1. A reference citation provides authoritative sources for statements in a paper and acknowledges that information did not originate with the writer. It follows APA style, which uses author-date citations in text and a reference list of only cited sources.
2. APA style does not require footnotes; citations in text and a reference list provide enough information for readers to locate sources. The reference list is ordered alphabetically and includes pertinent details for different source types such as books, journal articles, websites, and more.
3. Electronic sources require a title, date, URL or DOI, and author if available when cited in APA style. Journal articles include a DOI if available rather than a URL or database name
The document discusses the APA style of referencing sources in research papers. It explains that APA style uses author-date citations in the text and a reference list at the end. It provides examples of how to cite sources with one, two, or more authors in both the text and reference list. It also covers citing sources from books, journals, websites and other media. The reference list is arranged alphabetically and examples are given for formatting different source types like books, articles, and online sources.
The document provides guidelines for citing sources and creating reference lists according to the 6th edition of the APA Style Manual. It discusses citing sources in-text using parenthetical citations as well as creating an alphabetical list of references at the end. Specific guidelines are provided for different types of sources, including books, articles, websites, and more. Formatting such as double spacing, indentation, capitalization, and inclusion of publication details are also outlined.
The document provides guidelines for citing sources in APA style, including in-text citations and reference list entries. It discusses citing sources with different numbers of authors in the text and reference list. It also covers citing sources from books, scholarly journals, magazines, newspapers, government publications, and electronic resources. Specific examples are provided for various source types.
The document provides guidelines for citing sources and formatting reference lists according to the 6th edition of the Publication Manual of the American Psychological Association (APA). It discusses citing sources in-text using parenthetical citations as well as formatting the alphabetical list of references at the end. Specific guidelines are provided for various source types including books, journal articles, websites, and more. Proper formatting of author names, publication dates, titles, and retrieval information is covered.
This document provides an introduction to APA referencing style. It explains what referencing is, why it is important to reference, and the basic steps involved, including providing in-text citations and compiling a reference list. Referencing acknowledges the sources of information, facts, figures, ideas and theories used in an assignment. It helps avoid plagiarism and allows readers to follow up on cited sources. The document outlines the key information to include for different source types like books, journal articles, websites and more.
This document provides an overview of APA style in-text citations and reference list entries for various source types, including:
- Books by single and multiple authors
- Journal articles by single and multiple authors
- Websites and web pages
- Theses and unpublished works
- Magazine articles
It explains the general formats for different source types and provides examples of how to format in-text citations and reference list entries according to APA style guidelines.
PPA 2008 – American Government and Public Administration.docxharrisonhoward80223
PPA 2008 – American Government
and Public Administration
APA Formatting and Style Guide
General format;
Reference page;
In-text citations.
(Adapted from Dr. Daniels’s Lectures)
1
What is APA?
APA (American Psychological
Association) is the most
commonly used format for
manuscripts in the Social
Sciences.
2
What does APA regulate?
APA regulates:
Stylistics
In-text citations
References (a list of all
sources used in the paper)
3
APA stylistics: Basics
Use the third person point of view rather than using
the first person point of view;
The study showed that…, NOT
I found out that….
Use the active voice rather than passive voice.
The participants responded…, NOT
The participants have been asked….
4
Language in an APA paper is:
• clear: be specific in descriptions and explanations;
• concise: condense information when you can;
• plain: use simple, descriptive adjectives and
minimize the figurative language.
APA stylistics: Language
5
APA: General Format
Your essay should:
be typed, double-spaced, with two spaces after
punctuation between sentences;
with 1” margins on all sides;
in 12 pt. Times New Roman;
include a page header (title) in the upper left-hand
of every page and a page number in the upper
right-hand side of every page.
6
References
Main Body
Abstract
General Format (cont’d)
Title page
Your essay should
include four major
sections:
7
Title Page
Page header (use Insert Page
Header):
title flush left;
page number flush right.
Title (in the upper half of the
page, centered);
name (no title or degree);
affiliation (university, etc.).
8
Abstract Page
Page header: do NOT include
“Running head:”
Abstract (centered, at the top of
the page)
Write a brief (between 150 and 250
words) summary of your paper in an
accurate, concise, and specific
manner. Should contain: at research
topic, research questions,
participants, methods, results, data
analysis, and conclusions. May also
include possible implications of your
research and future work you see
connected with your findings. May
also include keywords. 9
Main Body (Text)
The first text page is page number 3;
Type the title of the paper centered, at the top of the page;
Type the text double-spaced with all sections following
each other without a break;
Identify the sources you use in the paper in parenthetical
in-text citations;
Format tables and figures.
10
References: Basics
Center the title – References – at the top of the page;
Double space reference entries;
Flush left the first line of the entry and indent
subsequent lines;
Order entries alphabetically by the author’s surnames;
11
References: Basics (cont’d)
Invert authors’ names (last name first followed by
initials);
Alphabetize reference list entries the last name of the first
author of each work;
Capitalize only the first letter of th.
The document discusses the APA style of referencing sources in research papers. It explains that APA style uses author-date citations in the text and a reference list at the end. It provides examples of how to cite sources with one, two, or more authors in both the text and reference list. It also covers citing sources from books, journals, websites and other media. The reference list is arranged alphabetically and examples are given for formatting different source types like books, articles, and online sources.
The document provides guidelines for citing sources and creating reference lists according to the 6th edition of the APA Style Manual. It discusses citing sources in-text using parenthetical citations as well as creating an alphabetical list of references at the end. Specific guidelines are provided for different types of sources, including books, articles, websites, and more. Formatting such as double spacing, indentation, capitalization, and inclusion of publication details are also outlined.
The document provides guidelines for citing sources in APA style, including in-text citations and reference list entries. It discusses citing sources with different numbers of authors in the text and reference list. It also covers citing sources from books, scholarly journals, magazines, newspapers, government publications, and electronic resources. Specific examples are provided for various source types.
The document provides guidelines for citing sources and formatting reference lists according to the 6th edition of the Publication Manual of the American Psychological Association (APA). It discusses citing sources in-text using parenthetical citations as well as formatting the alphabetical list of references at the end. Specific guidelines are provided for various source types including books, journal articles, websites, and more. Proper formatting of author names, publication dates, titles, and retrieval information is covered.
This document provides an introduction to APA referencing style. It explains what referencing is, why it is important to reference, and the basic steps involved, including providing in-text citations and compiling a reference list. Referencing acknowledges the sources of information, facts, figures, ideas and theories used in an assignment. It helps avoid plagiarism and allows readers to follow up on cited sources. The document outlines the key information to include for different source types like books, journal articles, websites and more.
This document provides an overview of APA style in-text citations and reference list entries for various source types, including:
- Books by single and multiple authors
- Journal articles by single and multiple authors
- Websites and web pages
- Theses and unpublished works
- Magazine articles
It explains the general formats for different source types and provides examples of how to format in-text citations and reference list entries according to APA style guidelines.
PPA 2008 – American Government and Public Administration.docxharrisonhoward80223
PPA 2008 – American Government
and Public Administration
APA Formatting and Style Guide
General format;
Reference page;
In-text citations.
(Adapted from Dr. Daniels’s Lectures)
1
What is APA?
APA (American Psychological
Association) is the most
commonly used format for
manuscripts in the Social
Sciences.
2
What does APA regulate?
APA regulates:
Stylistics
In-text citations
References (a list of all
sources used in the paper)
3
APA stylistics: Basics
Use the third person point of view rather than using
the first person point of view;
The study showed that…, NOT
I found out that….
Use the active voice rather than passive voice.
The participants responded…, NOT
The participants have been asked….
4
Language in an APA paper is:
• clear: be specific in descriptions and explanations;
• concise: condense information when you can;
• plain: use simple, descriptive adjectives and
minimize the figurative language.
APA stylistics: Language
5
APA: General Format
Your essay should:
be typed, double-spaced, with two spaces after
punctuation between sentences;
with 1” margins on all sides;
in 12 pt. Times New Roman;
include a page header (title) in the upper left-hand
of every page and a page number in the upper
right-hand side of every page.
6
References
Main Body
Abstract
General Format (cont’d)
Title page
Your essay should
include four major
sections:
7
Title Page
Page header (use Insert Page
Header):
title flush left;
page number flush right.
Title (in the upper half of the
page, centered);
name (no title or degree);
affiliation (university, etc.).
8
Abstract Page
Page header: do NOT include
“Running head:”
Abstract (centered, at the top of
the page)
Write a brief (between 150 and 250
words) summary of your paper in an
accurate, concise, and specific
manner. Should contain: at research
topic, research questions,
participants, methods, results, data
analysis, and conclusions. May also
include possible implications of your
research and future work you see
connected with your findings. May
also include keywords. 9
Main Body (Text)
The first text page is page number 3;
Type the title of the paper centered, at the top of the page;
Type the text double-spaced with all sections following
each other without a break;
Identify the sources you use in the paper in parenthetical
in-text citations;
Format tables and figures.
10
References: Basics
Center the title – References – at the top of the page;
Double space reference entries;
Flush left the first line of the entry and indent
subsequent lines;
Order entries alphabetically by the author’s surnames;
11
References: Basics (cont’d)
Invert authors’ names (last name first followed by
initials);
Alphabetize reference list entries the last name of the first
author of each work;
Capitalize only the first letter of th.
The document provides an overview of the American Psychological Association (APA) style guide for formatting research papers and citations. It discusses guidelines for formatting elements like paper layout, headings, numbers, tables, figures, in-text citations, and reference lists. The document uses examples to demonstrate how to format various citation elements, like quotations, references with multiple authors, and references from different source types.
1. APA
2. APA
3. MLA
4. APA
5. CMS
6. APA
7. APA
8. APA
9. Gonzales explained that ... (as
cited by Brown, 2018, p. 92)
10. It was stated that ... (dela Cruz,
Medina, Gray and Yu, 2018).
9. APA
10. APA
This document provides an introduction to the APA referencing style, including:
1. An overview of what referencing is and why it is important for avoiding plagiarism.
2. The basic steps involved in referencing sources, including taking notes on bibliographic details and inserting citations in text and a reference list.
3. Examples of how to format in-text citations and reference list entries for different source types like books, journal articles, and websites.
This document provides an overview of APA style guidelines for formatting papers, in-text citations, and reference lists. It discusses the general paper format including title pages, headings, tables, and figures. It also covers the basics of citing sources in-text, formatting quotations and paraphrasing, and constructing reference list entries according to APA style. Additional resources for learning APA style are listed at the end.
The document provides an overview of APA style guidelines for formatting papers, in-text citations, and reference lists. It discusses the general paper format, the four main sections of a paper (title page, abstract, main body, references), how to format headings, tables and figures, and how to create in-text citations and reference list entries for various source types, including guidelines for citing works by multiple authors and electronic sources. The document recommends additional APA resources for reference.
This document provides guidelines for using ASA (American Sociological Association) style for writing research papers, including formatting manuscripts, citing sources in text, formatting reference lists, and examples of different types of references such as books, journal articles, and websites. Students are expected to follow ASA style guidelines for citations and references when writing papers for sociology courses.
This document provides guidelines for citing sources using APA style, including in-text citations and reference list entries. It explains that APA style uses a name-year system of referencing, requiring an in-text citation and a full reference list entry. Examples are given for various types of in-text citations (one author, two authors, group authors, no author, etc.) and reference list entries (books, articles, websites, unpublished sources, etc.).
The document provides an overview of APA style formatting and guidelines for citing sources. It discusses the general structure of APA papers including title pages, abstracts, references pages, and in-text citations. Key aspects such as using active voice, clear/concise language, and the proper formatting of quotations, paraphrases, and references are covered. The document also reviews APA guidelines for headings, tables, figures, and formatting of electronic sources.
The document provides an overview of APA style formatting and guidelines for writing research papers according to APA style. It discusses the general paper format, in-text citations, references page, APA headings, tables and figures. Key aspects include double-spacing, 1-inch margins, title page with running head, abstract page, references page in alphabetical order, in-text citations with author and date, and formatting for quotations, summaries and paraphrases. Additional resources for APA style are also listed.
The document compares and contrasts the MLA and APA citation styles. MLA style is used in the humanities and focuses on citing sources in scholarly writing. It requires listing sources alphabetically in a Works Cited section. APA style is used in the social sciences and provides conventions for in-text citations, including citing authors by last name and year. It also requires listing references alphabetically but in a References section. Both styles require providing bibliographic information about sources like author, title, publisher, and date according to their prescribed formats.
The document provides guidelines for formatting a thesis according to the American Psychological Association (APA) style. It discusses formatting guidelines for elements like margins, font, line spacing, title page, headers, page numbers, paragraph indentation, headings, references page, and more. It also provides examples of in-text citations and reference list entries for different source types like books, journal articles, websites, and more. The document aims to help standardize the format of social science manuscripts and theses according to guidelines used by universities in Pakistan.
GENERAL COMMENTS—CASE 1 Incorporate statesmanship model wi.docxshericehewat
The document provides feedback on a case study submission. It recommends that the student: 1) apply the statesmanship model within the case analysis rather than just stating it; 2) demonstrate interpersonal skills of statesmanship through the main characters rather than just mentioning them; and 3) integrate biblical principles within the case analysis rather than just adding them at the end. It also notes that the case lacks specific characters and details.
The document provides an overview of the American Psychological Association (APA) style guide, which is commonly used for formatting papers in the social sciences. It discusses the key aspects of APA formatting such as in-text citations, references, headings, tables, and figures. The document also describes the general sections and structure of an APA paper, including the title page, abstract, main body, and references page. Helpful resources for APA style questions are also listed.
This document provides guidelines for citing references in academic writing using APA style. It is based on the 5th edition of the Publication Manual of the American Psychological Association.
