterans, vocational rehabilitation.
INTRODUCTION
It is well known that people with severe mental ill-
nesses, such as schizophrenia and bipolar disorder, face
Abbreviations: FY = fiscal year, ICD = International Classifi-
cation of Diseases, IT = incentive therapy, OIF/OEF/OND =
Operation Iraqi Freedom/Operation Enduri.
Abstract— If job satisfaction is there in employees, work done by these employees is usually of better quality in comparison where the employees are not satisfied with their jobe. So this study to assess job satisfaction and influence of demographic variables on job satisfaction, this study was carried out on 105 doctors of teaching hospitals. Questionnaire method of data collection was adopted. Job satisfaction was measured by six domains: Organizational functioning, Interpersonal relationship, Financial incentives, Non-financial incentives, Physical facilities and Working conditions. Study observed that over all, doctors were moderately satisfied with their job. Domains such as Interpersonal relationship and Working conditions, doctors were highly satisfied, whereas rest of the domains: Organizational functioning, Financial incentives, Non-financial incentives, and Physical facilities doctors were moderately satisfied. It is important to note that even though overall satisfaction is moderate, there were few components, where doctors were highly satisfied were - Communication system between patients and doctors, Involvement in decision making in the department, Rules and regulations of the institution, relationship between the department colleagues and other department colleagues, Provision for leave encashment, reward given for research work, workload of clinical aspect and workload of teaching aspect. Age and sex both shown significant association on level of satisfaction where as experience, designation and marital status of the doctors have not shown significant association.
MEDSURG Nursing—November/December 2010—Vol. 19/No. 6 335
Carol Isaac MacKusick, PhD(c), MSN,
RN, CNN, is an Assistant Professor of
Nursing, Clayton State University,
Morrow, GA.
Ptlene Minick, PhD, RN, is Doctoral
Faculty and Associate Professor of
Nursing, Georgia State University,
Atlanta, GA.
Carol Isaac MacKusick
Ptlene Minick
Why Are Nurses Leaving? Findings
From an Initial Qualitative Study on
Nursing Attrition
In the United States, nursing workforce projections indicate the registerednurse (RN) shortage may exceed 500,000 RNs by 2025 (American
Association of Colleges of Nursing [AACN], 2010; Cipriano, 2006; U.S.
Department of Health and Human Services, 2002). In 2008, the national RN
vacancy rate in the United States was greater than 8% (AACN, 2010).
Evidence suggests experiences as a newly licensed RN directly impact indi-
vidual perceptions related to the profession (Cowin & Hengstberger-Sims,
2006). An estimated 30%-50% of all new RNs elect either to change positions
or leave nursing completely within the first 3 years of clinical practice
(AACN, 2003; Aiken, Clarke, Sloane, Sochalski, & Silber, 2002; Cipriano, 2006;
Cowin & Hengstberger-Sims, 2006). While an abundance of data exist regard-
ing the RN who stays at the bedside, few studies have explored the percep-
tions of the RN who decides to leave clinical nursing. Understanding factors
associated with RNs’ practice decisions is the first step necessary in devel-
oping effective nursing-retention strategies.
Purpose
The purpose of this study was to identify the factors influencing the
decision of RNs to leave clinical nursing practice. Nurses who had elected
to leave clinical nursing were interviewed at the setting of their choice.
Previous clinical nursing experience included a variety of clinical practice
settings. For this study, the term clinical nursing is defined as providing
direct patient care in the hospital setting.
Background
Limited data exist about individuals no longer employed in nursing; no
literature was found about the perceptions or decision-making processes of
RNs no longer in clinical practice. A review of the literature was conducted
searching nursing, medical, labor, and psychological/sociological databas-
es. Years of search ended with 2007, the year of the interviews. A broad
search began with GoogleScholar® and was narrowed to include CINAHL,
MEDline, PsycINFO, and LexisNexis. Several issues concerning practice
decisions are associated with the current nursing shortage, including job
dissatisfaction (Aiken et al., 2002; Buerhaus, Donelan, Ulrich, Norman, &
Dittus, 2005), an aging workforce coupled with increased demands
(Auerbach, Buerhaus, & Staiger, 2007), and problematic relationships
among members of the health care team (Aiken et al., 2002). While these fac-
tors may lead to increased nursing attrition, they have not been explored
from the perspective of the former RN. A thorough examination of RNs’ per-
ceptions regarding the decision to ...
401JRRDJRRD Volume 51, Number 3, 2014Pages 401–414Rece.docxgilbertkpeters11344
401
JRRDJRRD Volume 51, Number 3, 2014Pages 401–414
Receipt of employment services among Veterans Health Administration
users with psychiatric diagnoses
Kristen M. Abraham, PhD;1–3* Dara Ganoczy, MPH;4 Matheos Yosef, PhD;2 Sandra G. Resnick, PhD;5–6
Kara Zivin, PhD2,4,7
1Department of Psychology, University of Detroit Mercy, Detroit, MI; 2Department of Psychiatry, University of Michi-
gan Medical School, Ann Arbor, MI; 3Department of Veterans Affairs (VA) Serious Mental Illness Treatment Resource
and Evaluation Center, Ann Arbor, MI; 4VA Center for Clinical Management Research, Ann Arbor, MI; 5Department of
Psychiatry, Yale University School of Medicine, New Haven, CT; 6VA New England Mental Illness Research, Educa-
tion, and Clinical Center, West Haven, CT; 7Department of Health Management and Policy, School of Public Health;
and Institute for Social Research, University of Michigan, Ann Arbor, MI
Abstract—This study examined the population-based reach of
Veterans Health Administration (VHA) employment services
to VHA patients with psychiatric diagnoses. Reach of services
includes the percentage and characteristics of people who
accessed services compared with those who did not. Using
clinical administrative data, we identified patients with a psy-
chiatric diagnosis among a random sample of all patients who
received VHA services in 1 yr. Among VHA patients with psy-
chiatric diagnoses, we examined their likelihood of receiving
any VHA employment services and specific types of employ-
ment services, including supported employment, transitional
work, incentive therapy, and vocational assistance. We identi-
fied clinical and demographic characteristics associated with
receiving employment services. Results indicated that 4.2% of
VHA patients with a psychiatric diagnosis received employ-
ment services. After adjusting for clinical and demographic
characteristics, VHA patients with schizophrenia and bipolar
disorder were more likely to receive any employment services
and to receive supported employment than were patients with
depression, PTSD, or other anxiety disorders. VHA patients
with depression and PTSD were more likely to receive transi-
tional work and vocational assistance than patients with
schizophrenia. Future studies should examine system-level
barriers to receiving employment services and identify types of
employment services most appropriate for Veterans with dif-
ferent psychiatric diagnoses.
Key words: access, anxiety disorders, bipolar disorder
employment services, depression, mental illness, psychiatric
diagnosis, PTSD, schizophrenia, supported employment, tran-
sitional work, veterans, vocational rehabilitation.
INTRODUCTION
It is well known that people with severe mental ill-
nesses, such as schizophrenia and bipolar disorder, face
Abbreviations: FY = fiscal year, ICD = International Classifi-
cation of Diseases, IT = incentive therapy, OIF/OEF/OND =
Operation Iraqi Freedom/Operation Enduri.
Staying Strong by Seeking Help: Barriers and Facilitators to Military Mental ...MFLNFamilyDevelopmnt
This 90-minute webinar addresses the determinants of mental health treatment seeking among military personnel and interventions to increase the percentage of military personnel seeking treatment. Determinants of treatment seeking address both barriers and facilitators. Barriers include such factors as the perceived stigma associated with harm to one’s career and differential treatment by fellow service members, negative attitudes toward mental health treatment, not having enough time to work treatment into a busy schedule, and a preference for handling problems oneself. Facilitators of treatment seeking include the support of family and friends, leaders, and unit members, positive attitudes toward mental health treatment, and a recognition that symptoms are interfering with performance and relationships. Interventions to reduce barriers and increase facilitators of treatment seeking are discussed, including emphasizing mental health treatment as a mechanism for increasing resilience, modifications to the number and duration of treatment sessions, and increasing supportive behaviors by fellow unit members for helping service members receive and remain in treatment.
Tami Frazier Initial Discussion PostNURS 6052 – Essentials of .docxperryk1
Tami Frazier
Initial Discussion Post
NURS 6052 – Essentials of Evidence-Based Practice
Week 8 Initial Discussion Post
Planning for Data Collection
Evidence-based practice is a theory that consists of using research to guide decision making in clinical and nursing settings. For research to be reliable and have validity a significant amount of data collection must first be collected. Whether a research project is using quantitative, qualitative, or mixed-methods design, it is essential to determine what types of information is needed. Due to the emphasis on patient satisfaction in the healthcare world at this time, it is crucial to evaluate how that care is being delivered (Krietz, Winters & Pedowitz, 2016). In this post, I will discuss using a survey method to obtain information representative of the population within a clinic setting.
In the example, I am a nurse working in a local primary care facility which sees thousands of patients annually. To make better clinical decisions regarding patient care and satisfaction, five questions have been created to elicit feedback. The questions are as follows:
1. Did you feel the wait time to be seen in the office was appropriate?
2. During your visit, did you feel the nurses and staff listened to your concerns and treated you with courtesy and respect?
3. Did the provider spend enough time listening, discussing care, and answering your questions?
4. Based on your experience today, would you recommend our clinic to someone you know?
5. In your opinion, what could our clinic have done better?
To obtain structured data that is self-reported and applicable to the clinic’s objectives, it is vital to determine which instrument would work best for the clientele. Self-report methods can extract information from patients that might otherwise be difficult to get (Polit & Beck, 2017). Allowing the freedom to report their experiences and feelings increases confidence in the clinic’s desire to meet their needs. If researchers know what data they want to obtain, a structured approach with some open-ended and closed questions can garner the information needed to make significant changes (Polit & Beck, 2017). Using a mixture of questions is an attempt to include all patients.
For this scenario, the questionnaire is a sampling of both types of questions and is the most popular method (Keough & Tanabe, 2011). The study will be given to individuals 18 and over. The questionnaire and a pen will be given to the patient by the nurse prior at the start of their appointment with the physician. An explanation of the questionnaire will be provided with instructions to return their questionnaire to the drop-box on the countertop in the room after their exam. The goal for participation is 500 patient responses over six months. Responses will be collected and responses logged into the computer on Fridays by the nurse manager. After the six months, results will be calculated, and staff will be informed of the result.
Gender Differences in Motivational Factors towards Medical Career Choiceiosrjce
The present study aims to study motivations of students in choosing the medical profession and
whether these motivations are different, gender wise along with their demographic features. The study was
conducted on 150 students of MIMER Medical College, Pune. Demographic result of the study indicated that
enrolment in medical faculty was more by girls (83) than by boys (67) and majority of students came from
medical family. A primary motivation factor in girls was patient care, interest in science, career opportunity
and personal skills. While in boys it was patient care, interest in science, status –security, self-employment. To
pursue the medical profession other motivating factors was number of attempts in medical entrance exam held,
there was no difference found in both gender statistically. But statistically significance was found gender wise,
in getting encouragement from family, in girls it was more encouragement. Also statistic significance was found
in girls for deciding the career choice before X classes compare to boy students, indicating girls are early
decider
Dr Geoff Waghorn is from the Queensland Center for Mental Health Research, Australia and spent 8 days based at Sainsbury Centre as part of an International Initiative for Mental Health Leadership event.
