This study identified an ethylene-responsive element (ERE) involved in regulating transcription of the carnation glutathione-S-transferase 1 (GST1) gene during petal senescence. Through deletion analysis and transient expression assays of GST1-GUS gene fusions delivered to carnation petals via particle bombardment, the researchers identified a 197 bp region between -667 and -470 bp upstream of the GST1 transcription start site that is necessary for ethylene-responsive expression. Within this region, a 126 bp sequence between -596 and -470 bp conferred ethylene-regulated expression to a minimal CaMV 35S promoter. Nuclear protein extracts from carnation petals were found to specifically bind

1. Proc. Nadl. Acad. Sci. USA
Vol. 91, pp. 8925-8929, September 1994
Plant Biology
An ethylene-responsive enhancer element is involved in the
senescence-related expression of the carnation glutathione-S-
transferase (GSTI) gene
(Dianhus caryophyllusplant hormone/flower senescence/transcription)
HANAN ITZHAKI*, JULIE M. MAXSON, AND WILLIAM R. WOODSONt
Department of Horticulture, Purdue University, West Lafayette, IN 47907-1165
Communicated by Shang Fa Yang, May 16, 1994
ABSTRACT The increased production of ethylene during
carnation petal senescence regulates the transcription of the
GSTI geneencoding a subunit ofglutathione-S-transferase. We
have investigated the molecular basis for this ethylene-
responsive transcription by examining the cis elements and
trans-acting factors involved in the expression of the GSTI
gene. Transient expression assays following delivery ofGSTI 5'
flanking DNA fused to a P-glucuronidase reporter gene were
used to functionally define sequences responsible for ethylene-
responsive expression. Deletion analysis of the 5' fanking se-
quences ofGST1 identifted a single positive regulatory element
of 197 bp between -667 and -470 necesary for ethylene-re-
sponsive expression. The sequences within this ethylene-re-
sponsive region were further localized to 126 bp between -596
and -470. The ethylene-responsive element (ERE) within this
regionconferred ethylene-regulated expression upon a mi l
cauliflower mosaic virus-35S TATA-box promoter in an ori-
entation-independent manner. Gel electrophoresis mobility-
shift assays and DNase I footprinting were used to identify
proteins that bind to sequences within the ERE. Nuclear
proteins from carnation petals were shown to specifically
interact with the 126-bp ERE and the presence and binding of
these proteins were independent of ethylene or petal senes-
cence. DNase I footprinting defined DNA sequences between
-510 and -488 within the ERE specifically protectedby bound
protein. An 8-bp sequence (ATTTCAAA) within the protected
region shares si ant homology with promoter sequences
required for ethylene responsiveness from the tomato fruit-
ripening E4 gene.
The gaseous plant hormone ethylene is involved in the
regulation ofplant growth and development and the response
ofplants to biotic and abiotic stresses (1). In carnations, the
developmentally programed senescence of flower petals is
regulated by the increased production of ethylene (2). The
senescence of carnation flower petals is an active process
involving programed cell death as evidenced by the necessity
for gene transcription and protein synthesis (2). This has led
us to clone several senescence-related genes in an attempt to
understand their functional significance to the processes of
senescence and the role ethylene plays in theirtranscriptional
regulation (3, 4). One such gene from carnation was recently
found to encode a glutathione-S-transferase (GST; ref. 5).
The GSTs are a superfamily of enzymes and catalyze the
conjugation of the thiol group of glutathione (GSH) to a
variety of electrophilic substrates (6). Plant GSTs have been
shown to conjugate GSH to a number ofherbicides leading to
their detoxification (7, 8). In addition, a GST was recently
shown to bind auxin with high affinity and may be involved
in intercellular transport or conjugation of this important
plant hormone (9). The function ofthe carnation senescence-
related GST is unknown. The cDNA representing this gene,
pSR8, detects a transcript that increases in abundance during
petal senescence (3). The increase in ethylene that accom-
panies petal senescence is essential for the transcriptional
activation of the SR8 gene (4). Other plant GSTs have been
shown to respond to anumberofinducers, including ethylene
(10), herbicide safeners (11), auxin (12), and pathogens (13).