The document defines APA style and explains why referencing is important to avoid plagiarism. It provides guidance on inserting in-text citations and creating a reference list, including examples of different source types like books, journal articles, websites and more. It also discusses referencing software that can help generate citations and references.
Reference and bibliography are essential components of the writing process, particularly in academic and scholarly work. They serve distinct purposes and play a crucial role in providing credibility, supporting claims, and acknowledging the sources of information used in a written work.
APA STYLE SEVENTH EDITION - 2019This module is desi.docxrobert345678
This document provides an overview of the key elements and guidelines of APA style seventh edition formatting for academic writing. It covers the basic paper components such as the title page, text of the paper, and reference page. Important APA style rules are explained for in-text citations, references, headings, tables, figures, abbreviations, bias-free language, numbers and statistics. Formatting guidelines are provided for title pages, running heads, typeface, margins, page numbers, headings, lists, tables and figures. Examples are included throughout to illustrate how to format references correctly.
This document provides guidelines for citing sources in APA style from the University of Tasmania. It discusses (1) why it is important to reference sources used, (2) how to cite sources in both in-text citations and a reference list, and (3) examples of different source types such as books, journal articles, websites, and more.
This document provides guidelines for referencing sources using the American Psychological Association (APA) style. It discusses referencing sources in-text with citations, and creating a reference list at the end. Key points covered include formatting in-text citations for one, two, three or more authors, works by the same author in the same or different years, and how to reference different source types such as books, book chapters, journal articles, and websites. Specific examples are provided to illustrate how to reference various sources correctly according to APA style.
APA Citation
1
What is APA style?
Standardized system for giving credit to others for their contribution to your work
Is parenthetical (cited in the text)
Guidelines for headings and a reference list
2
Parenthetical, which means the citations appear in the text of your paper. Also a reference list we’ll get to later.
What is APA style?
Author’s Last Name
Year of Publication
Page Number (if a direct quote)
3
Intro: In these citation, they call for three things.
Why Should I Use APA?
Shows honesty about borrowing others’ intellectual property
Provides evidence of your research
Allows readers to locate your sources
Prevents plagiarism
Honesty=much different from hip-hop and electronic music where borrowing without giving credit is a norm. Academic norm is to explicitly give credit.
4
What kind of source do I have?
Book
Page from a Website
Academic (Peer-Reviewed) Journal
In-text Citations: Direct Quote
Example from article (Original Sentence)
“This case study showed that the dominant upper back pain decreased after the RSP decreased through application of RST by using kinesiology tape in a female sedentary worker.”
1. Authors’ names 2. Year of Publication 3. Page number
(2013)
Hwang-Bo, Lee, & Kim
discovered
“dominant upper back pain decreased after the RSP decreased through application of RST by using kinesiology tape in a female sedentary worker”
(p. 611).
Inserted authors’ names, year, and page number at beginning and end
Noticed I also cut off the first part of the sentence because it didn’t really fit with how I wanted to construct my sentence and I want to emphasize their findings.
First time we spell out all name for sources with 1-5 authors. After that, 3,4,5 authors get shortcut the second time. 6 or more authors are always abbreviated.
8
Citation at end of sentence
“dominant upper
back pain decreased after the RSP decreased
through application of RST by using kinesiology
tape in a female sedentary worker”
Researchers discovered that
(Hwang-Bo,
Lee, & Kim, 2013, p. 611).
Subsequent References
1-2 authors-----Always spell out all names
Smith (2001) said….
Smith and Jones (1980) examined…
Applicants’ expectations are outlandish (Smith, 2001).
Applicants’ expectations are outlandish (Smith and Jones, 1980).
*Note that these are paraphrases.
Subsequent References: 3-5 Authors
First Reference:
Wiley, Smith, & Jones (2015) stated most left-handers are artistic.
Most left-handers are artistic (Wiley, Smith, & Jones, 2015).
Spell out all names first mention, then use “et al.”
11
Subsequent References: 3-5 Authors
Subsequent Reference: Wiley et al. (2015) state scary movies affect left-handers more than right-handers.
Scary movies affect left-handers more than right-handers (Wiley et al., 2015).
6 or more Authors
Start with first author, then use “et al.”
Johnson et al. (2015) defend the claim that…..
No Author Named
Use short ...
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1 APA Style Reference Citations Library Resource Gu
The document provides an overview of the American Psychological Association (APA) style guide for formatting research papers and citations. It discusses guidelines for formatting elements like paper layout, headings, numbers, tables, figures, in-text citations, and reference lists. The document uses examples to demonstrate how to format various citation elements, like quotations, references with multiple authors, and references from different source types.
1. APA
2. APA
3. MLA
4. APA
5. CMS
6. APA
7. APA
8. APA
9. Gonzales explained that ... (as
cited by Brown, 2018, p. 92)
10. It was stated that ... (dela Cruz,
Medina, Gray and Yu, 2018).
9. APA
10. APA
This document provides an introduction to the APA referencing style, including:
1. An overview of what referencing is and why it is important for avoiding plagiarism.
2. The basic steps involved in referencing sources, including taking notes on bibliographic details and inserting citations in text and a reference list.
3. Examples of how to format in-text citations and reference list entries for different source types like books, journal articles, and websites.
This document provides an overview of APA style guidelines for formatting papers, in-text citations, and reference lists. It discusses the general paper format including title pages, headings, tables, and figures. It also covers the basics of citing sources in-text, formatting quotations and paraphrasing, and constructing reference list entries according to APA style. Additional resources for learning APA style are listed at the end.
The document provides an overview of APA style guidelines for formatting papers, in-text citations, and reference lists. It discusses the general paper format, the four main sections of a paper (title page, abstract, main body, references), how to format headings, tables and figures, and how to create in-text citations and reference list entries for various source types, including guidelines for citing works by multiple authors and electronic sources. The document recommends additional APA resources for reference.
This document provides guidelines for using ASA (American Sociological Association) style for writing research papers, including formatting manuscripts, citing sources in text, formatting reference lists, and examples of different types of references such as books, journal articles, and websites. Students are expected to follow ASA style guidelines for citations and references when writing papers for sociology courses.
This document provides guidelines for citing sources using APA style, including in-text citations and reference list entries. It explains that APA style uses a name-year system of referencing, requiring an in-text citation and a full reference list entry. Examples are given for various types of in-text citations (one author, two authors, group authors, no author, etc.) and reference list entries (books, articles, websites, unpublished sources, etc.).
The document provides an overview of APA style formatting and guidelines for citing sources. It discusses the general structure of APA papers including title pages, abstracts, references pages, and in-text citations. Key aspects such as using active voice, clear/concise language, and the proper formatting of quotations, paraphrases, and references are covered. The document also reviews APA guidelines for headings, tables, figures, and formatting of electronic sources.
The document provides an overview of APA style formatting and guidelines for writing research papers according to APA style. It discusses the general paper format, in-text citations, references page, APA headings, tables and figures. Key aspects include double-spacing, 1-inch margins, title page with running head, abstract page, references page in alphabetical order, in-text citations with author and date, and formatting for quotations, summaries and paraphrases. Additional resources for APA style are also listed.
The document compares and contrasts the MLA and APA citation styles. MLA style is used in the humanities and focuses on citing sources in scholarly writing. It requires listing sources alphabetically in a Works Cited section. APA style is used in the social sciences and provides conventions for in-text citations, including citing authors by last name and year. It also requires listing references alphabetically but in a References section. Both styles require providing bibliographic information about sources like author, title, publisher, and date according to their prescribed formats.
The document provides guidelines for formatting a thesis according to the American Psychological Association (APA) style. It discusses formatting guidelines for elements like margins, font, line spacing, title page, headers, page numbers, paragraph indentation, headings, references page, and more. It also provides examples of in-text citations and reference list entries for different source types like books, journal articles, websites, and more. The document aims to help standardize the format of social science manuscripts and theses according to guidelines used by universities in Pakistan.
GENERAL COMMENTS—CASE 1 Incorporate statesmanship model wi.docxshericehewat
The document provides feedback on a case study submission. It recommends that the student: 1) apply the statesmanship model within the case analysis rather than just stating it; 2) demonstrate interpersonal skills of statesmanship through the main characters rather than just mentioning them; and 3) integrate biblical principles within the case analysis rather than just adding them at the end. It also notes that the case lacks specific characters and details.
The document provides an overview of the American Psychological Association (APA) style guide, which is commonly used for formatting papers in the social sciences. It discusses the key aspects of APA formatting such as in-text citations, references, headings, tables, and figures. The document also describes the general sections and structure of an APA paper, including the title page, abstract, main body, and references page. Helpful resources for APA style questions are also listed.
This document provides guidelines for citing references in academic writing using APA style. It is based on the 5th edition of the Publication Manual of the American Psychological Association.
The document defines APA style and explains why referencing is important to avoid plagiarism. It provides guidance on inserting in-text citations and creating a reference list, including examples of different source types like books, journal articles, websites and more. It also discusses referencing software that can help generate citations and references.
Reference and bibliography are essential components of the writing process, particularly in academic and scholarly work. They serve distinct purposes and play a crucial role in providing credibility, supporting claims, and acknowledging the sources of information used in a written work.
APA STYLE SEVENTH EDITION - 2019This module is desi.docxrobert345678
This document provides an overview of the key elements and guidelines of APA style seventh edition formatting for academic writing. It covers the basic paper components such as the title page, text of the paper, and reference page. Important APA style rules are explained for in-text citations, references, headings, tables, figures, abbreviations, bias-free language, numbers and statistics. Formatting guidelines are provided for title pages, running heads, typeface, margins, page numbers, headings, lists, tables and figures. Examples are included throughout to illustrate how to format references correctly.
This document provides guidelines for citing sources in APA style from the University of Tasmania. It discusses (1) why it is important to reference sources used, (2) how to cite sources in both in-text citations and a reference list, and (3) examples of different source types such as books, journal articles, websites, and more.
This document provides guidelines for referencing sources using the American Psychological Association (APA) style. It discusses referencing sources in-text with citations, and creating a reference list at the end. Key points covered include formatting in-text citations for one, two, three or more authors, works by the same author in the same or different years, and how to reference different source types such as books, book chapters, journal articles, and websites. Specific examples are provided to illustrate how to reference various sources correctly according to APA style.
APA Citation
1
What is APA style?
Standardized system for giving credit to others for their contribution to your work
Is parenthetical (cited in the text)
Guidelines for headings and a reference list
2
Parenthetical, which means the citations appear in the text of your paper. Also a reference list we’ll get to later.
What is APA style?
Author’s Last Name
Year of Publication
Page Number (if a direct quote)
3
Intro: In these citation, they call for three things.
Why Should I Use APA?
Shows honesty about borrowing others’ intellectual property
Provides evidence of your research
Allows readers to locate your sources
Prevents plagiarism
Honesty=much different from hip-hop and electronic music where borrowing without giving credit is a norm. Academic norm is to explicitly give credit.
4
What kind of source do I have?
Book
Page from a Website
Academic (Peer-Reviewed) Journal
In-text Citations: Direct Quote
Example from article (Original Sentence)
“This case study showed that the dominant upper back pain decreased after the RSP decreased through application of RST by using kinesiology tape in a female sedentary worker.”
1. Authors’ names 2. Year of Publication 3. Page number
(2013)
Hwang-Bo, Lee, & Kim
discovered
“dominant upper back pain decreased after the RSP decreased through application of RST by using kinesiology tape in a female sedentary worker”
(p. 611).
Inserted authors’ names, year, and page number at beginning and end
Noticed I also cut off the first part of the sentence because it didn’t really fit with how I wanted to construct my sentence and I want to emphasize their findings.
First time we spell out all name for sources with 1-5 authors. After that, 3,4,5 authors get shortcut the second time. 6 or more authors are always abbreviated.
8
Citation at end of sentence
“dominant upper
back pain decreased after the RSP decreased
through application of RST by using kinesiology
tape in a female sedentary worker”
Researchers discovered that
(Hwang-Bo,
Lee, & Kim, 2013, p. 611).
Subsequent References
1-2 authors-----Always spell out all names
Smith (2001) said….
Smith and Jones (1980) examined…
Applicants’ expectations are outlandish (Smith, 2001).
Applicants’ expectations are outlandish (Smith and Jones, 1980).
*Note that these are paraphrases.
Subsequent References: 3-5 Authors
First Reference:
Wiley, Smith, & Jones (2015) stated most left-handers are artistic.
Most left-handers are artistic (Wiley, Smith, & Jones, 2015).
Spell out all names first mention, then use “et al.”
11
Subsequent References: 3-5 Authors
Subsequent Reference: Wiley et al. (2015) state scary movies affect left-handers more than right-handers.
Scary movies affect left-handers more than right-handers (Wiley et al., 2015).
6 or more Authors
Start with first author, then use “et al.”
Johnson et al. (2015) defend the claim that…..
No Author Named
Use short ...
Similar to 1 APA Style Reference Citations Library Resource Gu (20)
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
हिंदी वर्णमाला पीपीटी, hindi alphabet PPT presentation, hindi varnamala PPT, Hindi Varnamala pdf, हिंदी स्वर, हिंदी व्यंजन, sikhiye hindi varnmala, dr. mulla adam ali, hindi language and literature, hindi alphabet with drawing, hindi alphabet pdf, hindi varnamala for childrens, hindi language, hindi varnamala practice for kids, https://www.drmullaadamali.com
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
How to Build a Module in Odoo 17 Using the Scaffold MethodCeline George
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar Kanvaria
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
1 APA Style Reference Citations Library Resource Gu
1. 1
APA Style Reference Citations
Library Resource Guide
WHAT IS A REFERENCE CITATION?
A reference citation is the documentation needed to make your
paper acceptable for academic purposes. It
gives authoritative sources for your statements, helps the reader
gain access to those sources, and acknowledges
the fact that the information used in a paper did not originate
with the writer.