He presented an Australian perspective on IPS to a group of colleagues in London.
Originally uploaded on 28 May 2010.
This report was produced by Peter Butterworth, Liana S. Leach and Kim M. Kiely of the Centre for Research on Ageing, Health and Wellbeing, The Australian National University under commission from Safe Work Australia.
Challenges and hurdles to implement e health in developing countriesMandirola, Humberto
Health informatics has the potential to show improve-ments in security and quality of patient's care, but its spread has some differences between developed and de-veloping countries. Related to this, the objective of this study is to know which are the challenges and hurdles to improve eHealth in developing countries. We surveyed experts to evaluate their opinion about 5 general ques-tions: economic support by Government for eHealth, Government education or training projects in the field, issues related to cultural or educational problems for the implementation of eHealth, policies in terminology or messaging standards and eHealth status policies for long periods.
Good medical practice covers a very wide range of issues, including matters of clinical competence and standards relating to more personal and interpersonal skills and attributes, like probity, communication and doctor-patient relationships. Today the patient sees himself as a buyer of health services. Once this concept is accepted, then there is a need to recognize that every patient has certain rights, which puts a special emphasis on to the delivery of quality health care. It is therefore essential that it is informed by a clear understanding of what expectations society actually has of doctors. These expectations are unlikely to be fixed and may be influenced by broader social, moral and cultural shifts.
REVIEW ARTICLEExploring positive pathways to care for memb.docxronak56
REVIEW ARTICLE
Exploring positive pathways to care for members of
the UK Armed Forces receiving treatment for PTSD:
a qualitative study
Dominic Murphy1*, Elizabeth Hunt1, Olga Luzon2 and Neil Greenberg1
1King’s Centre for Military Health Research, King’s College London, London, UK; 2Department of
Clinical Psychology, Royal Holloway University, London, UK
Objective: To examine the factors which facilitate UK military personnel with post-traumatic stress disorder
(PTSD) to engage in help-seeking behaviours.
Methods: The study recruited active service personnel who were attending mental health services, employed a
qualitative design, used semi-structured interview schedules to collect data, and explored these data using
interpretative phenomenological analysis (IPA).
Results: Five themes emerged about how participants were able to access help; having to reach a crisis point
before accepting the need for help, overcoming feelings of shame, the importance of having an internal locus
of control, finding a psychological explanation for their symptoms and having strong social support.
Conclusions: This study reported that for military personnel who accessed mental health services, there were a
number of factors that supported them to do so. In particular, factors that combated internal stigma, such as
being supported to develop an internal locus of control, appeared to be critical in supporting military
personnel to engage in help-seeking behaviour.
Keywords: Military health; PTSD; depression; pathways; stigma; barriers
*Correspondence to: Dominic Murphy, KCMHR, Weston Education Centre, Cutcombe Road, SE5 9PR
London, UK, Email: [email protected]
For the abstract or full text in other languages, please see Supplementary files under Article Tools online
Received: 17 June 2013; Revised: 4 October 2013; Accepted: 20 November 2013; Published: 17 February 2014
S
ince 2002, the UK and US military’s have con-
ducted highly challenging operations in Afghanistan
and Iraq. These military operations have been
the focus of a number of large-scale epidemiological re-
search studies, which have investigated the psychological
health of US and UK service personnel. Studies in the
United States have observed rates of post-traumatic stress
disorder (PTSD) in deployed personnel to be between
8 and 18% (Hoge et al., 2004; Smith et al., 2008). Further,
13% of participants met criteria for alcohol problems
and 18% for symptoms of anxiety and depression, with a
very high co-morbidity rate between these disorders and
PTSD (Riddle et al., 2007; Smith et al., 2008). This
increase in the rate of PTSD following deployment has
been replicated prospectively (Vasterling et al., 2006).
However, in the UK, the effects of the conflict upon the
mental health of service personnel have been quite
different.
The most extensive UK epidemiological studies of
service personnel since 2003 have been carried out at
King’s College London. This study is based o ...
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1. Discuss the nursing implications of the findings of the researc
Staying Strong by Seeking Help: Barriers and Facilitators to Military Mental ...MFLNFamilyDevelopmnt
This 90-minute webinar addresses the determinants of mental health treatment seeking among military personnel and interventions to increase the percentage of military personnel seeking treatment. Determinants of treatment seeking address both barriers and facilitators. Barriers include such factors as the perceived stigma associated with harm to one’s career and differential treatment by fellow service members, negative attitudes toward mental health treatment, not having enough time to work treatment into a busy schedule, and a preference for handling problems oneself. Facilitators of treatment seeking include the support of family and friends, leaders, and unit members, positive attitudes toward mental health treatment, and a recognition that symptoms are interfering with performance and relationships. Interventions to reduce barriers and increase facilitators of treatment seeking are discussed, including emphasizing mental health treatment as a mechanism for increasing resilience, modifications to the number and duration of treatment sessions, and increasing supportive behaviors by fellow unit members for helping service members receive and remain in treatment.
Tami Frazier Initial Discussion PostNURS 6052 – Essentials of .docxperryk1
Tami Frazier
Initial Discussion Post
NURS 6052 – Essentials of Evidence-Based Practice
Week 8 Initial Discussion Post
Planning for Data Collection
Evidence-based practice is a theory that consists of using research to guide decision making in clinical and nursing settings. For research to be reliable and have validity a significant amount of data collection must first be collected. Whether a research project is using quantitative, qualitative, or mixed-methods design, it is essential to determine what types of information is needed. Due to the emphasis on patient satisfaction in the healthcare world at this time, it is crucial to evaluate how that care is being delivered (Krietz, Winters & Pedowitz, 2016). In this post, I will discuss using a survey method to obtain information representative of the population within a clinic setting.
In the example, I am a nurse working in a local primary care facility which sees thousands of patients annually. To make better clinical decisions regarding patient care and satisfaction, five questions have been created to elicit feedback. The questions are as follows:
1. Did you feel the wait time to be seen in the office was appropriate?
2. During your visit, did you feel the nurses and staff listened to your concerns and treated you with courtesy and respect?
3. Did the provider spend enough time listening, discussing care, and answering your questions?
4. Based on your experience today, would you recommend our clinic to someone you know?
5. In your opinion, what could our clinic have done better?
To obtain structured data that is self-reported and applicable to the clinic’s objectives, it is vital to determine which instrument would work best for the clientele. Self-report methods can extract information from patients that might otherwise be difficult to get (Polit & Beck, 2017). Allowing the freedom to report their experiences and feelings increases confidence in the clinic’s desire to meet their needs. If researchers know what data they want to obtain, a structured approach with some open-ended and closed questions can garner the information needed to make significant changes (Polit & Beck, 2017). Using a mixture of questions is an attempt to include all patients.
For this scenario, the questionnaire is a sampling of both types of questions and is the most popular method (Keough & Tanabe, 2011). The study will be given to individuals 18 and over. The questionnaire and a pen will be given to the patient by the nurse prior at the start of their appointment with the physician. An explanation of the questionnaire will be provided with instructions to return their questionnaire to the drop-box on the countertop in the room after their exam. The goal for participation is 500 patient responses over six months. Responses will be collected and responses logged into the computer on Fridays by the nurse manager. After the six months, results will be calculated, and staff will be informed of the result.
Gender Differences in Motivational Factors towards Medical Career Choiceiosrjce
The present study aims to study motivations of students in choosing the medical profession and
whether these motivations are different, gender wise along with their demographic features. The study was
conducted on 150 students of MIMER Medical College, Pune. Demographic result of the study indicated that
enrolment in medical faculty was more by girls (83) than by boys (67) and majority of students came from
medical family. A primary motivation factor in girls was patient care, interest in science, career opportunity
and personal skills. While in boys it was patient care, interest in science, status –security, self-employment. To
pursue the medical profession other motivating factors was number of attempts in medical entrance exam held,
there was no difference found in both gender statistically. But statistically significance was found gender wise,
in getting encouragement from family, in girls it was more encouragement. Also statistic significance was found
in girls for deciding the career choice before X classes compare to boy students, indicating girls are early
decider
Dr Geoff Waghorn is from the Queensland Center for Mental Health Research, Australia and spent 8 days based at Sainsbury Centre as part of an International Initiative for Mental Health Leadership event.
He presented an Australian perspective on IPS to a group of colleagues in London.
Originally uploaded on 28 May 2010.
This report was produced by Peter Butterworth, Liana S. Leach and Kim M. Kiely of the Centre for Research on Ageing, Health and Wellbeing, The Australian National University under commission from Safe Work Australia.
Challenges and hurdles to implement e health in developing countriesMandirola, Humberto
Health informatics has the potential to show improve-ments in security and quality of patient's care, but its spread has some differences between developed and de-veloping countries. Related to this, the objective of this study is to know which are the challenges and hurdles to improve eHealth in developing countries. We surveyed experts to evaluate their opinion about 5 general ques-tions: economic support by Government for eHealth, Government education or training projects in the field, issues related to cultural or educational problems for the implementation of eHealth, policies in terminology or messaging standards and eHealth status policies for long periods.
Good medical practice covers a very wide range of issues, including matters of clinical competence and standards relating to more personal and interpersonal skills and attributes, like probity, communication and doctor-patient relationships. Today the patient sees himself as a buyer of health services. Once this concept is accepted, then there is a need to recognize that every patient has certain rights, which puts a special emphasis on to the delivery of quality health care. It is therefore essential that it is informed by a clear understanding of what expectations society actually has of doctors. These expectations are unlikely to be fixed and may be influenced by broader social, moral and cultural shifts.
REVIEW ARTICLEExploring positive pathways to care for memb.docxronak56
REVIEW ARTICLE
Exploring positive pathways to care for members of
the UK Armed Forces receiving treatment for PTSD:
a qualitative study
Dominic Murphy1*, Elizabeth Hunt1, Olga Luzon2 and Neil Greenberg1
1King’s Centre for Military Health Research, King’s College London, London, UK; 2Department of
Clinical Psychology, Royal Holloway University, London, UK
Objective: To examine the factors which facilitate UK military personnel with post-traumatic stress disorder
(PTSD) to engage in help-seeking behaviours.
Methods: The study recruited active service personnel who were attending mental health services, employed a
qualitative design, used semi-structured interview schedules to collect data, and explored these data using
interpretative phenomenological analysis (IPA).
Results: Five themes emerged about how participants were able to access help; having to reach a crisis point
before accepting the need for help, overcoming feelings of shame, the importance of having an internal locus
of control, finding a psychological explanation for their symptoms and having strong social support.