Given the variety ofinducers it willbe ofinterestto determine
if common cis elements are involved in the transcriptional
regulation of these genes. The transcriptional regulation of
GSTs in mammalian cells in response to xenobiotics and
antioxidants has been studied in detail (14). Cis elements
have been identified in the promoters ofthe GST Ya subunit
genes from mouse and rat that are responsible for inducible
expression of these genes (15-17). To date, no detailed
functional analysis ofthe 5' flanking region ofaplant GSThas
been reported. We recently described the carnation senes-
cence-related GSTJ gene (18) and reported that -1457 bp of
the 5' flanking DNA of this gene was sufficient to confer
ethylene responsiveness to a chimeric reporter gene. In this
paper we report the identification ofa region ofthe carnation
GSTI promoter that is both necessary and sufficient for
ethylene-responsive transcription of this gene during petal
senescence. We also define sequence-specific protein bind-
ing sites within this region using gel mobility-shift and DNase
I footprinting analyses.
MATERIALS AND METHODS
Plant Material. Carnation (Dianthus caryophyllus L. cv.
White Sim) flowers were harvested from greenhouse-grown
plants at anthesis. Flower petals were removed for all ex-
periments and placed on moistfilterpaperinPetri dishes. For
ethylene treatment, flower petals were placed in 24-liter
Plexiglas chambers through which humidified ethylene in air
was passed. The concentration of ethylene (10 A/liter) was
verified by analyzing the effluent air for ethylene by gas
chromatography.
Construction of Chimeric Genes. The construction of a
GSTI-f3-glucuronidase (GSTI-GUS) chimeric gene was pre-
viously described (18). This chimeric gene consists of the 5'
flanking region of GSTI (-1457 to +15) ligated to the GUS
coding sequences and nopaline synthase (NOS) 3' poly(A)
addition sequences ofpBI201.2 (Clontech). This plasmid was
used as a template to generate a series of 5' deletions using
exonuclease III. Internal deletions from the GSTJ 5' flanking
Abbreviations: CaMV, cauliflower mosaic virus; GUS, frglucuroni-
dase; GST, glutathione-S-transferase; LUC, luciferase; NOS, no-
paline synthase; ERE, ethylene-responsive element; MU, 4-meth-
ylumbelliferone.
*Present address: Institute of Field and Garden Crops, Agricultural
Research Organization, The Volcani Center, Bet Dagan 50250,
Israel.
to whom reprint requests should be addressed.
8925
The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Downloaded
by
guest
on
October
29,
2020

2. Proc. Natl. Acad. Sci. USA 91 (1994)
DNA of the chimeric genes were made by digestion with
restriction endonucleases and religation. The structure ofthe
resultingplasmids and the deletion endpoints were confirmed
by DNA sequence analysis.
Particle Bombardment. The transient expression of chi-
meric GSTI-GUS genes was determined following delivery of
DNA into cells by particle bombardment (19) using a Biolistic
PDS-1000/He particle delivery system (Bio-Rad). Approxi-
mately 10 ,ug of supercoiled CsCl-purified plasmid DNA was
precipitated onto 3 mg of 1.6-pm gold particles in 50%o
ethanol/50% glycerol according to the manufacturer's in-
structions. The amount of DNA was adjusted for deleted
plasmids to ensure equal molar amounts of DNA. The
DNA-coated gold particles were resuspended in 100o etha-
nol and 10 gl pipetted onto macrocarrier disk for each
bombardment. Intact flower petals, placed on moist filter
paper in a Petri dish, were bombarded at a distance of 2 cm
from the stopping plate using 1300-psi (1 psi = 6.89 kPa)
rupture disks. Following bombardment, tissue samples were
incubated for 16 hr in 24-liter chambers through which
humidified ethylene-free air or ethylene in air (10 ul/liter)
was passed.