WHAT IS APA'S STYLE OF REFERENCE CITATION?
APA style uses the author/date method of citation in which the
author's last name and the year of the
publication are inserted in the actual text of the paper. It is the
style recommended by the American
Psychological Association and used in many of the social
sciences. The American Psychological Association
addresses new electronic formats in a separate guide, which UT
students can access in book format or online
through the library. Several of the examples in this guide come
from one of these sources. The American
Psychological Association offers some guidance and examples
at http://www.apastyle.org/. The Writing
Center, on the first floor of Carlson, also offers help to students
2. who are writing papers. This guide only
summarizes a few main points regarding APA style. For full
information, please consult the two APA guides
below.
BF 76.7 .P83 2001 REF (available in Reference and Reserves at
Carlson Library)
Publication Manual of the American Psychological Association
(5th ed.) by The American
Psychological Association.
BF 76.7 .P833 2007 REF (available in Reference or at
http://utmost.cl.utoledo.edu/record=b2574984)
APA Style Guide to Electronic References by The American
Psychological Association.
WHEN USING APA STYLE, DO I NEED TO USE
FOOTNOTES AT THE BOTTOM OF THE PAGE?
No, by inserting reference citations in the text, you eliminate
the need to use footnotes at the bottom of the page
or at the end of your paper. The citations in your end-of-paper
references list should give readers enough
information to locate each source.
NOTE: It is suggested that you consult with your instructor or
advisor for the style preferred by your
department. Be consistent and do not mix styles! Inquire at the
Information/Reference Desk for style
manuals available at Carlson Library.
EXAMPLES OF REFERENCE CITATIONS IN TEXT--APA
STYLE
3. 1. If author's name occurs in the text, follow it with year of
publication in parentheses.
Example: Piaget (1970) compared reaction times...
2. If author's name is not in the text, insert last name, comma,
year in parenthesis.
Example: In a recent study of reaction times (Piaget, 1978)…
2
3. If author's name and the date of publication have been
mentioned in the text of your paper, they
should not be repeated within parentheses.
Example: In 1978, Piaget compared reaction times...
4. Because material within a book or on a web page is often
difficult to locate, authors should,
whenever possible, give page numbers for books or paragraph
numbers for web pages in body to
assist readers. Page numbers (preceded by p. or pp.) or
paragraph numbers (preceded by ¶ or
4. para.) follow the year of publication, and are separated from it
by a comma. For websites with
neither page numbers nor paragraph numbers, cite the heading
and the number of the paragraph
following it.
Examples: Hunt (1974, pp. 25-69) confirms the hypothesis...
(Myers, 2000 ¶ 5)
(Beutler, 2000, Conclusion section, para. 1)
5. If a work has two authors, always cite both names every time
the reference occurs in the text.
Connect both names by using the word "and."
Examples: Piaget and Smith (1972) recognize...
Finberg and Skipp (1973, pp. 37-52) discuss...
6. If a work has two authors and they are not included in the
text, insert within parentheses, the last
names of the authors joined by an ampersand (&), and the year
separated from the authors by a
comma.
Examples: ...to organize accumulated knowledge and order
sequences of operations (Piaget &
Smith, 1973)
...to organize accumulated knowledge and order sequences of
operations (Piaget &
Smith,1973, p. 410)
7. If a work has more than two authors (but fewer than six), cite
5. all authors the first time the
reference occurs; include the last name followed by "et al." and
the year in subsequent citations
of the same reference.
Example: First occurrence:
Williams, French and Joseph (1962) found...
Subsequent citations:
Williams et al. (1962) recommended...
8. Quotations: Cite the source of direct quotations by enclosing
it in parentheses. Include author,
year, and page number. Punctuation differs according to where
the quotation falls.
1) If the quoted passage is in the middle of a sentence, end the
passage with quotation marks, cite
the source in parentheses immediately, and continue the
sentence.
Example: Many inexperienced writers are unsure about "the
actual boundaries of the grammatical
abstraction called a sentence" (Shaughnessy, 1977, p. 24) or
about which form of
punctuation they should use.
6. 3
2) If the quotation falls at the end of a sentence, close the
quotation with quotation marks, and cite
the source in parentheses after the quotation marks. End with
the period outside the parentheses.
Example: Fifty percent "of spontaneous speech is estimated to
be non-speech"
(Shaughnessy, 1977, p. 24).
3) If the quotation is longer than forty words, it is set off
without quotations marks in an indented
block (double spaced). The source is cited in parentheses after
the final period.
Example: This is further explained by Shaughnessy's (1977)
following statements:
In speech, pauses mark rates of respiration, set off certain
words
for rhetorical emphasis, facilitate phonological maneuvers,
regulate the rhythms of thought and articulation and suggest
grammatical structure. Modern punctuation, however, does not
provide a score for such a complex orchestration. (p. 24)
4) If citing a work discussed in a secondary source, name the
original work and give a citation for
the secondary source. The reference list should contain the
7. secondary source, not the unread
primary source.
Example: Seidenberg and McClelland’s study (as cited in
Coltheart, Curtis, Atkins, &
Haller, 1993)
THE REFERENCE LIST
APA style suggests using a reference list for references cited in
the text of a paper rather than a bibliography. A
reference list includes only those references which were
actually cited in the text of one's paper. There must be
total agreement between the two. (See an example of a
reference list on the last page). A bibliography includes
all literature consulted which was "immediately relevant" to the
research process, even though the material was
not cited in the text of one's paper.
When compiling a reference list one needs to pay particular
attention to the following: 1) sequence; 2)
punctuation and spacing; 3) capitalization; and 4) underlining.
ORDER OF REFERENCES IN THE REFERENCE LIST
1) Arrange entries in alphabetical order by surname of the first
author.
2) Single-author entries precede multiple-author entries
beginning with the same surname:
Kaufman, J. R. (1981).
Kaufman, J. R., & Cochran, D. C. (1978).
8. 3) References with the same first author and different second or
third authors are arranged
alphabetically by the surname of the second author, and so on:
Kaufman, J. R., Jones, K., & Cochran, D. F. (1982).
Kaufman, J. R., & Wong, D. F. (1978)
4
4) References with the same authors in the same order are
arranged by year of publication, the
earliest first:
Kaufman, J. R., Jones, K. (1977).
Kaufman, J. R., Jones, K. (1980).
5) The order of several works by different authors with the same
surname is arranged alphabetically
by the first initial:
Eliot, A. L. (1983).
Eliot, G. E. (1980).
EXAMPLES OF ITEMS IN A REFERENCE LIST
Although the format for books, journal articles, magazine
articles and other media is similar, there are some
slight differences. Items in a reference list should be double -
spaced. Also, use hanging indents: entries should
begin flush left with subsequent lines indented.
BOOKS:
9. One author:
Castle, E. B. (1970). The teacher. London: Oxford University
Press.
Two authors:
McCandless, B. R., & Evans, E. D. (1973). Children and youth:
Psychosocial development.
Hinsdale, IL: Dryden Press.
Three or more authors: (list each author)
Smith, V., Barr, R., & Burke, D. (1976). Alternatives in
education: Freedom to choose.
Bloomington, IN: Phi Delta Kappa, Educational Foundation.
Society, association, or institution as author and publisher:
American Psychiatric Association. (1980). Diagnostic and
statistical manual of mental disorders
(3rd ed.). Washington, D.C.: Author.
Editor or compiler as author:
Rich, J. M. (Ed.). (1972). Readings in the philosophy of
education (2nd ed.). Belmont, CA:
Wadsworth.
Chapter, essay, or article by one author in a book or
encyclopedia edited by another:
10. Medley, D. M. (1983). Teacher effectiveness. In H. E. Mitzel
(Ed.), Encyclopedia of educational
research (Vol. 4, pp. 1894-1903). New York: The Free Press.
JOURNAL ARTICLES:
One author:
Herrington, A. J. (1985). Classrooms as forums for reasoning
and writing. College Composition
and Communication, 36(4), 404-413.
Two authors:
5
Horowitz, L. M., & Post, D. L. (1981). The prototype as a
construct in abnormal psychology.
Journal of Abnormal Psychology, 90(6), 575-585.
Society, association, or institution as author:
Institute on Rehabilitation Issues. (1975). Critical issues in
rehabilitating the severely
handicapped. Rehabilitation Counseling Bulletin, 18(4), 205-
213.
11. NEWSPAPER ARTICLES:
No author:
More jobs waiting for college grads. (1986, June 17). Detroit
Free Press, pp. 1A, 3A.
MAGAZINES:
One author:
Powledge, T. M. (1983, July). The importance of being twins.
Psychology Today, 19, 20-27.
No author:
CBS invades Cuba, returns with Irakere: Havana jam. (1979,
May 3). Down Beat, 10.
MICROFORMS:
ERIC report:
Plantes, Mary Kay. (1979). The effect of work experience on
young men's earnings. (Report No.
IRP-DP-567-79). Madison: Wisconsin University. Madison
Institute for Research on
Poverty. (ERIC Document Reproduction Service No. ED183687)
ERIC paper presented at a meeting:
Whipple, W. S. (1977, January). Changing attitude through
behavior modification. Paper
12. presented at the annual meeting of the National Association of
Secondary School
Principals, New Orleans, LA. (ERIC Document Reproduction
Service No. ED146500)
AUDIOVISUAL MEDIA AND SPECIAL INSTRUCTIONAL
MATERIALS:
This category includes the following types of non-book
materials:
Audiorecord Flashcard Motion picture Videorecording Slide
Kit
Chart Game Picture Transparency Realia Filmstrip
A bibliographic/reference format for these non-print materials is
as follows:
Author's name (inverted.----Author's function, i.e., Producer,
Director, Speaker, etc. in parentheses.----Date of
publication in parentheses----Title.----Medium in brackets after
title, [Filmstrip]. HOWEVER, if it is necessary
to use a number after a medium for identification or retrieval
purposes, use parentheses instead of brackets, e.g.,
(Audiorecord No. 4321).----Place of publication: Publisher.
Maas, J. B. (Producer), & Gluck, D. H. (Director). (1979).
Deeper in hypnosis [Motion Picture]. Englewood
Cliffs, NJ: Prentice-Hall.
13. 6
ELECTRONIC MEDIA:
Materials available via the Internet include journals,
newspapers, research papers, government reports, web
pages, etc. When citing an Internet source, one should:
1. Provide as much information as possible that will help
readers relocate the information. Also try to
reference specific documents rather than web pages when
possible.
2. Give accurate, working addresses (URLs) or Digital Object
Identifiers.
References to Internet sources should include at least the
following four items:
1. A title or description
2. A date (either date of publication or date of retrieval)
3. An address (URL) or Digital Object Identifier
4. An author's name, if available
In an effort to solve the problem of changed addresses and
broken links, publishers have begun to assign Digital
Object Identifiers (DOI) to documents, particularly to scholarly
journal articles. DOIs should be used in
14. reference lists when they are available. A DOI may be pasted
into the DOI Resolver at http://www.crossref.org/
to confirm a citation. For journal articles, if no DOI is
available, a database name or URL may be added for
particularly difficult to find publications. Since journal
articles, unlike many web pages, are unlikely to change,
a retrieval date is not necessary. Electronic book citations only
need source information when the book is
difficult to find or only available electronically.
Internet article based on a print source (exact duplicate) with
DOI assigned:
Stultz, J. (2006). Integrating exposure therapy and analytic
therapy in trauma treatment.
American Journal of Orthopsychiatry, 76(4), 482-488.
doi:10.1037/0002-9432.76.4.482
Article in an Internet only journal with no DOI assigned:
Sillick, T. J., & Schutte, N. S. (2006). Emotional intelligence
and self-esteem mediate between
perceived early parental love and adult happiness. E-Journal of
Applied Psychology, 2(2),
38-48. Retrieved from
http://ojs.lib.swin.edu.au/index.php/ejap/article/view/71/100
Daily newspaper article, electronic version available by search:
Botha, T. (1999, February 21). The Statue of Liberty, Central
Park and me. The New York Times.
15. Retrieved from http://www.nytimes.com
Webpage:
Raymon H. Mulford Library, The University of Toledo Health
Science Campus. (2008).
Instructions to authors in the health sciences. Retrieved June
17, 2008, from
http://mulford.mco.edu/instr/
Annual report:
Pearson PLC. (2005). Reading allowed: Annual review and
summary financial statements 2004.
Retrieved from
http://www.pearson.com/investor/ar2004/pdfs/summary_report_
2004.pdf
7
References
American Psychological Association. (2008). Electronic
resources. Retrieved June 17, 2008 from
http://www.apastyle.org/elecref.html.
American Psychological Association. (2008). Frequently asked
16. questions. Retrieved June 17, 2008 from
http://www.apastyle.org/faqs.html.
Bloom, B. S. (Ed.). (1956). Taxonomy of educational
objectives: The classification of educational goals, by a
committee of college and university examiners. New York: D.
McKay.
Botha, T. (1999, February 21). The Statue of Liberty, Central
Park and me. The New York Times. Retrieved
from http://www.nytimes.com
CBS invades Cuba, returns with Irakere: Havana jam. (1979,
May 3). Down Beat, 10.
Herrington, A. J. (1985). Classrooms as forums for reasoning
and writing. College Composition and
Communication, 36(4), 404-413.
Maas, J. B. (Producer), & Gluck, D. H. (Director). (1979).
Deeper in hypnosis [Motion Picture]. Englewood
Cliffs, NJ: Prentice-Hall.
Mandel, B. J. (1978). Losing one's mind: Learning to write and
edit. College Composition and Communication,
29, 263-268.
Medley, D. M. (1982). Teacher effectiveness. In H. E. Mitzel
(Ed.), Encyclopedia of educational research (Vol.
17. 4, pp. 1894-1903). New York: The Free Press.