Conclusions: This study reported that for military personnel who accessed mental health services, there were a
number of factors that supported them to do so. In particular, factors that combated internal stigma, such as
being supported to develop an internal locus of control, appeared to be critical in supporting military
personnel to engage in help-seeking behaviour.
Keywords: Military health; PTSD; depression; pathways; stigma; barriers
*Correspondence to: Dominic Murphy, KCMHR, Weston Education Centre, Cutcombe Road, SE5 9PR
London, UK, Email: [email protected]
For the abstract or full text in other languages, please see Supplementary files under Article Tools online
Received: 17 June 2013; Revised: 4 October 2013; Accepted: 20 November 2013; Published: 17 February 2014
S
ince 2002, the UK and US military’s have con-
ducted highly challenging operations in Afghanistan
and Iraq. These military operations have been
the focus of a number of large-scale epidemiological re-
search studies, which have investigated the psychological
health of US and UK service personnel. Studies in the
United States have observed rates of post-traumatic stress
disorder (PTSD) in deployed personnel to be between
8 and 18% (Hoge et al., 2004; Smith et al., 2008). Further,
13% of participants met criteria for alcohol problems
and 18% for symptoms of anxiety and depression, with a
very high co-morbidity rate between these disorders and
PTSD (Riddle et al., 2007; Smith et al., 2008). This
increase in the rate of PTSD following deployment has
been replicated prospectively (Vasterling et al., 2006).
However, in the UK, the effects of the conflict upon the
mental health of service personnel have been quite
different.
The most extensive UK epidemiological studies of
service personnel since 2003 have been carried out at
King’s College London. This study is based o ...
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
1. This week, we learned about the balanced scorecard and dashboard reporting, performance measurement, sources of revenues for different types of healthcare organizations, and financial and strategic planning initiatives. For your Unit 3 Complete assignment, write a narrative essay (minimum 1,200 words) in which you first discuss the use of the income statement, in general, for decision-making. Then, calculate the net operating income and operating margin for this year and last year using the table information below and discuss what these figures mean for the company (i.e. what ‘story’ do they tell the reader). Use at least three scholarly sources and remember to demonstrate a thorough understanding of the READ and ATTEND sections in your essay. Cite your sources using APA format.
Table 3
HEALTH CAMPAIGNS:
CREATING & EVALUATING
Day 33
Review
Ch. 8 Review
Activity
Homework
AGENDA:
1.
2.
3.
4.
Public Health
Public health: prevention of disease and illness among groups of people.
Creation of public policy regarding health issues and tracks diseases
_________________
Public health services (CDC)
(Lillie; Mattson & Hall, 2011)
Health Campaigns
Health campaign
Seeks to promote public health
Targets beliefs, attitudes, or behaviors
________- acceptance of something as
true or not
______- positive or negative feeling
about something
________-actions
____________
Goes beyond health education to involve
health information and environmental
support/resources for health
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
4 phases of the health campaign process
1. Establish a working group and ____________
2. Strategic planning from____________
3. _________________ and evaluation
4. ______________on process evaluation and outcome
evaluation
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
(Mattson & Hall, 2011, p. 253)
Phase 1: Establish a
Working Group
_________: core team for
strategic planning and advising
Includes stakeholders, health
experts, organizational
officials, community partners
_________: orgs and
businesses who have an interest in
the campaign
Provide resources:
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
Strategic plan: campaign goal and
plan of action
_______ analysis:
S_______ and
w______of campaign team
(internal to team)
O_____ and t______
(external to campaign)
Ex. grassroots support or
resistant audience
__________: research to
form strategies, select target
audiences, and develop marketing
strategies
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Needs assessment: process to
understand and determine a
community’s/population’s
health issues
Pre-campaign gather info from
Key informants
community forum
survey
_________: already
existing statistics
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Messaging process: after determining
baseline attitudes, beliefs, and behavi ...
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
1. The company I chose was Amazon
2.
3.
4.
1) Keep in mind that the data includes Amazon and competitors
2) Example(For reference only)
Table showing FedEx’s stock quote
Item
Value
Interpretation and brief explanation
Current market price
$274.48
This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock.
Market capitalization
$72.076 Billion
This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding
Beta
1.39 (5 year Monthly)
Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%).
PE Ratio
40.41
In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued.
EPS
$6.79
This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79.
Earning date
December 16th 2020
This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying.
Forward Dividend Yield
2.60 (0.93%)
This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
We all have good and bad thoughts from time to time and situation to situation. We are bombarded daily with spiraling thoughts(both negative and positive) creating all-consuming feel , making us difficult to manage with associated suffering. Good thoughts are like our Mob Signal (Positive thought) amidst noise(negative thought) in the atmosphere. Negative thoughts like noise outweigh positive thoughts. These thoughts often create unwanted confusion, trouble, stress and frustration in our mind as well as chaos in our physical world. Negative thoughts are also known as “distorted thinking”.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
Students, digital devices and success - Andreas Schleicher - 27 May 2024..pptxEduSkills OECD
Andreas Schleicher presents at the OECD webinar ‘Digital devices in schools: detrimental distraction or secret to success?’ on 27 May 2024. The presentation was based on findings from PISA 2022 results and the webinar helped launch the PISA in Focus ‘Managing screen time: How to protect and equip students against distraction’ https://www.oecd-ilibrary.org/education/managing-screen-time_7c225af4-en and the OECD Education Policy Perspective ‘Students, digital devices and success’ can be found here - https://oe.cd/il/5yV
This is a presentation by Dada Robert in a Your Skill Boost masterclass organised by the Excellence Foundation for South Sudan (EFSS) on Saturday, the 25th and Sunday, the 26th of May 2024.
He discussed the concept of quality improvement, emphasizing its applicability to various aspects of life, including personal, project, and program improvements. He defined quality as doing the right thing at the right time in the right way to achieve the best possible results and discussed the concept of the "gap" between what we know and what we do, and how this gap represents the areas we need to improve. He explained the scientific approach to quality improvement, which involves systematic performance analysis, testing and learning, and implementing change ideas. He also highlighted the importance of client focus and a team approach to quality improvement.
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
1. Discuss the nursing implications of the findings of the researc
1. 1. Discuss the nursing implications of the findings of the
research. Consider the following questions:
· Were the results statistically significant, if reported?
· What is the clinical significance of the findings?
· What are the risks vs. benefits to practice of the findings?
· Are the findings feasible to implement?
Work 57 (2017) 259–268
DOI:10.3233/WOR-172551
IOS Press
259
“I’ve never been able to stay in a job”:
A qualitative study of Veterans’
experiences of maintaining employment
Molly Harroda,∗ , Erin M. Millerb, Jennifer Henrya and Kara
Zivina,b,c,d
a VA Center for Clinical Management Research, VA Ann Arbor
Health Care System, Ann Arbor, MI, USA
bDepartment of Psychiatry, University of Michigan Medical
School, Ann Arbor, MI, USA
cDepartment of Health Management and Policy, University of
Michigan School of Public Health,
Ann Arbor, MI, USA
dInstitute for Social Research, University of Michigan, Ann
Arbor, MI, USA
Received 5 February 2016
Accepted 4 December 2016
2. Abstract.
BACKGROUND: Ensuring Veteran employment needs are met
is a top priority for the Department of Veteran Affairs
and the United States government. However, Veterans,
especially those with mental health disorders, continue to
encounter
difficulties when employed. While many employment related
programs offer numerous services aimed at helping Veterans
gain employment, their ability to maintain long-term
employment remains unknown.
OBJECTIVE: The objective of this study was to understand
factors that affect the ability of Veterans with mental health
disorders to maintain long-term employment.
METHODS: An exploratory, qualitative study design consisting
of semi-structured interviews with 10 Veterans was per-
formed. Inductive thematic analysis was performed to identify
salient themes.
RESULTS: We found that participants’ symptoms manifested
themselves within the workplace affecting their ability to
maintain employment, participants felt as if they had been
demoted from what they did in the military, and they felt unable
to relate to civilian co-workers. Strategies that helped some
transition into the civilian workforce were also identified.
CONCLUSIONS: A better understanding of the difficulties
some Veterans face when trying to maintain employment is
needed. Our findings suggest that increasing awareness of
existing programs and ensuring that services provide resources
and skills that help Veterans maintain long-term employment is
critical.
Keywords: Long-term employment, mental health, reintegration
1. Introduction
Within the United States there are approximately
4. erans with mental health disorders. For example,
Sayer et al. [5] surveyed Iraq-Afghanistan combat
Veterans and found that nearly 35% had difficulty
completing tasks, potentially affecting their work
productivity, and nearly 25% experienced job loss.
Additionally, Veterans with post-traumatic stress dis-
order (PTSD) tended to miss more work days, were
unhappy with their employment, and had difficulty
getting along with their co-workers when compared
to non-Veterans [6, 7].
While many employment related programs for Vet-
erans (with and without mental health disorders)
offer numerous services aimed at helping them gain
employment, it remains unclear how many offer ser-
vices related to maintaining employment. In fact, a
study by Burnett-Zeigler et al. [8] found that Veterans
with mental health disorders may have more difficulty
maintaining their employment rather than obtain-
ing employment. Studies have also noted the need
for research and information on reintegration experi-
ences and on-going needs, including those related to
employment of Veterans [4, 9].
Considering that studies [4, 10–13] have found that
unemployment can impede successful reintegration,
it is crucial to not only offer employment support to
Veterans, but to identify gaps in services to main-
tain employment. Therefore, the aim of this study
was to understand factors that may affect the ability
of Veterans with mental health disorders to maintain
long-term employment.
2. Methods
2.1. Study design, sampling and recruitment
5. We conducted an exploratory qualitative study
to better understand the general employment expe-
riences of Veterans with mental health disorders,
and their ability to maintain long-term employment
specifically. We chose a purposive sampling approach
which enables a “detailed exploration and under-
standing of the central themes” (p. 78) of interest
[14]. Thus, Veterans from one VA primary care clinic
were mailed a survey exploring employment related
issues and mental health status [15]. Inclusion criteria
for the survey consisted of patients who had a recent
primary care visit with planned follow-up and were
between the ages of 18 and 55 (ages most associated
with employment). Based on 287 survey responses,
32 respondents who screened positive for depression
and/or anxiety and indicated that they were experi-
encing unemployment, under-employment (workers
who are overqualified for the job they perform or
workers who are working part-time but prefer to work
full-time), or considered themselves to be insecurely
employed were eligible for the interview portion of
the study. All 32 survey respondents were contacted
by phone by the study’s project manager, explained
the purpose of the study, and offered a phone or
in-person interview. If they agreed to participate,
they were mailed a letter describing the study and
the informed consent form. Informed consent was
obtained prior to the interview. Of the 32 eligible,
10 survey respondents agreed to participate in semi-
structured interviews (October 2014-February 2015).
Each participant received a $25 gift card as a token
of appreciation. The local VA medical center Insti-
tutional Review Board approved all aspects of this
study.
6. 2.2. Data collection and analysis
Semi-structured interviews focused on employ-
ment, mental health, and reintegration (Appendix A).