GUS Assays. Following incubation, petal tissue was ex-
tracted and extracts were analyzed for GUS activity by
fluorometric quantification of 4-methylumbelliferone (MU)
produced from 4-methylumbelliferyl f3D-glucuronide (Sig-
ma) as described (20, 21). GUS activity was expressed in
pmol ofproduct generated per min per petal. The conditions
of bombardment were such that the entire petal was a
potential target for particles and therefore relating GUS
activity back to the petal ensured all cells expressing GUS
were included in the calculation.
Preparation of Nuclear Proteins. Crude nuclei were pre-
pared from carnation flowerpetals as described (22). Nuclear
protein extracts were prepared according to Miskimins et al.
(23). Following protein determination (Bio-Rad protein as-
say), aliquots were frozen in liquid N2 and stored at -800Cfor
up to 1 month.
Gel Mobility-Shift Assay. Fragments ofthe GSTI promoter
were amplified by PCR using the following oligonucleotide
pairs with the 5' deletion constructs in pBI201.2 as templates.
Fragment A: sense, Sp6 primer; antisense, 5'-GAGATGC-
TACATGCTAGGC-3'. Fragment B: sense, 5'-GAATTGAA-
TGGAGGGAGGA-3'; antisense, 5'-GAGATGCTACATGC-
TTAGGC-3'. Fragment C: sense, Sp6 primer; antisense, 5'-
CTCCTCCCTCCATTCAATT-3'. Promoter fragments were
end-labeled with [32P]dATPbyfilling-in 3' recessed ends with
Klenow fragment (Promega). Binding reactions were carried
out in 20 /4 ofsolution containing 0.1-0.2 ng oflabeled DNA,
1 pg ofpoly(dI-dC), 1 pug ofnuclearproteins, 10mM Tris*HCI
(pH 7.9), 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol,
and 5% glycerol at 25°C for 15 min. In competition experi-
ments, 20x molar excess ofunlabeled DNA was added to the
reaction for 15 min prior to the addition of labeled DNA.
Reaction products were separated on nondenaturing 4%
polyacrylamide gels as described (22). The dried gels were
exposed to x-ray film at -70°C with intensifying screens
overnight.
DNase I Footprinting. Approximately 0.5 ng of 32P-labeled
DNA was incubatedwith nuclear proteins as described above
except that reactions were scaled up to 80-pl volumes to
accommodate increasing protein concentrations. After incu-
bation at 25°C for 15 min, CaCl2 was added to 1 mM and
MgCl2to 5 mM followed by DNase I addition (1 pg)for5 min.
Reactions were terminated by adding 80 ,u of stop solution
(30 mM EDTA/1% SDS/300 mM NaCl/250 mg oftRNA per
ml) followed by phenol extraction and ethanol precipitation.
Maxam-Gilbert sequencingofthe labeled DNA fragmentwas
performed according to Maniatis et al. (24). Samples were
dissolved in 5 Al of sequencing load mix (United States
Biochemical), boiled for 3 min, placed on ice, and loaded onto
an 8% polyacrylamide sequencing gel.
RESULTS
Analysis of 5' Deletions of the GSTI Promoter. To investi-
gate the sequences responsible for ethylene-responsive ex-
pression ofthe carnation GSTI gene we employed micropro-
jectiles to deliver DNA constructs into petal tissue. The
analysis oftransient gene expression in situ by this method of
DNA delivery has been found to reliably duplicate tissue-
specific (25, 26), environmental (25), and hormonal cues (27)
responsible for regulated transcription of stably integrated
DNA. Previously we reported that a chimeric GSTI-GUS
gene was responsive to ethylene in transient assays following
delivery into petal tissue by particle bombardment (18). To
identify regions that are required for this ethylene-regulated
expression, a series of5' deletions ofthe GSTI-GUS chimeric
gene was generated. Using particle bombardment, these
constructs were delivered into petals isolated from carnation
flowers at anthesis (Od) or from flowers entering into the
ethylene climacteric 5-6 days after harvest (senescing).