Raymon H. Mulford Library, The University of Toledo Health
Science Campus. (2008). Instructions to authors
in the health sciences. Retrieved June 17, 2008, from
http://mulford.mco.edu/instr/
Sillick, T. J., & Schutte, N. S. (2006). Emotional intelligence
and self-esteem mediate between perceived early
parental love and adult happiness. E-Journal of Applied
Psychology, 2(2), 38-48. Retrieved from
http://ojs.lib.swin.edu.au/index.php/ejap/article/view/71/100
Stultz, J. (2006). Integrating exposure therapy and analytic
therapy in trauma treatment. American Journal of
Orthopsychiatry, 76(4), 482-488. doi:10.1037/0002-
9432.76.4.482 revised 06/23/08 jam
FACING THE PERILS OF
PRESIDENTIALISM?
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang
While several East Asian countries have been part of the “third
wave”
of democratization over the past generation, it is no secret that
many of
them have also been experiencing significant growing pains. In
just the
18. last five years, Indonesia, the Philippines, Taiwan, and most
recently
South Korea have all suffered serious—albeit not regime-
threatening—
political crises that featured at least the beginning of
impeachment
proceedings against an elected chief executive. Presidents
Joseph Estrada
of the Philippines and Abdurrahman Wahid of Indonesia (the
one indi-
rectly elected member of the group) actually lost their offices —
in
Estrada’s case through means that many deemed illegal.
Presidents Chen
Shui-bian of Taiwan and Roh Moo Hyun of South Korea
survived the
campaigns against them, the former because impeachment never
went
much beyond a preliminary motion in the legislature, and the
latter
because his country’s Constitutional Court decided that he
should keep
his job despite what the Court found were legal and
constitutional der-
elictions.
In each of these cases a president found himself facing a crisis
of
legitimacy, bereft of a legislative majority, and often without
power to
enact his agenda into law. The turmoil created by these crises
has led to
calls for constitutional reform in all four countries. In the
Philippines,
President Gloria Macapagal-Arroyo, Estrada’s successor, has
even agreed
19. to open formal deliberations on whether the country should
amend its
constitution and adopt a parliamentary form of government.
Is there a crisis in East Asian presidentialism comparable to the
prob-
Francis Fukuyama is Bernard Schwartz Professor of
International
Political Economy at the Johns Hopkins School of Advanced
Interna-
tional Studies. His most recent book is State-Building:
Governance and
World Order in the 21st Century (2004). Björn Dressel and Boo-
Seung
Chang are doctoral students at the Johns Hopkins School of
Advanced
International Studies.
Journal of Democracy Volume 16, Number 2 April 2005
Challenge and Change in East Asia
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 103
lems that presidential polities have experienced in Latin
America and
other parts of the world? Does what happened in Indonesia, the
Philip-
pines, South Korea, and Taiwan reveal defects inherent in
presidentialism,
or are the causes more particular, relating to poorly designed
institu-
tions in one country or another? If the latter, are such
20. institutions readily
fixable, or do they reflect deep-seated dynamics in each society
that are
likely to resist change?
It is true that presidential systems have created crisis and
instability
in all four of these East Asian lands, though none of the four
crises was
regime-threatening or led to democratic breakdown. In each
country,
presidentialism allowed a relative outsider to rise to power far
more
rapidly than would have been possible under parliamentarism.
In Tai-
wan and South Korea, these outsiders succeeded in dramatically
shifting
the policy agenda. Estrada might have as well, had the
Philippine estab-
lishment not ousted him. In many developing countries, the
tendency
toward consensus praised by proponents of parliamentarism is
often a
formula for political stasis. What one thinks of the ultimate
merits of
presidentialism thus depends on what one thinks about the
urgency of
political change in a given country.
Juan Linz, in his classic article in the Journal of Democracy,
laid out
four major “perils of presidentialism.”1 First, the inherently
winner-take-
all nature of presidential elections can too readily produce a
president
who enjoys the support of only a minority of the electorate and
21. hence
suffers from a legitimacy gap. Second, the rigidity of
presidential terms
and the difficulties in removing a sitting president make change
in the
executive excessively difficult, and term limits may turn even
popular
and effective incumbents into lame ducks. Third, the “dual
legitimacy”
of elected executives and legislatures often leads to policy
gridlock
when the two branches are captured by different parties or when
presi-
dents fail to muster solid legislative majorities to support their
agendas.
Finally, presidentialism can foster “personality politics” and
make it
possible for inexperienced outsiders to rise to the top.
L i n z ’ s o r i g i n a l a r t i c l e u n l e a s h e d a f l o o d
o f s c h o l a r s h i p o n
presidentialism, much of it published originally in the pages of
this jour-
nal.2 Very little of that literature, however, has taken account
of recent
developments in East Asia, where the majority of new
democracies have
presidential systems. In reviewing developments in the
Philippines, In-
donesia, South Korea, and Taiwan, we will explore to what
extent Linz’s
critique and predictions have been borne out in East Asia.
The Philippines: A President on Trial
Joseph Estrada won the presidency of the Philippines in May
22. 1998
with the largest landslide in the country’s history. A former
movie star
with strong populist appeal, he drew the support of poorer
voters and
Journal of Democracy104
the skepticism or even dismay of political and economic elites.
By
January 2001 he was being hustled out the back door of
Malacanang
Palace under a cloud of impeachment charges and with a new
version of
the nonviolent 1986 “people power” uprising brewing in
Manila.
At first glance, it all seemed a stunning reversal of fortune.
When
Estrada had taken office in mid-1998, he had enjoyed not only
wide
voter support but also majorities in both houses of the
legislature. His
cabinet was well-balanced, and he wisely boosted his legitimacy
and
allayed establishment fears by asking his well-respected
predecessor
Fidel Ramos to sign on as a senior advisor.
Within a year, however, Estrada’s approval ratings were
dropping
and his political capital was running low. A sluggish economy
and
mounting fiscal constraints had made clear the limits to his bold
23. agenda
of balancing the demands of economic liberalization with his
goal of
enacting policies to help the poor. New agencies and projects
such as
the National Anti-Poverty Commission and the mass-housing
program
seemed sluggish or even corruption-riddled.
The president’s day-to-day operating style, meanwhile, was
causing
concern. Estrada met with his cabinet ministers irregularly and
spent
much time drinking and gambling with a “midnight cabinet” of
cronies
who even drafted orders for the president to sign during after -
hours ca-
rousing sessions. Scandals and evidence of special presidential
treatment
involving friends of Estrada in the air travel,
telecommunications, and
banking industries as well as the stock market gravely worried
the Fili-
pino business community. The president tried to address these
worries in
early 2000 with a cabinet reshuffle and some outreach efforts,
but to no
avail. On 9 October 2000, a state governor named Luis Chavit
Singson
alleged that he had funneled about US$3.5 million in illegal
gambling
money to Estrada and his family as protection payments. This
accusation
led to the first concrete evidence that the president had been
taking bribes
and condoning illicit activities.
24. Civil society groups rallied to protest Estrada’s misdeeds,
business
groups distanced themselves from him, and legislators
defected.3 In
December 2000, the Senate began impeachment proceedings on
charges
of bribery, corruption, betrayal of public trust, and culpable
violation
of the constitution. The impeachment trial produced additional
evi-
dence against the president, but came to a sudden end in
January 2001
when the prosecutors walked out, claiming that pro-Estrada
senators
were manipulating the trial.
At that point, the focus of anti-Estrada activity moved to the
streets.
Church, business, and political leaders demanded Estrada’s
resigna-
tion, and thousands of mostly middle-class protesters in the
Manila area
backed these calls. When the armed forces publicly withdrew
their sup-
port, Estrada was finished. Gloria Macapagal-Arroyo stepped up
from
the vice-presidency to the presidency in a process not covered
by the
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 105
constitution. A Supreme Court ruling later deemed it a case of
presiden-
25. tial resignation, but doubts as to the legality of the process
remain.4
Estrada himself, detained in April 2001 and still under house
arrest,
awaits trial on charges of corruption, bribery, and economic
plunder.
Estrada’s dubious habits and erratic leadership convinced many
that
he was unfit, yet he was no political neophyte. He had become
mayor of
San Juan Municipality in metropolitan Manila in the late 1960s,
a posi-
tion that he held until he won a Senate seat (a nationwide office,
since
all Philippine senators are “at-large”) in 1987 and the vice-
presidency
five years after that. He had even served on Ramos’s
Presidential Anti-
Crime Commission. While Estrada had experience, however, he
was
unlike his predecessors in being unable to reach out to critical
business,
religious, and civic groups to build consensus. Under the
influence of
friends and family, his policy style became increasingly
exclusionary,
skewed toward populist policies aimed at the poor and relatively
un-
mindful of the urban middle class.
Institutional dynamics mattered a great deal as well. The
Philippine
president is directly elected and limited to a single six-year
term. A
26. serious presidential campaign costs more than US$50 million—
a huge
sum in a country where GDP per capita is about US$1,080 a
year.5 Busi-
ness interests typically provide most of this money, and expect
rewards
for doing so. Meanwhile, the term limit might reinforce
tendencies to
push through with a political agenda without pausing to build
broad-
based support.
Besides cash, it is popular appeal—and not the backing of the
Phil-
ippines’ traditionally weak and fragmented political parties—
that is
the key to winning the presidency. Estrada ran and won as the
head of a
party that was formed barely a year before the election. Given
the feeble-
ness of parties and the strength of the president in matters such
as the
budget process, floor-crossing is common, especially in the
250-mem-
ber House of Representatives. This eases the problem of “dual
legitimacy” but also means that defections can swiftly cascade
should
the president’s popularity slip or a crisis loom. The 24 members
of the
Senate, with their limit of two six-year terms and their
nationwide voter
bases, often regard themselves as potential presidents-in-
waiting, which
only tends to increase the system’s brittleness once a president
runs
into trouble.
27. The foregoing explains why the real push for Estrada’s removal
came
from outside the formal political institutions. At least one
scholar has
praised the “People Power II” movement, which united political
and
economic elites with activists from the urban middle classes, as
a vic-
tory for popular will and a “middle-class consensus.”6 Yet is
not the
resolution of a constitutional crisis by an extra-institutional
popular
movement a worrisome sign of brittleness and vulnerability in
the Phil-
ippine polity?
Journal of Democracy106
The institutional dimension of the crisis becomes fully
comprehen-
sible only in light of the strong regional, political, and above all
social
cleavages that made a populist such as Estrada a likely choice
for the
Philippine poor. The massive and someti mes violent protests of
his
supporters after his resignation as well as his continuing high
popular-
ity among lower-income voters betoken the aspirations of
millions who
are disillusioned with elites and institutions that have delivered
neither
equity nor sustained growth. As long as the Philippine Republic
28. is run
by elites that are unable or unwilling seriously to accommodate
the
policy preferences of the poor within a formal institutional
framework
centered on a strong presidency, political crisis is almost
inevitable.7
After the 2004 presidential election, in which populist outsider
(and
famous Philippine actor) Fernando Poe unsuccessfully
challenged Presi-
dent Macapagal-Arroyo, the latter proposed to resume a
constitutional-
reform process that had stalled during Estrada’s truncated term.
The goals
of this reform, it would appear, are to redefine elite-mass
relations,
recalibrate low-quality institutions, and change a political
culture widely
perceived as dysfunctional. It remains to be seen whether these
delibera-
tions will provide the Philippine Republic with the answers it
badly
needs.
Indonesia: A President Befuddled
Abdurrahman Wahid came to power in October 1999 as, in
effect, the
first democratically chosen president after the fall of the long-
ruling dic-
tator Suharto. A charismatic Muslim cleric known for his open-
minded
and inclusive leadership style as head of the moderate, Islamic -
oriented
29. National Awakening Party (PKB), Wahid was the widely
respected com-
promise choice of the People’s Consultative Assembly (MPR),
Indonesia’s
highest deliberative body. On 23 July 2001, barely two years
after elect-
ing him, the MPR dismissed him from office in a process
tantamount to
impeachment.
The first signs of tension surrounding Wahid’s presidency
appeared
early. Wahid headed a government of national unity comprising
all
major parties represented in Indonesia’s parliament, the
People’s Rep-
resentative Assembly (DPR). After only a few months in office,
he
shocked and outraged his coalition partners by firing several
major
cabinet ministers—one from each of three major parties that
were far
larger than Wahid’s own PKB—on unspecified corruption
charges that
were never followed up through the legal process. To make
matters
worse, Wahid installed his own close allies as replacements,
thereby
threatening to upset the delicate party balance in his 36-member
cabi-
net. Tensions spiraled upward, and Wahid’s subsequent
behavior would
only make them worse.
News soon leaked that Wahid had possibly misused state funds
and
30. Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 107
taken a large cash gift from the sultan of Brunei. The MPR
debated the
charges in August 2000, but party leaders, recognizing the
politically
charged climate in the country, decided to shelve the matter in
return
for Wahid’s agreement to enlarge the policy-making role of
Vice-Presi-
dent Megawati Sukarnoputri, who also headed the largest of the
parties
represented in parliament. Wahid made the promised power
transfer, but
kept it on a mostly procedural rather than substantive level.
Then, mis-
takenly thinking that he held the upper hand, he reshuffled his
cabinet
again. Wahid completely shut out Megawati’s party and another
major
party, while limiting the still-formidable old ruling party
(Golkar) plus
another major party to one ministerial post apiece.
The legislature’s response was swift. By January 2001, a special
com-
mittee had dismissed Wahid’s explanations and had officially
found it
“reasonable to believe” that Wahid had been involved in an
improper
state-funds transfer and had made contradictory statements
about the
Brunei money. In April 2001, parliament passed a motion of
31. censure.