The questions were developed to be open-ended and
explore if and how Veterans were able to maintain
employment. Each interview lasted, on average, 48
minutes (30–89 minutes), was audio-recorded and
transcribed. Transcripts were analyzed using an iter-
ative [16], inductive thematic analysis approach [17].
Prior to coding, all transcripts were read by the first
author (MH) and principal investigator (KZ) to better
understand the data set as a whole. Then, each tran-
script was re-read resulting in codes being created,
defined, and applied. As coding progressed and addi-
tional codes emerged, previously coded transcripts
were revisited to ensure new codes were applied
to all transcripts. All codes, definitions, and criteria
were documented in a codebook. Once initial cod-
ing was complete, pattern coding, in which codes are
reanalyzed and grouped into categories based on sim-
ilarities and relationships, was performed to develop
themes [18]. NVivo 10® software was used to man-
age the data and check for consistent application of
codes. This process led to the development of themes
discussed below.
M. Harrod et al. / Veterans’ experiences of employment 261
3. Results
In order to contextualize participants’ employment
experiences, they were asked about their military his-
7. tory including employment experiences while in the
military and since discharge (see Table 1). All of the
participants were Gulf War era Veterans. Although
post-traumatic stress disorder (PTSD) was not a
criterion for participation in an interview nor did
we ask specifically about this diagnosis, 5 out of
the 10 participants stated they had been diagnosed
with PTSD in conjunction with depression and/or
anxiety either while they were still active duty or
post-discharge.
What follows are three salient themes regard-
ing the difficulties participants faced in maintaining
employment. These themes reflect their experiences
of how their mental health symptoms, especially
those resulting from PTSD, manifested within the
work environment, their feelings of demotion from
what they did in the military to their civilian employ-
ment, and their feelings of being unable relate
to civilian co-workers, all of which affected their
abilities to maintain employment. We also include
strategies that have helped some of the participants
make the transition into the civilian workforce (see
Table 2).
Table 1
Veteran demographics
Gender
Male 8
Female 2
Marital status
Single 0
Married 5
Divorced/Separated 4
8. In a relationship 1
Education
High school or less 3
Some college 2
Bachelor’s or more 5
Military Branch
Army 5
Marines 2
National Guard 2
Navy 1
Years in Military
1–5 years 2
6–10 years 4
11–15 years 2
16+ years 2
Employment status at time of interview
Full-time 2
Part-time 3
In school 2
Unemployed 3
3.1. Symptom manifestation
How PTSD affected some of the participants’ abil-
ity to maintain employment came up organically in
the interviews. They told vivid stories of how their
PTSD symptoms, especially flashbacks which are
common PTSD symptoms [19], manifested while
they were at work. These unexpected events often left
participants struggling with how to react in a civilian
context when reminded of their wartime experience.
For example:
9. “I took a month off after deployment and then I
went back [to substitute teaching] and I was at
[named] High School and as it turns out, their
bell for passing between hours was a lot like the
incoming fire alarm in Iraq and every time I heard
that I would freeze up and at one point I had to say,
‘You know I can’t do this, can I go home?’ and
they knew that I had just come home and they
were like, ‘Yeah, we’re okay with that,’ . . . and
Table 2
Themes with definitions
Theme/Sub-theme Definition
Symptom manifestation Symptoms of PTSD
PTSD effect in
workplace
Stories about how Veterans’
symptoms of PTSD affected their
ability to function in the
workplace.
Triggers Veterans not knowing what would
cause a flashback.
Effect on social
interactions
Talk of how PTSD and its symptoms
impacted Veterans abilities to
interact with co-workers.
10. Feelings of demotion Civilian work did not compare to the
level of importance of Veteran
military careers.
Non-utilization of
military skills
Military skills are context dependent
and may be underutilized.
Inability to relate Difficulties relating to civilian
co-workers
Work ethics Sense that work ethic did not match
those of civilians.
Unappreciated Feeling a lack of respect or lack of
appreciation from co-workers for
their military service.
Lack of camaraderie Lacking a connection to co-workers.
Finding their way Coping mechanisms or strategies
Veterans developed themselves to
maintain employment.
Supportive co-workers Support and understanding from
co-workers, especially supervisors.
Independent work Work that allowed the Veteran to
work independently and control
own environment.
Change in career Change in career that is more
conducive to current needs.
11. 262 M. Harrod et al. / Veterans’ experiences of employment
after that, you know, I just avoided that school
for a little while of course as you can imagine.”
(Identification (ID) #200189)
Compounding these feelings was the uncertainty
of what might trigger a flashback. One participant
spoke of not knowing what his triggers were and
therefore, had difficulty controlling how he felt in
certain situations.
“ . . . [the] hardest part is I don’t know my triggers
for my PTSD. I do know when it hits, it hits,
you know, the anxiety goes up and stuff like that
and the anger just comes right to the top.” (ID
#200219)
These types of reactions occasionally affected their
interactions with co-workers. In an attempt to control
a situation, some of the participants stated that they
would often fall back on how they communicated
and interacted with their fellow soldiers, assuming
this was the way to get work done. They described
how the approach to work is significantly different
in the civilian context and they would often be per-
ceived as being “aggressive” or “harassing” towards
co-workers.
“I get mad at people and talk to them with a really
authoritative voice that was really powerful and
some people didn’t know how to take that. They
thought I was being harassing when I was just
telling them to clean the spider webs off a dis-
12. play for the third time . . . But that’s just the way
I’m used to communicating in the military, you
know?” (ID #200700)
Whether it was the unexpected events or the
inability to control one’s environment, many of the
participants either quit their jobs or were fired. Their
military experiences, especially for those with PTSD,
seemed to affect how they were able, or not, to adjust
to their work environments.
3.2. Feelings of demotion
While in the military, the participants stated
that they had received copious amounts of training
and education. Some had top level security clear-
ance in highly classified jobs, and others spoke
of being responsible for leading troops in com-
bat missions. However, once they returned to the
civilian workforce, participants stated they felt as
though they had been demoted. They felt their civil-
ian work was demeaning and they were not able
to use the skills they had acquired while in the
military.
“I mean it’s just, it wasn’t fun, it’s pretty demean-
ing and you go from being a platoon sergeant
to . . . filling a [expletive] vending machine and
you’re getting paid, you know, $10 an hour, so
yeah, it was pretty demeaning.” (ID #200848)
While many of the programs offered to Veterans
focus on translating skills acquired in the military
into a civilian context for securing employment we
found that, for some of the participants, it was the
13. context in which those skills were to be applied that
was the issue. For example, one participant, who had
been a military police officer, knew that because of
his PTSD, he was no longer capable of performing
these functions.
“I don’t have the mentality and I know I don’t.
I get easily aggravated and I’m smart enough to
know to not put myself into a situation where I
have a gun . . . ” (ID #200463)
Feeling demoted and/or that their skills were not
being utilized led some of the participants to seek out
new employment. However, this resulted in many of
them cycling through several jobs in an attempt to
find a work environment they felt utilized their skills
and knowledge. The two participants who returned
to school did so in an attempt to obtain not only bet-
ter employment but positions that were equivalent to
their military experiences. However, both wondered
if they would be able to adjust to the work environ-
ment, especially the social interactions that are often
required, in a way that would be successful.
3.3. Inability to relate
Many of the participants spoke about the difficul-
ties they had relating to civilian co-workers. Reasons
included differing work ethics, feeling a lack of
respect for their military service and skills, and a lack
of camaraderie/loyalty.
“. . . so many times I shake my head in different
places I’ve worked and thought, ‘Man, you can
tell these guys weren’t in the military.’ I guess [the
military] just raised my expectations of . . . work
14. ethics or respect to other people.” (ID #200016)
Some participants disassociated themselves from
their work and were more comfortable not develop-
ing work relationships. By keeping these two worlds
M. Harrod et al. / Veterans’ experiences of employment 263
separate, some participants felt that they were better
able to control their work environments.
“I try not to let my personal life interfere with my
professional life. I’ve learned over time, when I
go to work, I leave home at home and when I go
home, I leave work at work . . . That’s just the way
I’ve wired myself to deal with [problems].” (ID
#200219)
However, participants recognized that their inabil-
ity to cultivate work relationships put them at a
disadvantage for work-related opportunities and pro-
motions.
“I just sort of stick to myself when it comes to
co-workers . . . I think if I was a little bit more
outspoken, I probably would get a little bit further
but it’s really hard to [do that].” (ID #200848)
Inability to relate to co-workers affected partic-
ipants work relationships, sometimes in significant
ways, and many of them felt that it prevented them
from advancing in their careers.
3.4. Finding their way
15. One goal of the interviews was to try to discern
what types of employment services participants had
engaged in both during and after discharge. Half of
the participants stated they had attended the Tran-
sition Assistance Program/Transition Goals Plans
Success (TAPS) program during their discharge pro-
cess. TAPS is focused on offering services meant to
ensure that the separating service member is career
ready when they transition out of the military [2].
Although this program became mandatory in 2012,
the participants who had gone through the program
found it to be only moderately helpful. They stated
that it was too much information at once, they were
focused on going home rather than what they were
going to do for employment, and they did not know
how to apply the strategies they were taught once
discharged. For example, one focus of the TAPS
program is help with resume writing, including trans-
lating military skills into a civilian context, but one
participant stated:
“. . . that’s what the class [resume writing] was
and then they say, ‘Oh, just go on the computer
and put your resume on the computer.’ But if I
don’t know how to explain military life to civilian
life, they’re not helping me.” (ID #200145)
When asked if they had used any VA employment
support programs since discharge, 9 out of the 10
participants said they had not. A few had met with
a Veteran representative at the state unemployment
office, but did not find this resource helpful. Most
had heard of Veteran job fairs, but for the two who
had attended these, they found them to be unhelpful
in terms of actually securing a job.
16. “. . . it was a lot of people just handing out busi-
ness cards . . . There really wasn’t much to it, like
a lot of it was just information I could’ve already
received online.” (ID #200189)
Although use of employment services was almost
non-existent among participants, some of them were
able to manage their work environments in a way that
supported their transition back into the work force.
They spoke of having employers that understood their
circumstances and offered support and a willingness
to work with them in times of distress. This often
required the participant talking with their employer
about what they were going through and the difficul-
ties they were having reintegrating back into the work
environment.
“I talked to my boss . . . I said, ‘I won’t be able
to take it, I’ll explode and I’ll get up and walk
out’ . . . and we kind of [talked our] way through
it and he got me to smile . . . he’s a good guy like
that.” (ID #200016)
Not all participants were comfortable speaking to
their employers about their struggles. Instead, they
found jobs in areas that allowed them to work on their
own. For example, one participant found that working
in a job that offered him more independence and less
day-to-day direct contact with co-workers provided
him the time and space he needed to respond to stress
in a more measured and controlled way.
“I think what has helped me is my independence
from somebody being constantly on me . . . [it’s]
given me more reason to stand back and it’s that
17. time and space that allowed me to react within
reason and not immediately, you know, force back
when something upsets me.” (ID #200848)
Another participant stated that he found a change
in career was needed. He found solace in a factory
job that provided an environment that was stable and
predictable.