Senescing petals were allowed to continue into the later
stages of senescence overnight in air, while presenescent
petals were incubated in air or ethylene (10 //liter) for 16 hr
following bombardment. In preliminary experiments we at-
tempted to employ an internal standard by bombarding with
two constructs simultaneously. In this case the control plas-
mid was a 1.6-kbp cauliflower mosaic virus (CaMV)-35S
promoter fused to luciferase (LUC) (27). However, back-
ground luminescence, which increased in senescing flower
petals, severely limited the usefulness ofthis control. There-
fore, experiments were conducted using only the chimeric
gene of interest and generally involved between 8 and 12
replicate bombardments. Treatment of petals with ethylene
following delivery of the -1457-bp GSTJ-GUS construct
resulted in a 10-fold increase in GUS activity (Fig. 1). A less
pronounced induction was observed with naturally senescing
petals. This is likely due to the decrease in cell viability
300
250
C 200
2 150
E
CL 100
50
0
0-
CM M "i t
m m
CO CD
co r-- 0 10
1) c .:> 0)
q' I? I
FIG. 1. Deletion analysis of the GSTI 5' flanking DNA. GSTJ
promoter deletion endpoints relative to the start oftranscription are
indicated in bp shown on the abscissa. Chimeric genes were deliv-
ered into carnation petals by particle bombardment. Petals were
incubated in ethylene-free air or ethylene (10 /4/liter) for 16 hr
following bombardment and then assayed for GUS activity. Error
bars represent the standard deviation of the mean and each point
represents an average of at least eight bombardments. Air, petals
from flowers at anthesis incubated in ethylene-free air; Ethylene,
petals from flowers at anthesis incubated in ethylene (10 4/liter);
Senescing, petals from flowers 6 days after harvest and producing
climacteric ethylene.
8926 Plant Biology: Itzhaki et al.
Downloaded
by
guest
on
October
29,
2020

3. Proc. Natl. Acad. Sci. USA 91 (1994) 8927
associated with tissues that have passed through the ethylene
climacteric into advanced stages of senescence. In contrast,
a chimeric CaMV-35S-GUS gene (pBI221) did not exhibit
increased expression in response to exogenous ethylene
treatment. A promoterless GUS construct (pBI201) was
delivered into petal tissue to assess background levels of
GUS activity. In this case GUS activity was typically <5
pmol ofMU per min perpetal and was unaffected by ethylene
or petal senescence. In the absence of ethylene, the -1457
construct exhibited GUS activity =2-fold above the promot-
erless pBI2O1 construct. Treatment of petals with the ethyl-
ene action inhibitor 2,5-norbornadiene did not reduce this
GUS activity (data not shown), suggesting wounding by the
particles did not lead to sufficient ethylene to induce the
GST1 promoter. Deletion of the GSTI promoter to -956 bp
did not influence the GUS activity in response to ethylene;
however, further deletion to -667 bp resulted in a 25-fold
induction of GUS activity following ethylene treatment and
a 20-fold induction in senescing petals. This result suggests
that a silencing element is present between -956 and -667
of the GSTI gene. Further deletion of the GSTI 5' flanking
sequences to -470 completely eliminated the ethylene-
A
I I
GUS-NOB -956
-956 4 -231
I 1 GUS -956 A-364/-231
-956 -875
Li
-231
G S-NOB -956 A-875/-231
-667
I I
T-GUS-NOBS -
66 7
-667 -364 -231
1 1 a
8GUS-
-667 A-864/-231
responsive expression of the chimeric GSTI-GUS gene.
These results indicate that 197 bp are necessary for ethylene-
responsive expression of the carnation senescence-related
GSTJ gene.