Having now alienated all major parties, including the Muslim-
ori-
ented ones, and facing a series of cabinet resignations, Wahid
grew ever
more erratic. He offered more power-sharing proposals to
Megawati even
while lobbing corruption charges at senior figures in Golkar and
Megawati’s own party (including her husband)—all while
backing her
sister in an attempt to split the nationalist base. With Wahid’s
precari-
ous health failing further (he was nearly blind after a series of
strokes),
his last desperate flailings featured numerous additional cabinet
changes
and a shake-up of top military and police ranks as part of a plan
to
engineer a state of emergency that would allow him to dissolve
parlia-
ment. With the armed forces signaling no enthusiasm for this
scheme,
Wahid’s bid to declare a national emergency on 23 July 2001
was cut
short by an adverse Supreme Court decision, the refusal of the
army and
police to take part, and the MPR’s vote to oust Wahid and
replace him
with Megawati, who took the presidential oath of office the
same day.
Wahid, holed up in the presidential palace with supporters
gathering
outside, calmed his partisans and, to his credit, quietly left to
seek medi-
cal help in the United States. The way to a peaceful leadership
32. transition
was clear.
Clearly, President Wahid’s own rash behavior had fueled the
crisis.
Originally praised for his inclusive and tolerant leadership
style, he
became increasingly volatile as his term wore on. His
consultations
with his coalition partners and even his own advisors were often
impul-
sive and incoherent, while his relations with parliamentary
leaders grew
tense. He alienated the vast bulk of Indonesia’s political elite
even as
his frail health was driving him out of touch with day-to-day
political
affairs.
Blaming the crisis solely on Wahid, however, ignores the
context in
which his presidency operated. The 1945 constitution
establishes a presi-
Journal of Democracy108
dential system with twin legislatures, the DPR and the MPR.
The latter,
nominally the supreme sovereign body, was at the time in
charge of
electing the president. This practice has since been scrapped in
favor of
direct popular election with a provision for a runoff between the
top two
33. finishers if no candidate exceeds 50 percent in the first round.
The
constitution, a short document hastily drafted at independence
and lack-
ing any clear separation of powers, was reenacted by President
Sukarno
(Megawati’s father) in 1959 after a brief, volatile period of
parliamen-
tary democracy. Unamended for nearly four decades, it was the
cloudy
basis of an unclear constitutional framework that allowed rulers
like
Sukarno and Suharto to establish centralized authoritarian
structures
which they could then claim were somehow “constitutional.”
Coming to power amid the opening that followed Suharto’s
1998
resignation, Wahid was operating within an institutional
framework
that underlying political events had overtaken. Indonesia held
its first
truly democratic DPR elections in 1999. With more than 48
parties
competing in multimember districts on a closed-list system, the
predict-
able result was a “hung parliament” with no clear majority.
With most
parties both centralized and separated from each other by robust
ideo-
logical differences, stable coalitions were not in the cards.
Moreover,
the Muslim-minded parties, once virtually shut out of the
system, were
now competing under fairer conditions than ever before, and
doing
34. well.8 Under such circumstances, any president would have
found it
fairly hard to keep up broad support in the DPR and to a lesser
extent
the MPR, with its regional delegates and representatives named
directly
by the army (another practice since abandoned).
With no clear constitutional separation of powers, the
legislative
and the executive each tried to gain power at the other’s
expense. More-
over, Indonesia—unlike the other three countries—lacked an
exclusive
arbiter in constitutional matters such as a constitutional court to
help
settle conflicts between institutions. On top of this, the decision
to
switch to direct popular election of the president dated from
before
Wahid’s 1999 accession, meaning that party leaders had an
incentive to
jockey for position early, perhaps by facing down the
incumbent. In-
deed, Wahid’s cabinet firings and hirings may have been aimed
at
weeding out potential rivals while gaining access to
contributions for
his 2004 campaign chest.9
Perhaps a calmer if not more skillful politician than Wahid
would
have managed to stay in power despite these systemic flaws—
the more
placid Megawati did so for three years until the voters unseated
her in a
35. regular election. Indonesia is riven by ethnic, religious, and
regional
cleavages that press constantly on its political institutions and it
is
surprising how stable these institutions remained under Wahid’s
troubled
rule. While Wahid’s own blunders bear no small share of the
blame for
his fall, it is also true that the complicated and shifting
institutional
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 109
landscape which he inherited left him with little room for error.
Once
his poor decisions cut him off from the kind of major-party
support that
that he needed in Indonesia’s quasi-parliamentary system, the
drop was
very steep and he was effectively finished.
Triggered by Wahid’s impeachment, several substantial
constitu-
tional amendments have brought Indonesia a directly elected
president,
changes to the electoral process, more regional autonomy, and a
consti-
tutional court. The number of parties competing for
parliamentary seats
has decreased, and the electorate has—surprisingly for many
observ-
ers—tended to vote for centrist candidates. Though all this may
enhance
political stability and prevent major crisis in the future, given
36. the now
more pronounced dual-legitimacy problem in the modified
presidential
system, it remains to be seen whether presidential crises are
completely
an issue of the past.
South Korea: A Court Ascendant
Roh Moo Hyun’s December 2002 victory marked the second
time
since 1997 that a left-wing opposition leader had been elected
presi-
dent of South Korea (the first had been Kim Dae Jung). Roh at
first
lacked a legislative majority to carry out his program, and as
conflict
escalated with his main rivals in the Grand National Party
(GNP), his
approval ratings plummeted. Fifteen months after Roh’s
election, his
own Millennium Democratic Party (MDP) joined forces with the
GNP
and made him the first president that South Korea’s National
Assembly
had ever voted to impeach.
A little less than three months later, in mid-May 2004, South
Korea’s
Constitutional Court ruled that Roh could keep his office. In the
mean-
time, his foes had learned the hard way that they had overplayed
their
hand: The voters, having formed an unfavorable view of the
impeach-
ment push, had gone to the polls for prescheduled elections in
37. mid-April
and had given Roh’s new Uri Party (UP) a narrow legislative
majority.
The Korean system survived this turmoil and in the end
produced a
result that was both constitutionally and democratically
legitimate. But
there was substantial instability in the meantime, and it
amplified Korea’s
existing social cleavages in way that may encourage future
political
conflict.
Roh’s election had been unforeseen by pollsters and came as a
great
shock. Perhaps among those most surprised was the winner
himself, who
seemed unready for the burdens of national leadership. Roh was
a self-
made lawyer who had never gone to college because his parents
were too
poor. His opponent, Lee Hoi Chang of the GNP, was a former
high-court
justice and prime minister who had graduated from the best
university in
South Korea. Signs of tension surfaced immediately after the
election,
with GNP leader Choi Byong Ryol publicly rejecting Roh’s
legitimacy
Journal of Democracy110
and talking of ousting him. The GNP held a solid legislative
majority and
38. in September 2003 successfully pressed Roh to fire a cabinet
minister.
Roh’s popularity fell and the smell of a failed presidency was in
the air.
Under the Republic of Korea’s constitution, impeachment
requires
the vote of a two-thirds majority of the National Assembly. The
GNP
lacked that many votes, so the move became a live possibility
only in
early September 2003, when the MDP split into factions for and
against
Roh. The group loyal to Roh became the UP, but it had only 44
seats—
not enough to block an impeachment. In response, Roh
suggested
holding a referendum on his presidency, in effect trying to
engineer a
presidential version of the parliamentary practice of a
confidence vote.
The constitution carefully spells out the conditions under which
a refer-
endum may go forward, however, and as no such conditions
applied in
this case, Roh’s proposal went nowhere.
Two months later, more than two-thirds of the National
Assembly voted
to establish an independent-counsel’s office to probe corruption
charges
involving President Roh’s entourage. Roh vetoed this move, but
in De-
cember an even larger majority overrode him (after a nearly
ninety-day
investigation, little would come of these charges). On 24
39. February 2004,
Roh made a televised remark that opposition leaders said was in
violation
of the election law and the constitution. Roh refused to retract
or apolo-
gize, and said that he would let the people decide the matter via
the
legislative balloting already set for mid-April. Impeachment
came on
March 12 by a vote of 193 to 2, with nearly all Roh supporters
abstaining.
In presidential systems, impeachment is meant to be used
infrequently
to correct grave abuses by the executive, and not as a routine
means of
unseating presidents. There is evidence that Roh’s opponents
were using
it in the latter fashion. He had deeply upset conservatives by
saying that
he might adopt a policy of anti-Americanism, as if seeking to
ride the
wave of anti-Americanism and Korean nationalism among
younger vot-
ers.10 In the eyes of business interests and the old guard within
the existing
political parties, Roh’s remark about the United States in
conjunction
with his past as a labor-rights lawyer and dissident represented
a grave
danger to Korea’s international security and domestic political
order.
Enveloping these ideological splits was a climate of personal
antago-
nism between President Roh and opposition leaders. The anti -
40. Roh faction
in the MDP consisted of the former party mainstream, now
resentful of
the president’s recent rise. The GNP epitomized the
establishment that
had ruled for decades before Kim Dae Jung. Roh, in other
words, was the
consummate outsider. He had run and lost repeatedly in races
for the
National Assembly seat representing his far-southeastern
hometown of
Pusan, knowing that as long as he refused to pay court to
regional pa-
trons, his chances of winning were near zero. He thus
symbolized the
“underdog” mentality within the strongly regional politics of
South
Korea.
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 111
In many respects, the impeachment of Roh resembled the
impeachment
of U.S. president Andrew Johnson in 1868: The grounds for
impeachment
cited in the resolution seemed strained at best, if not simply
false.11 Ac-
cording to the resolution, Roh had neglected his obligation to be
neutral
on political matters when he publicly supported the Uri Party,12
and had
disregarded his obligation to protect law and order when he
publicly
rejected as unfair the National Election Commission’s
41. reprimand.13 The
Constitutional Court would later rule these charges “not
sufficient”—
even if true—to warrant the removal of a duly elected president.
In impeaching Roh, the opposition had miscalculated badly.
Citi-
zens weighed the charges and found them wanting. As voters in
April,
these same citizens stripped the GNP of its majority, reduced
the MDP
to fewer than a dozen seats, and tripled the size of the UP’s
National
Assembly delegation.
South Korea’s political system, instead of bridging political
con-
flicts arising from the country’s pronounced regional and class
divisions,
tends to widen them. For example, the first-past-the-post
electoral sys-
tem for the National Assembly overrepresents certain populous
provinces
in the central government, while underrepresenting social
interests such
as the labor and environmentalist movements. Strong party
discipline
exacerbates conflicts by making it hard for presidents to reach
across
party lines to individual lawmakers for the sake of gathering
“issue
coalitions” behind specific policies.14
As in some other countries, the single, five-year term of a
Korean presi-
dent removes the prospect of reelection as an accountability
42. mechanism
and puts a huge premium on constantly maintaining a
stratospheric level
of popular support. To hold the president accountable, voters
can only
punish his party in the next election, which of course increases
the likeli-
hood of divided government. More importantly, the one-term
limit tempts
presidents to excessive haste in their efforts to deliver on
election pledges.
In the end, the real winner may have been neither Roh nor his
Uri
Party, but rather the Constitutional Court. By resolving the
standoff
between the president and the legislature, the Court effectively
raised
its own stature above that of either the presidency or the
National As-
sembly. The Court’s nine justices took center stage and bestrode
the
political world as millions of their fellow citizens looked to
them to
decide a grave national issue. If nothing else, South Korea’s
voters
learned that institutions matter. This lesson from the school of
crisis
suggests that future debates on constitutional reform in South
Korea
will draw close and careful attention from her people.
Taiwan: A President Wounded
President Chen Shui-bian came to power in March 2000, ending
the
43. 55-year rule of the Nationalist Party (Kuomintang or KMT) in
Taiwan.
Journal of Democracy112
Like Roh, Chen was a lawyer and former regime opponent. He
began his
political career in 1980 when he defended eight anti -KMT
demonstra-
tors in court. The son of poor tenant farmers, he worked his way
up
through Taiwanese society by entering prestigious National
Taiwan
University and succeeding at the law. He became a national
figure with
his 1994 election as mayor of Taipei.
Chen and his Democratic Progressive Party (DPP) have long
advo-
cated Taiwanese independence. This puts them at odds with
both Beijing
(which insists that Taiwan is a province of China) and the KMT
(which
maintains that the island is the seat of the legitimate national
govern-
ment of all China). Chen’s election therefore marked a great
change on
the island—the rise of a new Taiwanese national identity and
assertiveness. Yet Chen’s presidency has been afflicted by many
of the
weaknesses that Linz describes. These include legislative
deadlock,
weak legitimacy due to a minority mandate, and the attempted
use of
44. impeachment to oust a weak and unpopular president. Chen’s
legiti-
macy remains contested, as some opposition leaders have been
refusing
to concede defeat in the March 2004 presidential election.
Like Chile’s Salvador Allende (1970–73), Chen Shui-bian was
origi-
nally a minority president. He won in 2000 only because the
KMT vote
split between Lien Chan and James Soong as the result of a feud
be-
tween Lien and former president Lee Teng-hui. Chen lacked a
parliamentary majority, and found both the KMT and Soong’s
People
First Party (PFP) blocking his program in the Legislative Yuan
(LY). An
early dispute over the building of a fourth nuclear power plant
on the
island led the opposition to attempt Chen’s impeachment, but
that reso-
lution never passed. Chen’s standing as a leader suffered,
however, and
an ailing economy dragged down his popularity. Chen’s refusal
to reaf-
firm a “one China” policy and his increasingly confrontational
attitude
toward Beijing energized his base but polarized the island’s
politics.
The legitimacy of Chen’s presidency faced a more serious
challenge,
however, at the beginning of his second term. On 19 March
2004, the
day before the presidential election, Chen and his vice-
president, Annette
45. Lu, were shot and slightly wounded while leading a motorcade
in Tainan.