“Like people are puzzled like, ‘Why did you
leave the professional world for that? You went
264 M. Harrod et al. / Veterans’ experiences of employment
to school for how many years and now you’re just
a factory worker?’ But I’m like you know what?
I’ve never been happier with the job. I mean its
menial labor, but it pays well, I get along with
everybody, there’s no stress so and I’m actually up
for promotion, and I’ve only been there a month,
so it works.” (ID #200189)
Even though these participants found ways of rein-
tegrating back into the civilian workforce, almost all
had done so without help from a Veteran employ-
ment program. Although they had been able to obtain
employment, they were not able to maintain their
employment, changing jobs frequently or leaving
the job market altogether. When asked what they
thought would be most helpful in terms of employ-
ment services, participants stated knowing what was
available, what they were eligible for, and where
they could find information would be most useful.
Some also stated that support for changing careers
18. was needed given that many had changed jobs and
others were still trying to figure out where they fit in
the employment sector.
4. Discussion
Although understanding the difficulties Veterans
face when trying to obtain employment is impor-
tant, we found that understanding their struggles
with maintaining employment is crucial. Many of the
existing programs were developed with the idea that
Veterans reenter and remain in the workforce. How-
ever, all of our participants were no longer employed
in the job they had immediately following discharge.
Several of them had cycled through multiple jobs and
3 remained unemployed.
Resnick and Rosenheck [20] note that because
symptoms of PTSD are difficult to control, those with
PTSD may withdraw to environments that are known
and predictable. Participants in our study described
how PTSD symptoms or triggers manifested them-
selves within the workplace and ultimately impacted
their ability to perform at their jobs. As a result, some
remained unemployed while others chose to return to
school or change careers. We also found that some of
the participants felt they had been demoted from the
jobs they performed in the military to what they were
doing in civilian employment. Feelings of demotion
came from not applying the skills they had obtained
while in the military and how they felt they were
treated within the workplace, especially during their
interactions with co-workers.
Difficulty relating to co-workers was a common
theme among the participants. Inability to relate often
19. prevented many of the participants from developing
work relationships, sometimes resulting in negative
consequences such as placing them at a disadvan-
tage for work-related opportunities and promotions.
While a few of the Veterans we spoke with were able
to find employment within predictable environments
or adapt their work environments to make work more
manageable, they had cycled through several jobs
before reaching stable employment. They were not
aware of any programs that could have helped them
through this process.
4.1. Implications for practice
Our findings support prior research that concluded
that employment services need to address obtain-
ing employment and effective functioning within the
work environment, especially when mental health
symptoms are present [21]. Programs that currently
do not include counseling on how to identify PTSD
triggers and coping strategies to mitigate symptoms
should consider adding these to their programs. In
addition, employer education should include infor-
mation on Veteran mental health disorders including
depression, anxiety, and PTSD and how the work
environment could be optimized to lessen the burden
of these illnesses.
A great deal of attention has been paid to the need
for skill matching between military experience and
civilian job requirements. As noted above, one of the
main goals of the TAPS program [2] is to translate
military skills prior to discharge so that Veterans are
prepared to enter the civilian workforce. However,
we found that it may also be necessary to consider
the contexts in which they are applying those skills.
20. Assessment of Veteran job skills, or the tasks they
can perform, may be insufficient to determine their
ability to adjust to a different context. Determining
the type of environment a Veteran is comfortable
in may help identify jobs that are a better match,
potentially making long-term employment more
feasible.
Similar to other recommendations, employment
service programs should include counseling on how
to build and maintain relationships within the work-
place for both Veterans and their civilian co-workers.
In addition, developing a network of Veterans who
have been successful in these pursuits could pro-
vide support for newly employed Veterans looking
for guidance and mentorship [22].
M. Harrod et al. / Veterans’ experiences of employment 265
And finally, because most of the Veterans we
spoke with were not aware of any employment pro-
grams that could help them maintain employment,
employment services should be structured as on-
going support programs that are designed not only
to help Veterans find initial employment, but also to
help them adapt to their workplace and, if unsuccess-
ful, provide additional support so that a change in
career is possible.
4.2. Limitations
A limitation of this study was the low number of
Veterans who participated. Therefore, it is difficult to
discern how applicable our findings are to the Veteran
21. population as a whole and may, in fact be limited to
the Veteran participants in this study. However, we
feel that the use of an exploratory design, purposive
sampling strategy, and thematic analysis approach
mitigates this limitation in that it presents a richer
understanding of the difficulties some Veterans
face while trying to maintain employment. Another
limitation was that very few of the participants
had used a Veteran-related employment service
program since discharge. Therefore, it is necessary
to talk with Veterans who have participated in
employment-related programs in order to determine
how these programs currently provide resources
directed at maintaining employment and understand
their experiences. And finally, we did not include
interviews with staff who administer employment
programs, including career counseling. Understand-
ing their experiences working with Veterans and the
resources required to provide on-going support for
maintaining employment is critical.
5. Conclusion
Our study provides insight into how some Veterans
have experienced employment however, additional
research is needed on those who have been able
to maintain their employment and the skills they
employ to do so. Although there has been a tendency
to focus on Veteran unemployment rates, a better
understanding of the difficulties some Veterans face
when trying to maintain employment is also needed.
Current employment programs tend to prioritize job
obtainment. Our findings suggest that increasing the
awareness of existing programs and ensuring that
these services provide resources and skills that help
Veterans maintain long-term employment is critical.
22. Acknowledgments
The authors wish to extend a heartfelt thanks
to the participants in this study for sharing their
time, thoughts, and experiences. The authors alone
are responsible for the writing, content and views
expressed in this paper and do not necessarily repre-
sent the views of the Department of Veterans Affairs.
Conflict of interest
The authors report no conflicts of interest.
References
[1] U.S. Census Bureau. Profile America Facts for Features:
CB15-FF.23. [cited 2015 July 30]. Available from: (http://
www.census.gov/content/dam/Census/newsroom/facts-
for-features/2015/cb15-ff23 veterans day 2015.pdf).
[2] Collins B, Dilger RJ, Dortch C, Kapp L, Lowry S, Perl L.
Employment for Veterans: Trends and programs. Congres-
sional Research Service, Washington DC; 2014.
[3] West M, Kregel J. Employment services and supports
available to veterans with disabilities through the U.S.
Department of Veterans Affairs and other Federal agencies
(No. 8092). Mathematica Policy Research; 2014.
[4] Yosick T, Bates M, Moore M, Crowe C, Phillips J, Davison
J.
A review of post-deployment reintegration: Evidence, chal-
lenges, and strategies for program development. Defense
Center of Excellence: For Psychological Health and Trau-
matic Brain Injury; 2012.
23. [5] Sayer NA, Noorbaloochi S, Frazier P, Carlson K, Gravely
A, Murdoch M. Reintegration problems and treatment
interests among Iraq and Afghanistan combat veterans
receiving VA medical care. Psychiatric Services 2010;61(6):
589-97.
[6] Hoge CW, Terhakopian A, Castro CA, Messer SC, Engel
CC. Association of posttraumatic stress disorder with
somatic symptoms, health care visits, and absenteeism
among Iraq war veterans. The American Journal Psychiatry
2007;164(1):150-3.
[7] Pietrzak RH, Goldstein MB, Malley JC, Johnson DC, South-
wick SM. Subsyndromal posttraumatic stress disorder is
associated with health and psychosocial difficulties in vet-
erans of Operations Enduring Freedom and Iraqi Freedom.
Depression and Anxiety 2009;26(8):739-44.
[8] Burnett-Zeigler I, Valenstein M, Ilgen M, Blow AJ, Gorman
LA, Zivin K. Civilian employment among recently return-
ing Afghanistan and Iraq National Guard veterans. Military
Medicine 2011;176(6):639-46.
[9] Kleykamp M. Unemployment, earnings and enrollment
among post 9/11 veterans. Social Science Research
2013;42(3):836-51.
[10] Adler DA, Possemato K, Mavandadi S, Lerner D, Chang H,
Klaus J, Tew JD, Barrett D, Ingram E, Oslin DW. Psychi-
atric status and work performance of veterans of Operations
Enduring Freedom and Iraqi Freedom. Psychiatric Services
2011;62(1):39-46.
http://www.census.gov/content/dam/Census/newsroom/facts-for-
features/2015/cb15-ff23_veterans_day_2015.pdf
24. http://www.census.gov/content/dam/Census/newsroom/facts-for-
features/2015/cb15-ff23_veterans_day_2015.pdf
266 M. Harrod et al. / Veterans’ experiences of employment
[11] Chicas J, Maiden P, Oh H, Wilcox S, Young D. From war
to
the workplace: Helping Veterans transition to civilian work
settings. Policy Brief. Los Angeles, CA: USC Center for
Innovation and Research on Veterans and Military Families.
2012.
[12] Interian A, Kline A, Callahan L, Losonczy M. Readjust-
ment stressors and early mental health treatment seeking by
returning National Guard soldiers with PTSD. Psychiatric
Services 2012;63(9):855-61.
[13] Wilcox SL, Oh H, Redmond SA, Chicas J, Hassan AM,
Lee PJ, Ell K. A scope of the problem: Post-deployment
reintegration challenges in a National Guard unit. Work
2015;50(1):73-83.
[14] Ritchie J, Lewis J. (Eds.) Qualitative research practice: A
guide for social science students and researchers. London;
Sage; 2013.
[15] Zivin K, Yosef M, Levine DS, Abraham KM, Miller EM,
Henry J, Nelson CB, Pfeiffer PN, Sripada RK, Harrod M,
Valenstein M. Employment status, employment function-
ing, and barriers to employment among VA primary care
patients. Journal of Affective Disorders 2016;193:194-202.
[16] Dey I. Qualitative data analysis: A user friendly guide for
social scientists., New York, NY: Routledge; 2003.
25. [17] Braun V, Clarke V. Using thematic analysis in psychology.
Qualitative Research in Psychology 2006;3(2):77-101.
[18] Saldaña J. The coding manual for qualitative researchers.
London: SAGE; 2013.
[19] PTSD: National Center for PTSD. [cited 2015 July
10]. Available from: (http://www.ptsd.va.gov/public/PTSD-
overview/basics/symptoms of ptsd.asp).
[20] Resnick SG, Rosenheck RA. Posttraumatic stress disor-
der and employment in veterans participating in Veterans
Health Administration Compensated Work Therapy. Jour-
nal of Rehabilitation Research & Development 2008;45(3):
427-35.
[21] Erbes CR, Kaler ME, Schult T, Polusny MA, Arbisi
PA. Mental health diagnosis and occupational function-
ing in National Guard/Reserve veterans returning from
Iraq. Journal of Rehabilitation Research & Development
2011;48(10):1159-70.