To determine if sequences downstream of the ethylene-
responsive region of GSTI participate in ethylene-regulated
gene expression a series of chimeric constructs was gener-
ated in which internal sequences were deleted (Fig. 2A).
These internal deletions took advantage ofseveralAcc I sites
within the GSTI promoter. Deletion of 133 bp between -364
and -231 did not affect the ethylene responsiveness ofeither
the -956 or the -667 GSTI-GUS chimeric gene (Fig. 2B). In
contrast, an internal deletion between -875 and -231 bp
removed the ethylene-responsive region and resulted in com-
plete loss of ethylene-regulated expression of the chimeric
A
-667
-461 +8
1 -1
CaMV GUS-rbcS 3
-470-4W- +8
/
I- I
GST1 TCaM GUS-rbcS 3'
-667 -580-46 +8
I I
GSTI M GUS~c3
-596 -470546- +8
1 1
GSTI CaM| GUS-rbcS 3'
-470 -596 46- +8
1-1
GST1 CaMV GUS-rbcS 1
-596 -470 -596 -470 -596 -470-46- +8
GST1 GST1 I GST1 I Camvl GUS-rbcS3|
A
B
C
D
E
F
B
I
E
B
35
30 1
0)
0.f
C
E
0.
V-
r- qp-~~~~~C'
C#) cr)
~~~~~~~Cf'
I c cm
25 F
20 V
15 -
10 F
5
0
FIG. 2. Effects of internal deletions on the ethylene-responsive
expression of the GSTI promoter. (A) Schematic representations of
various constructs in which portions of the 5' flanking DNA were
deleted. The thin lines represent the 5' flanking DNA of GSTJ. The
solid box represents the relative position of the ethylene-responsive
region between -667 and -470. Deletion endpoints are in bp and
were generated by digestion with Acc I followed by religation. (B)
Chimeric genes were delivered into carnation petals by particle
bombardment and incubated in air or ethylene (10 pl/liter) for 16 hr
and then assayed forGUS activity. Error bars represent the standard
deviation of the mean and each point is the average of at least eight
bombardments.
A B C D E F
Construct
FIG. 3. Effects of5' flanking sequences ofGSTI on the ethylene-
responsive expression of a minimal CaMV-35S promoter fused to
GUS. (A) Schematic representation of chimeric genes constructed
between a minimal CaMV-35S TATA-box promoter fused to GUS
and 5' flanking sequences of GSTL. (B) Chimeric genes were deliv-
ered into carnation petals by particle bombardment. Petals were
incubated in air (open boxes) or 10 4 of ethylene per liter (closed
boxes) for 16 hr following bombardment and then assayed for GUS
activity. Error bars represent the standard deviation ofthe mean and
each point represents an average of at least eight bombardments.
Plant Biology: Itzhaki et al.
Downloaded
by
guest
on
October
29,
2020

4. Proc. Natl. Acad. Sci. USA 91 (1994)
gene. Interestingly, the -364 to -231 internal deletion from
a -956 GSTI-GUS chimeric gene increased ethylene-
responsive expression significantly over the complete -956
construct. This result indicates that sequences downstream
of the ethylene-responsive element (ERE) act in a combina-
torial fashion with silencing sequences between -956 and
-667.
The Ethylene-Responsive Region of GSTI Is Sufficient for
Ethylene-Regulated Expression. To determine whether se-
quences present between -667 and -470 of the GST1 pro-
moter are sufficient to confer ethylene responsiveness, this
region was fused to a minimal CaMV-35S promoter (28)
containing a TATA box and driving the transcription of the
GUS coding region (Fig. 3A). Bombardment of carnation
petals with this construct resulted in a 6-fold induction of
GUS activity in response to ethylene exposure (Fig. 3B). To
localize more precisely the regulatory sequences within the
197-bp GSTI promoter, these sequences were further divided
into two regions (-667 to -580 and -55% and -470; Fig. 3A).