Chen won the election by a small margin of 29,518 votes, or
0.22 per-
cent of the total votes cast. Polls had predicted a sli ght
advantage for
the KMT’s Lien Chan. Lien immediately charged that the
shooting had
been an election-eve stunt, staged to gain sympathy votes from
unde-
cided voters who otherwise would have stayed home. The
presence of
337,297 invalidated ballots—representing 2.5 percent of all
ballots cast,
or more than enough to change the outcome —further
exacerbated op-
position suspicions.
On March 21, thousands gathered in Taipei and elsewhere on
the
island to protest the election result. The Central Electoral
Commission
nonetheless declared Chen the winner. The KMT-PFP “Pan-
Blue” alli-
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 113
ance then filed two lawsuits, one asking for the invalidation of
the
election, and the other asking for a recount of the votes. The
Taiwan
High Court dismissed the first suit in November as “lacking
evidence.”
In response to the second lawsuit, the judiciary began
46. recounting bal-
lots on May 10. Chen’s margin fell to 22,000 votes, but he
remained the
winner.
The opposition continued to contest the legitimacy of Chen’s
elec-
tion, however, and to use their LY majority in an effort to
reverse the
verdict. In August 2004, the LY adopted a bill to set up an
independent
body, the March 19 Shooting Truth Investigation Special
Committee,
to look into the election-eve shooting. The Truth Committee
was sup-
posed to be equipped with its own investigative and
prosecutorial
services loaned from the Executive Yuan and controlled by
KMT and
PFP lawmakers. President Chen signed the bill authorizing the
Truth
Committee in September, but refused to execute the legislation.
DPP
lawmakers asked the Court to judge the constitutionality of the
Truth
Committee. In December 2004, the Court ruled certain core
provisions
of the Truth Committee statute unconstitutional.
Each of Chen’s terms has borne the mark of a legitimacy crisis.
The
first stemmed from his minority-winner status, a problem
highlighted
by Linz. The second and odder crisis, stemming from the
shooting con-
troversy, could of course also have occurred in a parliamentary
47. system.
What could not have happened in a parliamentary system,
however, was
the attempt by the opposition parties to keep the legitimacy
challenge
alive through their control of a majority in the legislature. In
the LY
election of 11 December 2004, the Pan-Blue alliance retained
its major-
ity and therewith its ability to prolong the deadlock. The lack of
synchronization between the presidential and legislative
electoral cycles
makes matters worse.
Does Linz’s Critique Apply to the Asian Cases?
How do the four defects of presidentialism that Linz outlines
apply
to these East Asian cases?
Minority presidents. Korea, Taiwan, and Indonesia all elected
presi-
dents who received a minority of the popular vote and whose
legitimacy
the opposition thus questioned. The alleged legitimacy deficit
was the
direct motivation for impeachment efforts. This was not the
case in the
Philippines, where Joseph Estrada received a large popular
mandate.
Rigid terms and difficulty of removal. In each of the four cases,
po-
litical opponents tried to remove a president who had become
unpopular
before his term was over. The weapon in each case was
48. impeachment (or,
in the case of Indonesia, its equivalent). Impeachment barely
got off the
ground in Taiwan; was stopped in Korea by a court ruling;
failed in the
Philippines, yet not in a way that ultimately saved the president
(whose
Journal of Democracy114
removal may have been illegal); and succeeded only in
Indonesia, where
it arguably also fulfilled the function of removing a genuinely
incom-
petent (that is, severely ailing) president.
Policy gridlock. Dual legitimacy pro-
duced situations in which presidents failed
to achieve supportive legislative coalitions
in Indonesia, South Korea, and Taiwan. As
many of Linz’s critics have noted, this out-
c o m e i s o f t e n t h e r e s u l t n o t o f
presidentialism per se but of poorly de-
s i g n e d e l e c t o r a l s y s t e m s . T h i s w a s a
problem in all three cases, and particularly
in Indonesia, where a constitution left over
from authoritarian days left executive-leg-
islative relations severely clouded.
Election of inexperienced outsiders.
This was true in all four cases: It is highly
unlikely that figures such as Estrada, Wahid, Roh, and Chen
could have
49. risen to power in parliamentary systems. The personalization of
politics
is most evident in the Philippines, which has seen popular
actors run in
the last two elections.
The question remains as to whether the problems experienced in
these Asian cases constitute a “crisis” of presidentialism, and if
so,
whether they bolster the general indictment of presidentialism
made by
Linz. It is our view that they do not.
To begin with, all four systems endured and remained
democratic
even in the face of crisis. In these four stories, the military coup
or other
authoritarian backsliding is conspicuous by its absence. Not
only was
there no Pinochet-style military takeover, but democratic
institutions
worked as they were supposed to in Korea, Taiwan, and
Indonesia. In
the first two cases, constitutional courts played a particularly
important
role in diffusing conflict between the executive and legislative
branches.
Even in the Philippines, the Supreme Court defused conflict by
supply-
ing a degree of after-the-fact legitimation to Estrada’s removal.
Indeed, one can argue that the problems experienced by each
coun-
try reflect the immaturity of its democratic system rather than
some
defect of presidentialism as such. This was particularl y true in
50. Indone-
sia, where constitutional rules were in flux as the crisis
unfolded. In
South Korea, Roh’s ultimate vindication makes it unlikely that
the po-
litical opposition will try to use impeachment as a political
weapon any
time in the foreseeable future. A learning process has taken
place.
Finally, the conflicts between Roh, Chen, and Estrada and their
re-
spective opponents reflected real social conflicts in each
country. Each
president represented constituencies that were more left-leaning
or at
least populist than those of the existing establishment. The
winner-
Whether one regards
presidentialism as
good or bad depends
in part on what one
thinks about the need
of democratic politi-
cal systems to
accommodate rapid
political change.
Francis Fukuyama, Björn Dressel, and Boo-Seung Chang 115
take-all nature of presidential systems often amplifies rather
than mutes
structural dissonances, thereby making faster political change
51. possible.
The politics of South Korea and Taiwan are utterly differ ent
today than
they were a decade ago, and it is doubtful that this would have
hap-
pened had they possessed Japanese-style parliamentary systems,
where
delay and accommodation, rather than dispatch and tension, are
the
order of the day. The Philippines was ripe for a similar shift,
but estab-
lished elites blocked change by going outside the institutional
framework. Whether one regards presidentialism as good or bad
thus
depends in part on what one thinks about the need of democratic
politi-
cal systems to accommodate rapid political change.
Juan Linz wrote his critique of presidentialism at the end of a
period in
which militaries in many developing countries had come to
regard them-
selves as guardians of stability, and had intervened to prevent
the sort of
rapid political change that presidentialism facilitates. Today,
there are
much stronger norms against overt military intervention—
though it is
interesting to note that the refusal of the military to help the
sitting
president get his way was a major factor in both the Philippines
and
Indonesia. In these four Asian cases, one can make the argument
that
constitutional courts are doing in a gentler way something like
what
52. militaries used to do in a much rougher fashion when presidents
and
legislatures simply could not get along. Presidential systems
have not
two but three branches; whether judiciaries come to play critical
mediat-
ing roles on a consistent basis will bear careful watching.
NOTES
1. Juan J. Linz, “The Perils of Presidentialism,” Journal of
Democracy 1 (Win-
ter 1990): 51–69.
2. Donald L. Horowitz, “Comparing Democratic Systems,” Guy
Lardeyret,
“The Problem with PR,” and Arend Lijphart, “Constitutional
Choices for New
Democracies,” in Larry Diamond and Marc F. Plattner, eds.,
The Global Resur-
gence of Democracy 2 nd ed. (Baltimore: Johns Hopkins
University Press, 1996);
Matthew S. Shugart and John M. Carey, Presidents and
Assemblies: Constitutional
Design and Electoral Dynamics (Cambridge: Cambridge
University Press, 1992);
Scott Mainwaring and Matthew S. Shugart, Presidentialism and
Democracy in
Latin America (Cambridge: Cambridge University Press, 1997).
3. Carl H. Landé, “The Return of ‘People Power’ in the
Philippines,” Journal of
Democracy 12 (April 2001): 88–102.
4. The decision, while unanimous, reveals some of the legal
problems sur-
53. rounding Estrada’s fall from power. Three justices held it to be
a case of resignation,
three accepted Macapagal-Arroyo’s presidency as an
irreversible fact, two ruled
Estrada permanently disabled, and the largest group—five—
simply signed the
ruling without expressing any opinion.
5. Yvonne T. Chua and Sheila S. Coronel, eds., The PCIJ Guide
to Government
(Manila: Philippine Center for Investigative Journalism, 2003).
Journal of Democracy116
6. Alexander R. Magno, “Philippines: Trauma of a Failed
Presidency,” South-
east Asian Affairs (May 2001): 251–63.
7. Steven Rogers, “Philippine Politics and the Rule of Law,”
Journal of Democ-
racy 15 (October 2004): 111–25.
8. See Robert W. Hefner, Civil Islam: Muslims and
Democratization in Indone-
sia (Princeton: Princeton University Press, 2000); Greg Fealy,
“Islamic Politics: A
Rising or Declining Force?” revised version of a paper
presented at a conference
on “Rethinking Indonesia,” Melbourne, Australia, 4–5 March
2000; R. William
Liddle, “The Islamic Turn in Indonesia: A Political
Explanation,” Journal of Asian
Studies 55 (August 1996): 613–34; and Martin van Bruinessen,
“Genealogies of
54. Islamic Radicalism in Post-Suharto Indonesia,” Southeast Asia
Research 10 (July
2 0 0 2 ) : 1 1 7 – 5 4 .
9. R. William Liddle, “Indonesia in 2000: A Shaky Start for
Democracy,” Asian
Survey 41 (January–February 2001): 208–20.
10. Various survey results show that anti-Americanism is one of
the most im-
portant sources of the recent political polarization in South
Korea. See Sook Jong
Lee, The Transformation of South Korean Politics: Implications
for U.S.-Korea
Relations (Washington, D.C.: Brookings Institution, 2004).
11. For a brief review of Andrew Johnson’s impeachment, see
John Bowman,
History of the American Presidency (North Dighton, Mass.:
World Publications,
2002), 78.
12. Roh’s controversial 24 February 2004 remark, made during
a televised
discussion program, was as follows: “I expect that people will
overwhelmingly
support [the Uri Party] in the general election in April.”
13. On 3 March 2004, the NEC found that Roh’s 24 February
2004 remark
violated a provision of Korean electoral law which requires that
all public employ-
ees except national and local assemblymen remain neutral in
election campaigns.
The Commission sent Roh a letter urging him to abide by his
legal duty of neutral-
55. ity. Officials in the president’s office (not Roh himself)
objected, citing the open
and active electioneering typical of U.S. presidents.
14. Strong party discipline is of course not always a liability; in
many develop-
ing countries its absence makes it difficult for presidents to pass
unpopular agendas.
Ph.D. Program in Political Science of the City University of
New York is collaborating with JSTOR to digitize, preserve
and extend access to Comparative Politics.
http://www.jstor.org
Juan Linz, Presidentialism, and Democracy: A Critical
Appraisal
Author(s): Scott Mainwaring and Matthew S. Shugart
Source: Comparative Politics, Vol. 29, No. 4 (Jul., 1997), pp.
449-471
Published by: Ph.D. Program in Political Science of the City
University of New York
Stable URL: http://www.jstor.org/stable/422014
Accessed: 22-03-2015 17:27 UTC
Your use of the JSTOR archive indicates your acceptance of the
Terms & Conditions of Use, available at
http://www.jstor.org/page/info/about/policies/terms.jsp
JSTOR is a not-for-profit service that helps scholars,
researchers, and students discover, use, and build upon a wide
range of content
in a trusted digital archive. We use information technology and
56. tools to increase productivity and facilitate new forms of
scholarship.
For more information about JSTOR, please contact
[email protected]
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org
http://www.jstor.org/action/showPublisher?publisherCode=phd
http://www.jstor.org/stable/422014
http://www.jstor.org/page/info/about/policies/terms.jsp
http://www.jstor.org/page/info/about/policies/terms.jsp
Juan Linz, Presidentialism, and Democracy
A Critical Appraisal
Scott Mainwaring and Matthew S. Shugart
Since the 1960s Juan J. Linz has been one of the world's
foremost contributors to
our understanding of democracy, authoritarianism, and
totalitarianism. Although
many of his contributions have had a significant impact, few
have been as far-
reaching as his essay "Presidential or Parliamentary Democracy:
Does It Make a
Difference?," originally written in 1985. The essay argued that
presidentialism is
less likely than parliamentarism to sustain stable democratic
regimes. It became a
classic even in unpublished form. Among both policymakers
and scholars it
57. spawned a broad debate about the merits and especially the
liabilities of presidential
government. Now that the definitive version of the essay has
appeared, we believe
that a critical appraisal is timely. This task is especially
important because Linz's
arguments against presidentialism have gained widespread
currency.
This article critically assesses Linz's arguments about the perils
of presidential-
ism. Although we agree with several of Linz's criticisms of
presidentialism, we dis-
agree that presidentialism is particularly oriented towards
winner-takes-all results.'
We argue that the superior record of parliamentary systems has
rested partly on
where parliamentary government has been implemented, and we
claim that presi-
dentialism has some advantages that partially offset its
drawbacks. These advantages
can be maximized by paying careful attention to differences
among presidential sys-
tems. Other things being equal, presidentialism tends to
function better where pres-
idencies have weak legislative powers, parties are at least
moderately disciplined,
and party systems are not highly fragmented. Finally, we argue
that switching from
presidentialism to parliamentarism could exacerbate problems
of governability in
countries with undisciplined parties. Even if parliamentary
government is more con-
58. ducive to stable democracy, much rests on what kind of
parliamentarism and presi-
dentialism is implemented.2
By presidentialism we mean a regime in which, first, the
president is always the
chief executive and is elected by popular vote or, as in the U.S.,
by an electoral col-
lege with essentially no autonomy with respect to popular
preferences and, second,
the terms of office for the president and the assembly are fixed.