[22] Little R, Alenkin N. Overcoming barriers to employment
for
veterans: Current trends and practical approaches. Policy
Brief. Los Angeles, CA: USC Center for Innovation and
Research on Veterans and Military Families. 2011.
http://www.ptsd.va.gov/public/PTSD-
overview/basics/symptoms_of_ptsd.asp
M. Harrod et al. / Veterans’ experiences of employment 267
Appendix A. Veteran Employment Interview
Guide
26. Interviewee Background
• Please start by telling me a little about yourself?
◦ Tell us about your living situation, (e.g,
partner, children)
� Has this changed since you have been
home?
• Can you tell me a little about your military expe-
riences?
◦ In which branch of the military did you
serve?
◦ Why did you join the military?
◦ What were your duties?
� Did these duties change over the course
of your enlistment?
◦ What types of skills, training or education
did you receive in the military?
◦ Deployments?
◦ How long have you been home?
◦ From what base were you discharged?
◦ Can you describe for me the discharge pro-
cess?
� What were you most concerned about?
� Prior to discharge, did you receive any
job-related information?
27. Employment Experiences
• Since discharge (or last ten years if discharge
was longer), can you tell us about your job his-
tory?
◦ How many jobs have you had?
◦ Where did you work?
◦ How did you hear/find out about the job?
◦ Did you have to interview for it?
� If yes, what was that like?
◦ What were your duties?
◦ How long did you work there?
◦ Reason for leaving?
◦ What did you like/dislike about the job?
• Tell us about your most recent job.
◦ Where do you work?
◦ How did you hear/find out about the job?
◦ Did you have to interview for it?
� If yes, what was that like?
◦ What are your duties?
◦ How long have you worked here?
◦ What do you like/dislike about your job?
◦ Is it something you want to continue doing?
• What have the challenges been for you at work?
• What has been helpful to you in feeling comfort-
able at work?
• What has been helpful to you in succeeding at
work?
• What types of support, if any, do you have at
28. work?
Reintegration and Mental Health Issues
• Can you tell us how your return to civilian life
has gone?
• Have you experienced emotional issues or prob-
lems since your return?
◦ If so, what types of issues or problems have
come up? Do you know why?
◦ Are these new issues or problems you have
experienced for some time?
◦ How have these emotional issues or prob-
lems affected your functioning at work and
other parts of your life?
Treatment Seeking and Experience
• Do you know what options are available for
addressing employment problems and issues?
• Do you know where help might be offered?
• Have you talked to a professional for an employ-
ment related issue?
◦ Have you ever used an employment
agency?
◦ If yes:
� Where did you go? What were the rea-
29. sons you chose this agency?
� What was your experience in getting
employment services?
• What help did they provide?
• What advice did you receive?
� What did you like?
� What do you think could be better?
� What might make it difficult for you to
continue using employment services?
� How do your family and friends feel
about you going to employment services?
◦ If no, but interviewee expresses need:
� What prevents you from using these
types of services?
� Do you know if the VA or another Veteran
organization offers any type of employ-
ment service?
� What have you heard about these differ-
ent services?
◦ If no and not interested:
268 M. Harrod et al. / Veterans’ experiences of employment
� How do you get employment related
information now?
30. � Why would you not be interested in using
the VA or another Veteran organization
for employment support?
◦ Have you had a Veteran friend who has used
employment services? Tell me about that.
◦ Where did he/she go? How has that affected
you?
Assessment of comfort with possible future
intervention
• What concerns/issues would you most like to get
help with?
• Tell me your feelings about attending classes to
improve your comfort and skill in interacting
with people.
• What would be the most useful focus of employ-
ment services for you?
• What would increase the likelihood of partici-
pating in services?
• What barriers do you see to using employment
services?
• What interpersonal situations have been difficult
for you when seeking work or on the job?
• When you imagine going to a job interview, what
thoughts run through your mind?
• When you get nervous during a job interview,
31. what do you worry about?
• When you have to talk to the boss, what might
you think about?
Future Plans and Goals
• What are your plans regarding employment at
this point?
◦ Future schooling or training?
• What would be your dream job?
◦ Do you see yourself ever having that type
of job?
◦ What would it take for you to get that job?
• What do you think the VA needs to do help
Veterans with employment?
Copyright of Work is the property of IOS Press and its content
may not be copied or emailed
to multiple sites or posted to a listserv without the copyright
holder's express written
permission. However, users may print, download, or email
articles for individual use.
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 392
32. www.internationaljournalofcaringsciences.org
Original Article
Effect of Nursing Intervention on Knowledge and Practice of
Salt and Diet
Modification among Hypertensive Patients in a General
Hospital
South-West Nigeria
Ajiboye, Rachael Oluwafunmilayo
Senior Nurse Tutor, School of Nursing, Lagos State College of
Nursing, Midwifery and Public Health,
Igando, Lagos, Nigeria
Okafor, Ngozi Antonia
Senior Lecturer, Department of Nursing, Babcock University,
Ilishan-Remo, Ogun State, Nigeria
Olajide, Tayo Emmanuel
Lecturer II, Department of Nursing, Babcock University,
Ilishan-Remo, Ogun State, Nigeria
Emmanuel Olayemi Tosin
Principal Nurse Tutor, School of Nursing, Lagos State College
of Nursing, Midwifery and Public Health,
Igando, Lagos, Nigeria. [email protected]
Correspondence: Ajiboye, Rachael Oluwafunmilayo School of
Nursing, Lagos State College of Nursing,
Midwifery and Public Health, Igando, Lagos, Nigeria. E-
mail:[email protected]
33. Abstract
Background: Hypertension is the most common non-
communicable disease and the leading cause of
cardiovascular disease in the world. Current management of
hypertension stressed the importance of salt and
diet modifications. Unfortunately, many hypertensive patients
do not have proper knowledge of this, which
results to inadequate practice. Therefore, there is need to
develop strategies that will help to improve knowledge
and practice of salt and diet modifications among hypertensive.
Objective: To determine the effect of nursing intervention on
knowledge and practice of salt and diet
modifications among hypertensive patients.
Materials and Methods: A quasi experimental design was
conducted using purposive sampling to select the
sample size of 38 participants. A researcher-developed
questionnaire derived from the literature review and
Hypertension Self-Care Activity Level Effects (H-SCALE)
adapted from Warren-Find low and Seymour (2011)
was used to measure knowledge and practice of salt and diet
modification among the participants. Data gathered
from participants were expressed using tables and percentages
while research questions were answered with
descriptive statistics of mean and standard deviation through
statistical package for the social science software
version 21.
Results: the study revealed that higher percentage of the
participants (81.6%) had poor of knowledge of salt and
diet modification pre-intervention, also 92.1% of the
participants reported poor practice before intervention.
Intervention was given to the participants and results showed a
positive change in knowledge and practice of salt
and diet practice post-intervention.
Conclusion: regular training should be given to hypertensive
patients by nurses to improve their knowledge and
34. practice of salt and diet modification for effective blood
pressure control.
Keywords: Hypertension, Knowledge, Practice, Salt and Diet
modification, Nigeria
Introduction
The burden of hypertension and other non-
communicable diseases is rapidly increasing and
this poses a serious threat to the economic
development of many nations. Hypertension is a
global public health challenge due to its high
prevalence and the associated risk of stroke and
cardiovascular diseases in adults.
Globally, hypertension is implicated to be
responsible for 7.1 million deaths and about
12.8% of the total annual deaths (World Health
Organization (WHO), 2018). Africa, among
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 393
www.internationaljournalofcaringsciences.org
other WHO regions was rated highest with
increased prevalence of high blood pressure,
estimated at 46% from age 25 years and above in
35. which Nigeria contributes significantly to this
increase (Okwuonu, Emmanuel, & Ojimadu
2014; Ekwunife, Udeogaranya, & Nwatu, 2018;
WHO, 2018). This is so in spite of the
availability to safe and potent drugs for
hypertension and existence of clear treatment
guidelines, hypertension is still grossly not
controlled in a large proportion of patients
worldwide.
Current national recommendations for the
prevention and treatment of high blood pressure
emphasized non-pharmacological therapy, also
termed "lifestyle modification" which includes
salt and diet modification. However, there is a
dearth of information on the knowledge and
practice of salt and diet modification among
hypertensive patients attending Nigeria’s health
institutions (Abubakar et. al, 2017). Hence, poor
knowledge of salt and diet modifications, and
inability to practice these were one of the
identified patient- related barriers to hypertension
control (Tesema et.al, 2016). This gap may also
be attributed to the type of information or
training programmes given to patients on salt and
diet modification.
Therefore, this study might help to improve the
knowledge of hypertensive patients on salt and
diet modification which in turn may affect its
practice thus reducing the death burden,
complications and economic cost of poorly
controlled hypertension among patients and in
the society.
Objective
36. The aim of the study was to determine the effect
of nursing intervention on knowledge and
practice of lifestyle modification among
hypertensive patients. The following research
questions were expected to be answered:
1. What is the pre-intervention knowledge
and practice of salt and diet modification among
hypertensive patients?
2. What is the post-intervention knowledge
and practice of salt and diet modification among
hypertensive patients?
Methods
It is a quasi-experimental study, which adopted
one pre-test-post-test design, conducted between
February and September 2019, at a secondary
health facility (General Hospital), South-west,
Nigeria. The study was carried out among
hypertensive patients attending medical out-
patients department (MOPD) in the general
hospital. The hospital was purposively selected
being the only secondary health facility located
in one of the densely populated communities in a
major commercial city of South-west, Nigeria.
Sample size and sampling procedure: Sample
size was calculated using Taro Yamane method
of sample size determination, n = calculated
sample size, Population size (N) = 42 based on
daily clinic attendance of hypertensive patients,
and margin of error = 0.05 with a confidence
level of 95% given a sample size of 38
37. participants. Inclusion criteria were male and
female patients who were ≥18 years of age,
diagnosed to be hypertensive and attending
medical out-patients department (MOPD),
available and willing to participate in the study,
who could communicate either in English or
Pidgin English. Exclusion criteria were other
patients at MOPD who were not diagnosed to be
hypertensive, or with any co-morbidity that could
interfere with participation in the training, and
have attended previous educational programme
on salt and diet modification. Participants were
selected based on the inclusion criteria using
purposive sampling.
Data collection tools and procedures: Data
were gathered using researcher-developed
questionnaire derived from the literature review
with the opinions of experts in the field to assess
participants’ knowledge of salt and diet practice
and modified Hypertension Self-Care Activity
Level Effects (H-SCALE) developed by Warren-
Findlow and Seymour (2011) to assess practice
of salt and diet modification among the
participants.The questionnaire consists of three
parts. The first part includes the demographic
characteristics of the participants with eight (8)
items; the second part assessed the participants’
knowledge of salt and diet modification. The
knowledge of salt and diet modification
questions includes twelve (12) items with
maximum and minimum scores of 12 and 0
respectively. Participants’ knowledge scores of
9-12 points indicate high knowledge, 6-8 points
indicate moderate knowledge and scores <6
points indicate poor knowledge. The third part
38. assessed the practice of salt and diet modification
among the participants with seven items which
were used to assess practices related to eating a
healthy diet, avoiding salt while cooking and
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 394
www.internationaljournalofcaringsciences.org
eating, and avoiding foods high in salt content.