Under pure presi-
dentialism the president has the right to retain ministers of his
or her choosing
regardless of the composition of the congress.
449
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Comparative Politics July 1997
The Perils of Presidentialism: Linz's Argument
Linz bases his argument about the superiority of parliamentary
systems partially on
the observation that few long established democracies have
presidential systems. He
maintains that the superior historical performance of
parliamentary democracies
stems from intrinsic defects of presidentialism. He analyzes
59. several problems of
presidential systems. We briefly summarize the five most
important issues.
First, in presidential systems the president and assembly have
competing claims
to legitimacy. Both are popularly elected, and the origin and
survival of each are
independent from the other.3 Since both the president and
legislature "derive their
power from the vote of the people in a free competition among
well-defined alter-
natives, a conflict is always latent and sometimes likely to erupt
dramatically; there
is no democratic principle to resolve it."4 Linz argues that
parliamentarism obviates
this problem because the executive is not independent of the
assembly. If the major-
ity of the assembly favors a change in policy direction, it can
replace the government
by exercising its no confidence vote.
Second, the fixed term of the president's office introduces a
rigidity that is less
favorable to democracy than the flexibility offered by
parliamentary systems, where
governments depend on the ongoing confidence of the assembly.
Presidentialism
"entails a rigidity . .. that makes adjustment to changing
situations extremely diffi-
cult; a leader who has lost the confidence of his own party or
the parties that ac-
quiesced [in] his election cannot be replaced."' By virtue of
their greater ability to
promote changes in the cabinet and government, parliamentary
systems afford
60. greater opportunities to resolve disputes. Such a safety valve
may enhance regime
stability.
Third, presidentialism "introduces a strong element of zero-sum
game into demo-
cratic politics with rules that tend toward a 'winner-take-all'
outcome." In contrast,
in parliamentary systems "power-sharing and coalition-forming
are fairly common,
and incumbents are accordingly attentive to the demands and
interests of even the
smaller parties." In presidential systems direct popular election
is likely to imbue
presidents with a feeling that they need not undertake the
tedious process of con-
structing coalitions and making concessions to the opposition.6
Fourth, the style of presidential politics is less propitious for
democracy than the
style of parliamentary politics. The sense of being the
representative of the entire
nation may lead the president to be intolerant of the opposition.
"The feeling of hav-
ing independent power, a mandate from the people ... is likely
to give a president
a sense of power and mission that might be out of proportion to
the limited plurality
that elected him. This in turn might make resistances he
encounters ... more frus-
trating, demoralizing, or irritating than resistances usually are
for a prime minister.7
The absence in presidential systems of a monarch or a
"president of the republic"
deprives them of an authority who can exercise restraining
power.
61. 450
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Scott Mainwaring and Matthew J. Shugart
Finally, political outsiders are more likely to win the chief
executive office in
presidential systems, with potentially destabilizing effects.
Individuals elected by
direct popular vote are less dependent on and less beholden to
political parties. Such
individuals are more likely to govern in a populist,
antiinstitutionalist fashion.
A Critique of Linz's Argument
We agree with the main thrust of four of Linz's five basic
criticisms of presidential-
ism. We concur that the issue of dual legitimacy is nettlesome
in presidential sys-
tems, but we believe that his contrast between presidential and
parliamentary sys-
tems is too stark. To a lesser degree than in presidential
systems, conflicting claims
to legitimacy also exist in parliamentary systems. Conflicts
sometimes arise between
the lower and upper houses of a bicameral legislature, each
claiming to exercise
legitimate power. If both houses have the power of confidence
62. over the cabinet, the
most likely outcome when the houses are controlled by different
majorities is a com-
promise coalition cabinet. In this case dual legitimacy exists,
not between executive
and assembly, but between the two chambers of the assembly.
This arrangement
could be troublesome if the two chambers were controlled by
opposed parties or
blocs. In a few parliamentary systems, including Canada,
Germany, and Japan,
upper houses have significant powers over legislation but can
not exercise a vote of
no confidence against the government. In some the upper house
can not be dissolved
by the government. Then, there is a genuine dual legitimacy
between the executive
and part of the legislature. Thus, dual democratic legitimacy is
not exclusively a
problem of presidentialism, though it is more pronounced with
it. A unicameral par-
liament would avoid the potential of dual legitimacy under
parliamentarism, but it
sacrifices the advantages of bicameralism, especially for large,
federal, and plural
countries.8
Another overlooked potential source of conflicting legitimacy in
parliamentary
republics is the role of the head of state, who is usually called
"president" but tends
to be elected by parliament. The constitutions of parliamentary
republics usually
give the president several powers that are - or may be, subject
to constitutional
interpretation - more than ceremonial. Examples include the
63. president's exclusive
discretion to dissolve parliament (Italy), the requirement of
countersignatures of
cabinet decrees (Italy), suspensory veto over legislation (Czech
Republic, Slovakia),
the power to decree new laws (Greece for some time after
1975), and appointments
to high offices, sometimes (as in the Czech Republic and
Slovakia) including min-
istries. Linz argues that the president in such systems "can play
the role of adviser
or arbiter by bringing party leaders together and facilitating the
flow of information
among them." He also notes that "no one in a presidential
system is institutionally
entitled to such a role." He is quite right that political systems
often face moments
451
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Comparative Politics July 1997
when they need a "neutral" arbiter. However, for the position of
head of state to be
more than feckless it is necessary to make it "institutionally
entitled" to other tasks
as well. Linz correctly notes that, "if presidents in pure
parliamentary republics were
irrelevant, it would not make sense for politicians to put so
64. much effort into electing
their preferred candidate to the office."'
Paradoxically, the more authority the head of state is given, the
greater is the
potential for conflict, especially in newer democracies where
roles have not yet been
clearly defined by precedent. Hungary and especially Slovakia
have had several con-
stitutional crises involving the head of state, and in some Third
World parliamentary
republics such crises have at times been regime-threatening, as
in Somalia
(1961-68) and Pakistan. Politicians indeed care who holds the
office, precisely
because it has potential for applying brakes to the parliamentary
majority. The office
of the presidency may not be democratically legitimated via
popular election, but it
typically has a fixed term of office and a longer term than the
parliament's By prais-
ing the potential of the office in serving as arbiter, Linz
implicitly acknowledges the
Madisonian point that placing unchecked power in the hands of
the assembly major-
ity is not necessarily good. Again, the key is careful attention to
the distribution of
powers among the different political players who are involved
in initiating or block-
ing policy.
We also agree that the rigidity of presidentialism, created by the
fixed term of
office, can be a liability, sometimes a serious one. With the
fixed term it is difficult
to get rid of unpopular or inept presidents without the system's
65. breaking down, and
it is constitutionally barred in many countries to reelect a good
president. However,
there is no reason why a presidential system must prohibit
reelection. Provisions
against reelection have been introduced primarily to reduce the
president's incen-
tives to abuse executive powers to secure reelection. Despite the
potential for abuse,
reelection can be permitted, and we believe it should be in
countries where reliable
institutions safeguard elections from egregious manipulation by
incumbents.
Even if reelection is permitted, we are still left with the rigidity
of fixed term
lengths. One way of mitigating this problem is to shorten the
presidential term so
that if presidents lose support dramatically, they will not be in
office for as long a
time. Therefore, we believe that a four year term is usually
preferable to the longer
mandates that are common in Latin America.
The argument about the flexibility of replacing cabinets in
parliamentary systems
is two-edged. In a parliamentary system the prime minister's
party can replace its
leader or a coalition partner can withdraw its support and usher
in a change of gov-
ernment short of the coup that might be the only way to remove
a president who
lacks support. We agree with Linz that cabinet instability need
not lead to regime
instability and can offer a safety valve. Yet crises in many
failed parliamentary sys-
66. tems, including Somalia and Thailand, have come about
precisely because of the dif-
ficulty of sustaining viable cabinets. Presidentialism raises the
threshold for remov-
452
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Scott Mainwaring and Matthew J. Shugart
ing an executive; opponents must either wait out the term or
else countenance
undemocratic rule. There may be cases when this higher
threshold for government
change is desirable, as it could provide more predictability and
stability to the poli-
cymaking process than the frequent dismantling and
reconstructing of cabinets that
afflict some parliamentary systems.
Theoretically, the problem of fixed terms could be remedied
without adopting
parliamentarism by permitting under certain conditions the
calling of early elections.
One way is to allow either the head of government or the
assembly majority to
demand early elections for both branches, as is the case under
newly adopted Israeli
rules. Such provisions represent a deviation from
presidentialism, which is defined
67. by its fixed terms. Nevertheless, as long as one branch can not
dismiss the other
without standing for reelection itself, the principle of separation
of powers is still
retained to an extent not present in any variant of
parliamentarism.
We take issue with Linz's assertion that presidentialism induces
more of a winner-
takes-all approach to politics than does parliamentarism. As we
see it, parliamentary
systems do not afford an advantage on this point. The degree to
which democracies
promote winner-take-all rules depends mostly on the electoral
and party system and
on the federal or unitary nature of the system. Parliamentary
systems with disci-
plined parties and a majority party offer the fewest checks on
executive power, and
hence promote a winner-takes-all approach more than
presidential systems.'0 In
Great Britain, for example, in the last two decades a party has
often won a decisive
majority of parliamentary seats despite winning well under 50
percent of the votes.
Notwithstanding its lack of a decisive margin in popular votes,
the party can control
the entire executive and the legislature for a protracted period
of time. It can even
use its dissolution power strategically to renew its mandate for
another five years by
calling a new election before its current term ends.
Because of the combination of disciplined parties, single
member plurality elec-
toral districts, and the prime minister's ability to dissolve the
68. parliament,
Westminster systems provide a very weak legislative check on
the premier. In prin-
ciple, the MPs of the governing party control the cabinet, but in
practice they usual-
ly support their own party's legislative initiatives regardless of
the merits of partic-
ular proposals because their electoral fates are closely tied with
that of the party
leadership. As a norm, a disciplined majority party leaves the
executive virtually
unconstrained between elections." Here, more than in any
presidential system, the
winner takes all. Given the majority of a single party in
parliament, it is unlikely that
a no confidence vote would prevail, so there is little or no
opposition to check the
government. Early elections occur not as a flexible mechanism
to rid the country of
an ineffective government, but at the discretion of a ruling
majority using its disso-
lution power strategically to renew its mandate for another five
years by calling a
new election before its current term ends.12
Presidentialism is predicated upon a system of checks and
balances. Such checks
453
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
69. Comparative Politics July 1997
and balances usually inhibit winner-takes-all tendencies;
indeed, they are designed
precisely to limit the possibility that the winner would take all.
If it loses the presi-
dency, a party or coalition may still control congress, allowing
it to block some pres-
idential initiatives. If the president's own legislative powers are
reactive only (a
veto, but no decree powers), an opposition-controlled congress
can be the prime
mover in legislating, as it is in the United States and Costa
Rica, the two longest
standing presidential democracies. Controlling congress is not
the biggest prize, and
it usually does not enable a party or coalition to dictate policy,
but it allows the party
or coalition to establish parameters within which policy is
made. It can be a big prize
in its own right if the presidency has relatively weak legislative
powers.
Moreover, compared to Westminster parliamentary systems,
most presidential
democracies offer greater prospects of dividing the cabinet
among several parties.
This practice, which is essentially unknown among the
Westminster parliamentary
democracies, is common in multiparty presidential systems. To
get elected, presi-
dents need to assemble a broad interparty coalition, either for
the first round (if a
plurality format obtains) or for the second (if a two round,
absolute majority format
70. obtains). Generally, presidents allocate cabinet seats to parties
other than their own
in order to attract the support of these parties or, after elections,
to reward them for
such support. Dividing the cabinet in this manner allows losers
in the presidential
contest a piece of the pie. The norm in multiparty presidenti al
systems is similar to
that in multiparty parliamentary systems: a coalition governs,
cabinet positions are
divided among several parties, and the president typically must
retain the support of
these parties to govern effectively.
Thus, most parliamentary systems with single member district
electoral systems
have stronger winner-takes-all mechanisms than presidential
systems. The combi-
nation of parliamentarism and a majority party specifically
produces winner-takes-
all results. This situation of extreme majoritarianism under
parliamentarism is not
uncommon; it is found throughout the Caribbean and some parts
of the Third World.
In fact, outside western Europe all parliamentary systems that
have been continu-
ously democratic from 1972 to 1994 have been based on the
Westminster model (see
Table 1). Thus, Linz is not right when he states that an absolute
majority of seats for
one party does not occur often in parliamentary systems.'3 In
presidential systems
with single member plurality districts, the party that does not
win the presidency can
control congress, thereby providing an important check on
executive power.
71. Linz's fourth argument, that the style of presidential politics is
less favorable to
democracy than the style of parliamentar y politics, rests in part
on his view that pres-
identialism induces a winner-takes-all logic. We have already
expressed our skepti-
cism about this claim. We agree that the predominant style of
politics differs some-
what between presidential and parliamentary systems, but we
would place greater
emphasis on differences of style that stem from constitutional
design and the nature
of the party system.
454
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Scott Mainwaring and Matthew J. Shugart
Table 1 Independent Countries That Were Continuously
Democratic, 1972-1994
Inc. level Pop. size Parliamentary Presidential Other
Low/lower- Micro
middle
Small Jamaica Costa Rica
Mauritius
72. Medium/ Colombia
Large Dominican Republic
Upper- Micro Nauru
middle Barbados
Malta
Small Botswana
Trinidad and Tobago
Medium/ Venezuela
Large
Upper Micro Luxembourg Iceland
Small Ireland Cyprus
New Zealand
Norway
Medium/ Australia United States Austria
Large Belgium Finland
Canada France
Denmark Switzerland
Germany
Israel
Italy
Japan
Netherlands
Sweden
United Kingdom
All regimes in the "other" column are premier-presidential,
except for Switzerland.