Responses were coded ranged from never (1) to
always (3). Responses were summed up creating
a range of scores from three (3) to twenty one
(21). Scores of eleven (11) and above indicates
that participants followed the low-salt diet and
was considered as having good low salt diet
practice while score <11 indicate poor salt diet
practice. The psychometric properties of the
instrument was checked by experts in the field
using face and content validity criteria, the
reliability of the instrument was determined
using split-half method and the Cronbach’s alpha
reliability coefficient on knowledge of salt and
diet modification was 0.78, while salt and diet
practice was 0.72 which showed high reliability
of the instrument. The method of data collection
involved three phases:
Phase 1: this involved meeting with the
consultant and nurses in charge of MOPD of the
General Hospital to explain the purpose of the
39. study and its benefits, and to seek their co-
operation for the success of the study. This took
place during the first week of the study. In the
second week of the study, the researcher with
two research assistants visited the MOPD to
listen to health talk given to the patients by the
nurses and other health personnel, gaps were
identified which was used to modify the training
modules. The participants were met to discuss
the purpose, course and potential benefits of the
study. Interested participants were enrolled for
the study after obtaining their consent. Further
selection of the participants continued in the third
and fourth week. A pre-test instrument
(questionnaire) was given to the selected
participants to complete during the selection. No
external interference was allowed during data
collection, researcher and research assistants
stayed with the participants throughout the
period of completing the questionnaire after
which they were thoroughly checked for
completeness before retrieval from the
participants.The results from this phase were also
used to modify the training module for better
intervention. Reminder for the training
programme was given through phone calls, text
messages and visits on the clinic- days prior to
the training.
Phase 2: A developed intervention package was
implemented based on feedback obtained from
pre-intervention knowledge and practice score
with learning modules which was used for the
educational training of hypertensive patients on
salt and diet modification. The intervention
40. package had two modules of learning which was
delivered for two hours weekly for two weeks.
Different instructional methods were utilized to
deliver the programme including lectures, group
discussion, questions and answers, chats/pictures
and educational hand out. Follow-up through
phone calls and text messages was done every
week after intervention to ensure adequate
practice before the post-intervention test.
Phase 3: A post-test was given one month post-
intervention with the same instruments used
during the pre-test. Data collected were coded
and processed using statistical package for social
science (SPSS), version 21. Frequency table was
constructed and data were expressed on it. The
research questions were answered using
descriptive statistics of mean and standard
deviation.
Ethical Consideration: The ethics committee of
the researcher’s institution approved the study
with approval reference BUHREC102/19 dated
27th February, 2019 and written permission of the
State Health Service Commission was also
obtained to conduct the study. Participants were
informed about the purpose of the study and their
consents both verbal and written were taken
before the study commences. Participation was
voluntary and participants have the right to
withdraw at any stage of the study.
Results
The socio-demographic data reveals that greater
number of the participants was females (68.4%)
41. possibly, because females tend to pay more
attention to their health and engaged more in
physical and emotion stress than their male
counterparts. Majority, (44.7%) participants were
between the ages of 46 to 60 years, also many of
the participants (28.9%) have primary education
and 42.1% were self-employed. This could also
be related to the fact that the study was carried
out in one of the largest commercial city in
South-west Nigeria and research facility was
located in one of the densely populated
communities in the state which often require
constant subsidized health care services (Table 2)
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 395
www.internationaljournalofcaringsciences.org
Table 1: Intervention programme module about salt and diet
modification
Goals Learning content
At the end of the module, the
participants will:
Have a background knowledge of
hypertension
Know and identify the risk factors of
42. hypertension
Understand the contribution of salt and
diet modification to blood pressure
control.
Describe salt intake reduction and the
recommended quantity of salt intake
for blood pressure control.
Week One
Background knowledge of hypertension
Hypertension is the leading cause of heart and blood vessels
diseases
worldwide.
About 7.1 million deaths worldwide (~12.8% of total deaths)
are
estimated to be caused to hypertension.
Africa has the highest numbers of people with hypertension.
In Nigeria, hypertension is graded as number one of all terrible
diseases
among the people.
It affects both men and women, rich and poor people in rural
and urban
communities.
Hypertension is also called high blood pressure. Blood pressure
is the
measurement of force against the walls of your arteries when
your heart
pumps blood through your body. It has two numbers; the top
43. number is
called systolic blood pressure while the bottom number is
diastolic
pressure.
Your blood pressure is normal when these numbers are lower
than
120/80mmHg most of the time. Whenever these numbers are
120/80mmHg or higher most of the time but below
140/90mmHg is
called pre-hypertension. Any time the number is 140/90mmHg
or higher
most of the time is hypertension.
The risk factors of hypertension
These are situations that can make one to have hypertension.
Those situations that you can control
Unhealthy (bad) diet
Too much of salt intake
Overweight or obese
Sedentary lifestyle (lack of physical activity)
Tobacco usage
Excessive alcohol usage
Stress
Lack of sleep
Those situations that you can control
Age
Race
Family History
44. The contribution of salt and diet modification to blood pr essure
control.
Salt restriction: when you take not more than 2.4 g of sodium
per day it
reduces your blood pressure by 2-8 mmHg.
Adopt DASH eating plan: when you eat a diet rich in fruits,
vegetables,
and low fat dairy products with a reduced content of saturated
(solid
fats) and total fat it reduces your blood pressure by 8–14
mmHg.
Salt intake reduction and recommended quantity of salt intake
for blood
pressure control.
Ways to reduce your salt intake:
Salt intake should be reduced to less than 2,400 milligrams
(mg) a day (1
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 396
www.internationaljournalofcaringsciences.org
teaspoon).
Aim for less than 1,500 mg a day (not more than ½ teaspoon),
if
45. possible.
Do not add extra salt at the table.
Remove or reduce the amount of salt used in cooking and
baking.
Reducing salt to less than 2,400mg (1 teaspoon) can reduce
your blood
pressure to 2-8 mm Hg.
At the end of the module, the
participants will:
Adopting Dietary Approaches to Stop
Hypertension eating plan (DASH diet)
that lowered blood pressure
Components of Dash eating plan
Examples of daily and weekly servings
that meet DASH eating plan targets for
a 2,000 to 2,100-calorie-a-day diet.
Examples of food items that make up
the DASH eating plan.
Week Two
Adopting Dietary Approaches to Stop Hypertension eating plan
(DASH
46. diet) that lowered blood pressure
Food is an essential measure in prevention and treatment of
hypertension.
DASH diet is a simple and complete eating plan that helps
produce a
heart-healthy eating style for life.
It requires no special foods but provides daily and weekly
nutritional
goals.
Studies have shown that the DASH diet can lower blood
pressure within
2 weeks.
Adopting DASH eating plan can produce blood pressure
lowering
effects of 8-14mmHg, comparable to drug monotherapy.
Components of Dash eating plan
The plan recommends
eating vegetables, fruits, and whole grains
fat-free or low-fat dairy products
limiting foods that are high in saturated fat,
Avoiding /limiting sugar-sweetened beverages and sweets
Examples of daily and weekly servings that meet DASH eating
plan
targets for a 2,000 to 2,100-calorie-a-day diet
Food Group Daily Servings
Grains 6–8
Meats, poultry, and fish 6 or less
Vegetables 4–5
Fruit 4–5
Low-fat or fat-free dairy products 2–3
Fats and oils 2–3
Sodium (salt) 2,300 mg*
47. Weekly Servings
Nuts, seeds, dry beans, and peas 4–5
Sweets 5 or less.
Examples of food items that make up the DASH eating plan.
1. Rich in potassium, calcium, magnesium (fruits and
vegetables).
Examples: Avocado, Bananas, Carrots, Beans, orange, Pears
(fresh),
Peanuts, Spinach, Tomatoes, Skimmed Milk, Pawpaw, Oysters,
Soy
milk, Tofu.
2. Low in saturated and trans- fat or low-fat dairy products :
Examples: fish, yogurt, mayonnaise, unsalted nuts and seeds
such as
almonds, peanuts, walnuts, vegetable oils: canola, olive, peanut,
sunflower, corn, soybean, cottonseed.
3. Good source of fibre and protein
Examples: Whole grains, Whole wheat bread, Brown rice, oats,
barley,
wheat , White beans, kidney beans, northern beans.
4. Avoid food high in saturated diet
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 397
www.internationaljournalofcaringsciences.org
Example:
Meat: fatty/red meats, processed meats like hot dogs, organ
meat
Full-fat dairy products: whole milk, whole-milk products and
48. 2% milk
Tropical oils: coconut oil, palm oil or palm kernel oil.
Fats: Margarines, cocoa butter, vegetables cooked in excessive
amounts
of sauce and butter, fried foods.
Snacks and Sugar: chocolate, ice cream, cakes, candy (sweet),
butter
rolls, egg breads, and commercial doughnuts.
Table 2: Socio-demographic data of the participants n=38
Variable Experimental (n=38)
Age (years) Freq. (%)
18-30 years 2 (5.3)
31-45 years 3 (7.9)
46-60 years 17 (44.7)
>60 years 16 (42.1)
Total 38 (100.0)
Gender
Male 12 (31.6)
Female 26 (68.4)
Total 38 (100.0)
49. Educational Level
No formal education 11 (28.9)
Primary education 11 (28.9)
Secondary education 5 (13.2)
Tertiary education 11 (28.9)
Total 38 (100.0)
Occupation
Employed 8 (21.1)
Retired 10 (26.3)
Self employed 16 (42.1)
House keeper 4 (10.5)
Total 38 (100.0)
Duration of Hypertension
1-5 years 16 (42.1)
6-10 years 21 (55.3)
>10 years 1 (2.6)
Total 38 (100.0)
50. International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 398
www.internationaljournalofcaringsciences.org
Table 3: Summary of responses on knowledge and practice of
salt and diet modification
pre-intervention
Knowledge Level n=38
Poor knowledge
(0-5 points)
Moderate knowledge
(6-8 points)
Good knowledge
(9-12 points)
Total
Pre-
intervention
31 (81.6%) 7 (18.4%) 0 (0.00%) 38 (100%)
Practice Level n=38
Poor practice (0-10
51. points)
Good practice (11-21
points)
Total
Pre-
intervention
35 (92.1) 3 (7.9) 38 (100%)
Table 4: Comparing pre - and post-intervention knowledge and
practice of salt and diet
modification.