73. Countries that have become independent from Britain or a
British Commonwealth state since
1945: Jamaica, Mauritius, Nauru, Barbados, Malta, Botswana,
Trinidad and Tobago, Cyprus,
Israel
455
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Comparative Politics July 1997
Finally, we agree with Linz that presidentialism is more
conducive than parlia-
mentarism to the election of a political outsider as head of
government and that this
process can entail serious problems. But in presidential
democracies that have more
institutionalized party systems the election of politi cal outsiders
is the exception.
Costa Rica, Uruguay, Colombia, and Venezuela have not elected
an outsider presi-
dent in recent decades, unless one counts Rafael Caldera of
Venezuela in his latest
incarnation (1993). Argentina last elected an outsider president
in 1945, when Per6n
had not yet built a party. In Chile political outsiders won the
presidential campaigns
of 1952 and 1958, but they were exceptions rather than the
norm. The most notable
74. recent cases of elections of political outsiders, Fernando Collor
de Mello in Brazil
(1989) and Alberto Fujimori in Peru (1990), owe much to the
unraveling of the party
systems in both countries and in Fujimori's case also to the
majority run-off system
that encouraged widespread party system fragmentation in the
first round.
Assessing the Record of Presidentialism
Linz correctly states that most long established democracies
have parliamentary sys-
tems. Presidentialism is poorly represented among long
established democracies.
This fact is apparent in Table 1, which lists countries that have
a long, continuous
democratic record according to the criteria of Freedom House.
Freedom House has been rating countries on a scale of 1 to 7
(with 1 being best)
on political rights and civil rights since 1972. Table 1 lists all
thirty-three countries
that were continuously democratic from 1972 to 1994. We
considered a country con-
tinuously democratic if it had an average score of 3 or better on
political rights
throughout this period.14 Additionally, the scores for both
political and civil rights
needed to be 4 or better in every annual Freedom House survey
for a country to be
considered continuously democratic.
Of the thirty-three long established democracies, only six are
presidential despite
the prevalence of presidentialism in many parts of the globe.
75. Twenty-two are par-
liamentary, and five fall into the "other" category. However, the
superior record of
parliamentarism is in part an artifact of where it has been
implemented.
Table 1 provides information on three other issues that may
play a role in a so-
ciety's likelihood of sustaining democracy: income level,
population size, and
British colonial heritage. It is widely recognized that a
relatively high income level
is an important background condition for democracy.'" In
classifying countries by
income levels, we followed the guidelines of the World Bank's
World Development
Report 1993: low is under $635 per capita GNP; lower middle is
$636 to $2,555;
upper middle is $2,556 to $7,,910; and upper is above $7,911.
We collapsed the
bottom two categories. Table 2 summarizes the income
categories of countries in
Table 1.
456
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Scott Mainwaring and Matthew J. Shugart
Table 2 Income Levels of Continuous Democracies, 1972-1994
76. (number of countries in each
category)
Per Capita GNP in US $ Parliamentary Presidential Other
0-2555 2 3 0
2556-7910 5 1 0
over 7911 15 2 5
total 22 6 5
Most of these long established democracies (twenty-eight of
thirty-three) are in
upper middle or upper income countries. But among the low to
lower middle income
countries there are actually more presidential (three) than
parliamentary (two) sys-
tems. Fifteen of the parliamentary democracies are found in
Europe or other high
income countries such as Canada, Israel, and Japan. It is likely
that these countries
would have been democratic between 1972 and 1994 had they
had presidential con-
stitutions. So some of the success of parliamentary democracy
is accidental: in part
because of the evolution of constitutional monarchies into
democracies, the region
of the world that democratized and industrialized first is
overwhelmingly populated
with parliamentary systems.
Very small countries may have an advantage in democratic
stability because they
typically have relatively homogeneous populations in ethnic,
religious, and linguis-
tic terms, thereby attenuating potential sources of political
conflict. We classified
77. countries as micro (population under 500,000), small (500,000
to 5,000,000), and
medium to large (over 5,000,000), using 1994 population data.
Table 3 groups our
thirty-three long established democracies by population size.
Here, too, parliamen-
tary systems enjoy an advantage. None of the five micronations
with long estab-
lished democracies has a presidential system.
The strong correlation between British colonial heritage and
democracy has been
widely recognized. Reasons for this association need not
concern us here, but possi-
bilities mentioned in the literature include the tendency to train
civil servants, the gov-
ernmental practices and institutions (which include but can not
be reduced to parlia-
mentarism) created by the British, and the lack of control of
local landed elites over
Table 3 Population Size of Continuous Democracies, 1972-1994
(number of countries in
each category)
Population Parliamentary Presidential Other
Under 500,000 4 0 1
500,000 to 5,000,000 7 2 0
Over 5,000,000 11 4 5
total 22 6 5
457
This content downloaded from 128.235.251.160 on Sun, 22 Mar
78. 2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Comparative Politics July 1997
the colonial state.16 Nine of the thirty-three long established
democracies had British
colonial experience. Among them, eight are parliamentary and
one is presidential.
Here, too, background conditions have been more favorable to
parliamentary systems.
It is not our purpose here to analyze the contributions of these
factors to democ-
racy; rather, we wanted to see if these factors correlated with
regime type. If a back-
Table 4 Independent Countries That Were Democratic for at
Least Ten Years (But Less Than
Twenty-three) as of 1994
Inc. level Pop. size Parliamentary Presidential Other
Low/lower- Micro Belize (1981)
middle Dominica (1978)
Kiribati (1979)
St. Lucia (1979)
St. Vincent (1979)
Solomons (1978)
Tuvalu (1978)
Vanuatu (1980)
79. Small Papua New Guinea
(1975)
Medium/ India (1979) Bolivia (1982)
Large Brazil (1985)
Ecuador (1979)
El Salvador (1985)
Honduras (1980)
Middle Micro Antigua and Barbuda
(1981)
Grenada (1985)
St. Kitts-Nevis
(1983)
Small
Medium/ Greece (1974) Argentina (1983) Portugal' (1976)
Large Uruguary (1985)
Upper Micro Bahamas (1973)
Small
Medium/ Spain (1977)
Large
Numbers in parentheses give the date when the transition to
democracy took place or the date
of independence for former colonies that were not independent
as of 1972.
Note: 1. Portugal has a premier-presidential system
Countries that have become independent from Britain or a
British Commonwealth state since
80. 1945: Belize, Dominica, Kiribati, St. Lucia, St. Vincent,
Solomons, Tuvalu, Vanuatu, Papua
New Guinea, India, Antigua and Barbuda, Grenada, St. Kitts-
Nevis, Bahamas
458
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Scott Mainwaring and Matthew J. Shugart
ground condition that is conducive to democracy is correlated
with parliamentarism,
then the superior record of parliamentarism may be more a
product of the back-
ground condition than the regime type.
Table 4 shows twenty-four additional countries that had been
continuously demo-
cratic by the same criteria used in Table 1, only for a shorter
time period (at least ten
years). Together, Tables 1 and 4 give us a complete look at
contemporary democra-
cies that have lasted at least ten years.
There are three striking facts about the additional countries in
Table 4. First, they
include a large number of microstates that became independent
from Britain in the
1970s and 1980s, and all of them are parliamentary. All seven
presidential democ-
81. racies but only three of the sixteen parliamentary democracies
are in medium to
large countries (see Table 5). All sixteen of the democracies
listed in Tables 1 and 4
with populations under one-half million (mostly island nations)
are parliamentary,
as are eight of ten democracies with populations between one-
half and five million.
In contrast, no presidential systems are in microstates, and
many are in exception-
ally large countries, such as Argentina, Brazil, and the United
States.
Second, with Table 4 the number of presidential democracies
increases substan-
tially. Most are in the lower and lower middle income
categories, and all are in Latin
America. Table 6 summarizes the income status of the newer
democracies listed in
Table 4. Clearly, not all of parliamentarism's advantage stems
from the advanced
industrial states. Even in the lower to upper middle income
categories, there are
more parliamentary systems (twenty-one if we combine Tables 1
and 4, compared
to eleven presidential systems). However, every one of the
parliamentary democra-
cies outside of the high income category is a former British
colony. The only other
democracies in these income categories are presidential, and all
but Cyprus are in
Latin America.
Thus, if the obstacles of lower income (or other factors not
considered here) in
Latin America continue to cause problems for the consolidation
82. of democracy, the
number of presidential breakdowns could be large once again in
the future. More
optimistically, if Latin American democracies achieve greater
success in consoli-
dating themselves this time around, the number of long
established presidential
democracies will grow substantially in the future.
Table 5 Population Size of Continuous Democracies, 1985-1994
(number of countries in
each category)
Population Parliamentary Presidential Other
Under 500,000 12 0 0
500,000 to 5,000,000 1 0 0
Over 5,000,000 3 7 1
total 16 7 1
459
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Comparative Politics July 1997
Table 6 Income Levels of Continuous Democracies, 1985-1994
(number of countries in each
category)
83. Per Capita GNP in US$ Parliamentary Presidential Other
0-2555 10 0 0
2556-7910 4 5 1
Over 7911 2 2 0
total 16 7 1
Similarly, if British colonial heritage and small population size
are conducive to
democracy, parliamentarism has a built-in advantage simply
because Britain colon-
ized many small island territories. As a rule, British colonies
had local self-govern-
ment, always on the parliamentary model, before
independence." Further, if other
aspects of Latin American societies (such as extreme inequality
across classes or
regions) are inimical to stable democracy, then presidentialism
has a built-in disad-
vantage.
In sum, presidentialism is more likely to be adopted in Latin
America and in
Africa than in other parts of the world, and these parts of the
world have had more
formidable obstacles to democracy regardless of the form of
government. In con-
trast, parliamentarism has been the regime form of choice in
most of Europe and in
former British colonies (a large percentage of which are
microstates), where condi-
tions for democracy have generally been more favorable. Thus,
the correlation
between parliamentarism and democratic success is in part a
product of where it has
84. been implemented.
Advantages of Presidential Systems
Presidential systems afford some attractive features that can be
maximized through
careful attention to constitutional design. These advantages
partially offset the lia-
bilities of presidentialism.
Greater Choice for Voters Competing claims to legitimacy are
the flipside of one
advantage. The direct election of the chief executive gives the
voters two electoral
choices instead of one - assuming unicameralism, for the sake
of simplicity of
argument. Having both executive and legislative elections gives
voters a freer range
of choices. Voters can support one party or candidate at the
legislative level but
another for the head of government.
Electoral Accountability and Identification Presidentialism
affords some
advantages for accountability and identifiability. Electoral
accountability describes
460
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
85. Scott Mainwaring and Matthew J. Shugart
the degree and means by which elected policymakers are
electorally responsible to
citizens, while identifiability refers to voters' ability to make an
informed choice
prior to elections based on their ability to assess the likely
range of postelection
governments.
The more straightforward the connection between the choices
made by the elec-
torate at the ballot box and the expectations to which
policymakers are held can be
made, the greater electoral accountability is. For maximizing
direct accountability
between voters and elected officials, presidentialism is superior
to parliamentarism
in multiparty contexts because the chief executive is directly
chosen by popular vote.
Presidents (if eligible for reelection) or their parties can be
judged by voters in sub-
sequent elections. Having both an executive and an assembly
allows the presidential
election to be structured so as to maximize accountability and
the assembly election
so as to permit broad representation.
One objection to presidentialism's claim to superior electoral
accountability is
that in most presidential systems presidents may not be
reelected immediately, if at
all. The electoral incentive for the president to remain
responsive to voters is
weakened in these countries, and electoral accountability
suffers. Bans on reelection
86. are deficiencies of most presidential systems, but not of
presidentialism as a regime
type. Direct accountability to the electorate exists in some
presidential systems, and
it is always possible under presidential government. If, as is
often the case, the con-
stitution bans immediate reelection but allows subsequent
reelection, presidents who
aspire to regain their office have a strong incentive to be
responsive to voters and
thereby face a mechanism of electoral accountability. Only if
presidents can never
be reelected and will become secondary (or non) players in
national and party poli-
tics after their terms are incentives for accountability via
popular election dramati-
cally weakened. Even where immediate reelection is banned,
voters can still directly
hold the president's party accountable.
Under parliamentarism, with a deeply fragmented party system
the lack of direct
elections for the executive inevitably weakens electoral
accountability, for a citizen
can not be sure how to vote for or against a particular potential
head of government.
In multiparty parliamentary systems, even if a citizen has a
clear notion of which
parties should be held responsible for the shortcomings of a
government, it is often
not clear whether voting for a certain party will increase the
likelihood of excluding
a party from the governing coalition. Governments often change
between elections,
and even after an election parties that lose seats are frequently
invited to join gov-
87. erning coalitions.
Strom used the term "identifiability" to denote the degree to
which the possible
alternative executive-controlling coalitions were discernible to
voters before an elec-
tion.'8 Identifiability is high when voters can assess the
competitors for control of the
executive and can make a straightforward logical connection
between their preferred
candidate or party and their optimal vote. Identifiability is low
when voters can not
461
This content downloaded from 128.235.251.160 on Sun, 22 Mar
2015 17:27:51 UTC
All use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsp
Comparative Politics July 1997
predict easily what the effect of their vote will be in terms of
the composition of the
executive, either because postelection negotiations will
determine the nature of the
executive, as occurs in multiparty parliamentary systems, or
because a large field of
contenders for a single office makes it difficult to discern where
a vote may be
"wasted" and whether voting for a "lesser-of-evils" might be an
optimal strategy.