Knowledge and Practice Level n=38
Knowledge of salt
and diet
modification n=38
Poor knowledge
(0-5 points)
Moderate
knowledge (6-8
points)
Good
knowledge (9-12
points)
52. Total
Pre-intervention 31 (81.6%) 7 (18.4%) 0 (0.00%) 38 (100%)
Post-intervention 1 (2.6%) 0 (0.0%) 37 (97.4%) 38 (100.0%)
Practice of Salt and
Diet Modification
Poor practice (0-10
points)
Good practice (11-
21 points)
Total
Pre-intervention 35 (92.1) 3 (7.9) 38 (100%)
Post-intervention 4 (10.5) 34 (89.5) 38 (100%)
Table 3 summarily shows participants responses
on knowledge and practice of salt and diet
modification pre-intervention. 81.6% of the
participants had poor knowledge of salt and diet
modification, 18.4% had moderate knowledge
level and none of the participants had high
knowledge level (0.00%) of salt and diet
modification. Participants also demonstrated
poor practice of salt and diet modification as
92.1% of the participants reported poor practice,
while only 7.9% of the participants reported
good practice of salt and diet modification before
53. intervention. However, Table 4 reveals a positive
change in the participants’ level of knowledge
and practice of salt and diet modification after
intervention. Only 2.6% of the participants
demonstrated poor level of knowledge of salt and
diet modification post intervention as against
81.6% before intervention. While 97.4%
demonstrated high knowledge level post-
intervention training as opposed to none (0.00%)
before intervention. When comparing pre and
post intervention practice of salt and diet
modification, the practice of diet and salt
restriction was good (≥11) from 7.9% pre-
intervention to 89.5% post intervention. While
poor practice level (≤10) was reduced to 10.5%
from 92.1% after intervention.
Discussion
The study revealed that the pre-intervention
knowledge of participants about salt and diet
modification was poor (81.6%). This finding
corroborates the findings of a study done in India
in 2011 and South Ethiopia (2017) that majority
of the respondents have poor knowledge of salt
and diet modification (Subramanian et. al 2011;
Buda et.al, 2017). The finding is also in
agreement with Okwuonu, Emmanuel, and
Ojimadu (2014) that most hypertensive patients
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 399
54. www.internationaljournalofcaringsciences.org
are not fully aware of the impact of unsaturated
oil, reduction in diary food, whole grains,
consumption of fruits and vegetables in the
control of blood pressure and salt reduction The
study also showed poor practice of salt and diet
modification (92.1%) among the participants
before intervention. This finding was a bit higher
compare with a similar study done in China that
about 70% of the participants had poor adherence
to modification practices (Lu, et. al, 2017). This
may be attributed to poor knowledge of salt and
diet modification which in turn affects its
practice among the participants. This agreed
with Babu, (2015) who said that the desired
changing level in patients’ attitude toward
knowledge and practice of salt and diet
modification was not achieved due to insufficient
information in relation to effect of salt and diet
modification on blood pressure control given by
the health care professionals. Hence, an intense
effort should be made by health care givers for
effective improvement.
According to the findings of the study, poor
knowledge and practice of salt and diet
modification as demonstrated by the participants
may affect effective blood pressure control
which may be attributed to poor health seeking
behavior on the part of patients or inadequate
information provided by the health personnel.
This is particularly supported by a group of
researchers who posited that targeted health
55. education strategies are obviously necessary to
enhance the knowledge level of hypertensive as
this will help to prevent adverse effect of poor
blood pressure control, and that health care
givers are needed to provide appropriate cost-
effective programmes on management of
hypertension with a lot of reinforcement and
motivation for effective practices (Gnanaselvam
et. al, 2016). In addition, patients need to be
taught the basic underlying principles behind
every part of their care for them to be motivated
and adopt any change of behavior. Therefore,
patient education should be strengthened on the
use of salt and different type of diets that are
suitable for prevention and effective control of
blood pressure (Okwuonu, Emmanuel, and
Ojimadu, 2014); Tesema et.al, 2016).
The study findings revealed a notable
improvement on knowledge and practice of salt
and diet modification after the intervention
training programme as shown by post-
intervention test score. This shows that
intervention programme was very effective as the
participants gained more insight salt and diet
modification in relation to blood pressure
control. This agreed with Babu (2015) that when
a structured instructional module is used to
divulge facts on salt and diet modification among
hypertensive patients this will in turn affect their
practice and thus lowered blood pressure.
The findings validate the report of a randomized
controlled clinical trial which states that increase
in knowledge about the role of lifestyle in the
56. occurrence of high blood pressure would cause
people to start modifying their lifestyles and
enhance their preventive behaviours (Jafari et.al,
2016). This was proven with the result of a meta-
analysis of 37 randomized controlled trials by
Aburto et. al, (2013) who demonstrates the
strong and consistent relationship that has been
observed between dietary sodium and blood
pressure that reduced sodium intake reduces
blood pressure in both non-acutely ill adults and
children. The largest controlled feeding study of
potassium supplementation effects on blood
pressure was conducted among Chinese adults by
Gu et. al (2013) the study demonstrated a
significant reduction in blood pressures that was
reproducible after an average of 4.5 years. Even
more encouraging are the results of magnesium
supplements decreasing systolic and diastolic
blood pressure 3 to 4 mmHg and 2 to 3 mmHg,
respectively, with greater dose-dependent effects
at supplementations >370 mg/day (Kupetsky-
Rincon & Uitto, 2012). In subgroup analyses
involving five trials conducted among
hypertensive, fiber intake significantly reduced
both systolic and diastolic blood pressure by 5.95
and 4.20 mmHg, respectively (Bazzano et.al,
2015). Buda et al. (2017) added that irrespective
of other treatments options, if all hypertensive
patients are given needed information and
support required in controlling blood pressure it
will assist in achieving and maintaining salt and
diet practices. Hence, educational programs are
essential in increasing knowledge, improving
self-management, and controlling dietary habits
that are detrimental to effective blood pressure
control (Beigi et. al, 2014)
57. Conclusion and Recommendation: The study
helped to validate that a nurse-led intervention
programme has significant effect in improving
knowledge and practice salt and diet
modification among hypertensive patients.
Therefore, it is recommended that nurses should
ensure adequate provision of such programme in
a continuous and intermittent way with accurate
International Journal of Caring Sciences
January-April 2021 Volume 14 | Issue 1| Page 400
www.internationaljournalofcaringsciences.org
information while providing care for these
patients.
Limitation of the Study: There are other
variables that are effective in control of blood
pressure which were not included in the study
such as measurement of patients’ clinical
parameters like cholesterol level and
triglycerides due to financial constraints. Another
important limitation was follow-up time, hence,
future studies should be conducted given enough
time for follow-up.
Acknowledgements: The researchers show their
appreciation management of the health facility
used as well the State Health Service
Commission for permission to use their facility
for the study. Appreciation also goes to all
participants that took part in the study.
58. References
Abubakar, S., Muhammad, L. U., Ahmed, A., &Idris,
F. (2017). Knowledge, attitude, and adherence to
non-pharmacological therapy among patients with
hypertension and diabetes attending the
hypertension and diabetes clinics at tertiary
hospitals in Kano, Nigeria. Sahel Medical
Journal20(3), 102-108. Retrieved from
www.smjonline.org DOI: 10.4103/1118-
8561.223170
Aburto, A., Nancy, J., Ziolkovska, A., Hooper, L.,
Paul, E., Cappuccio, F. P., Meerpohl, J. J. (2013).
Effect of lower sodium intake on health:
Systematic review and meta-analyses.
BMJ , 346 doi: https://doi.org/10.1136/bmj.f1326.
Babu, A.(Eds.). ( 2015). Effectiveness of structured
teaching program on knowledge of hypertensive
patients regarding dash diet at selected community
area, Bangalore. Karnataka, India: Rajiv Gandhi
University of Health Science.
Bazzano, L. A., Green T., Harrison T. N., &
Reynolds K. (2015). Dietary approaches to
prevent hypertension. Curr Hypertens Rep,15(6),
694–702.
Beigi, M. A., Zibaeenezhad, M. J., Aghasadeghi, K.,
Jokar, A., Shekarforoush, S., & Khazraei,H.
(2014). The effect of educational programs on
hypertension management. International
Cardiovasc Res J,8(3), 94–98.
59. Buda, E. S., Hanfore, L. K., Fite, R. O., & Buda, A.S.
(2017). Lifestyle modification practice And
associated factors among diagnosed hypertensive
patients in selected hospitals, South Ethiopia.
Clinical Hypertension, 23(26).
Ekwunife, O. I., Udeogaranya, P. O., &Nwatu, I. L.
(2018). Prevalence, awareness, treatment and
control of hypertension in a Nigerian population.
Scientific Research Publishing Inc. 2(7), 731-735.
Gnanaselvam, K., Ilankoon, P., Arulanandem, K., &
Joseph, J. (2016). Assessment of knowledgeon
hypertension, its consequences and management
practices among hypertensive patients: A
descriptive study. Journal of the Postgraduate
Institute of Medicine,3(30), 1-11
Gu, D., Zhao, Q., Chen, J., Chen, J. C., Huang, J.,
Bazzano, L. A. ,… He, J. (2013). Reproducibility
of blood pressure responses to dietary sodium and
potassium interventions: The general salt study.
Hypertension, 62(3), 499-505.
Jafari, F., Shahriari M., Sabouhi F., Farsani A. K.,
&Babadi M. E. (2016). Effects of a lifestyle
modification program on knowledge, attitude and
practice of hypertensive patients with angioplasty:
A randomized controlled clinical trial. Int J
Community Based Nurs and Midwifery, 4(4),
286–296.
Kupetsky-Rincon, E. A.,&Uitto J. (2012).
Magnesium: Novel applications in cardiovascular
disease—A review of the literature. Ann
60. NutrMetab, 61(2), 102–10.
Lu, J., Lu, Y., Wang, X., Li, X., Linderman, G. C.,
Wu, C., Jiang, L. (2017). Prevalence, awareness,
treatment, and control of hypertension in China:
Data from 1.7 million adults in a population-based
screening study (China peace million persons
project). Lancet, 390, 2549.
Okwuonu, C.G, Emmanuel, C.I, &Ojimadu, N.E.
(2014).Perception and practice of lifestyle
modification in the management of hypertension
among hypertensive in South-east Nigeria.
International Journal of Medicine and Biomedical
Research, 3(2), 121-131
Subramanian, H., Soudarssanane, M. B.,
Jayalakshmy, R., Thiruselvakumar, D.,
Navasakthi, D., Sahai, A., &Saptharishi, L. G.
(2011). Non-pharmacological interventions in
hypertension: A community-based cross-over
randomized controlled trial. Indian Journal of
Community Med., 36(3), 191–196.
Tesema, S., Disasa, B., Kebamo, S., &Kadi, E.
(2016). Knowledge, attitude and practice
regarding lifestyle modification of hypertensive
patients at Jimma university specialized hospital,
Ethiopia. Primary Health Care Open Access
Journal, 6(218), 1-4.
Warren-Findlow, J.& Seymour, R. B. (2011).
Prevalence rates of hypertension self-care
activities among African Americans. Joint
National Medical Association, 103(6), 503–512.
61. World Health Organization (2018) Global health
observatory data: Raised blood pressure Situation
and trends. Retrieved
fromhttp://www.who.int/chp/ncd_global_status_re
port/en
Copyright of International Journal of Caring Sciences is the
property of International Journal
of Caring Sciences and its content may not be copied or emailed
to multiple sites or posted to
a listserv without the copyright holder's express written
permission. However, users may
print, download, or email articles for individual use.