Sequences present between -5% and -470 (Fig. 3B, con-
struct D) conferred ethylene responsiveness to the minimal
CaMV-35S promoter. The ERE between -596 and -470
functioned in an orientation-independent manner (Fig. 3B,
construct E) and exhibited additive responsiveness when
tandemly arranged (Fig. 3B, construct F). Taken together,
these data suggest that the regulatory sequences between
-5% and -470 function as an ethylene-responsive enhancer
element.
A Carnation Flower Petal Nuclear Protein Interacts with the
Ethylene-Responsive Region of GSTL. To identify nuclear
proteins from carnation petals that interact specifically with
sequences in the ethylene regulatory region ofGST1, nuclear
extracts were prepared from petals at anthesis, petals treated
with ethylene, and petals producing the climacteric ethylene
associated with senescence. These proteins were incubated
with a 32P-end-labeled promoter fragment from -667 to
-470. DNA binding activity was present in both presenes-
cent and ethylene-producing petals (Fig. 4). Similar DNA
bindingpatterns were observed with nuclear proteins isolated
from ethylene-treated petals (data not shown). Addition of a
20-fold molar excess of unlabeled fragments from -667 to
-470 (fragment A) and -5% to -470 (fragment B) effectively
competed for protein binding to the labeled GSTI fragment.
A
-667
C
Comp. (20x)
Protein
o day
A B C
+ + +$ +
-470
B
6 day
A B C;
d * Bound on
Free a
FIG. 4. Gel mobility-shift analysis of the ERE-containing GSTI
promoter region using crude nuclear extracts from carnation petals
at anthesis (0 day) or entering the ethylene climacteric (6 day).
Binding of the end-labeled GSTI promoter fragment from -667 to
-470 with petal nuclear protein competed with a 20x molar excess
ofunlabeled DNA fragments: A, -667 to -470; B, -596 to -470; C,
-667 to -580. Products were analyzed on a 4% nondenaturing
polyacrylamide gel.
CODING STRAND NONCODING STRAND
iig protein 0 30 75 0 30 75
I,"
GTGATTTACCACCTATTTCAAAG
CACTAAATGGTGGATAAAGTTTC
FIG. 5. DMase I protection analysis of the ethylene-responsive
GSTI promoter region (-667 to -470) defined by interaction of
nuclearfactors from carnation petals in the ethylene climacteric. The
promoter fragment was end-labeled on the coding or noncoding
strand and incubated with the indicated concentration of nuclear
protein prior to DNase I digestion. Products were analyzed on an 8%
polyacrylamide denaturing gel. Maxam-Gilbert G and A + G se-
quencing reactions were run on the same gel to precisely identify
protected regions. The GSTI promoter sequence from -510 to -488
is shown. Thick lines correspond to regions of protection on each
strand. Arrows indicate sequences with dyad symmetry.
In contrast, no competition for DNA binding activity was
observed with the GSTI 5' flanking sequences between -667
and -570 (fragment C). To more precisely localize the
sequences involved in protein binding, DNase I footprinting
was performed on both strands ofthe -667 to -470 GSTI 5'
flanking sequence. Incubation with nuclear extracts from
petals in the ethylene climacteric revealed regions ofprotec-
tion from -510 to -488 on both strands (Fig. 5). This
sequence exhibits an imperfect dyad symmetry common to
DNA-protein binding sites. These data show that a DNA
binding factor(s) is present in nuclear extracts of carnation
petals that interacts specifically with a region of the GSTI
promoter (-5% to -470) containing an ERE. The agreement
between functional ethylene regulation and in vitro protein
binding activity suggests that the DNA binding protein(s)
may represent trans-acting factor(s) involved in the ethylene-
regulated expression of GSTI.
DISCUSSION
In the flowers of carnation it is well established that the
increased ethylene production associated with petal senes-
cence regulates the processes of programed cell death in-
cluding the transcriptional activation of senescence-related
genes (2, 4). In an attempt to understand how ethylene
regulates-gene expression during petal senescence we have
examined the cis elements and trans-acting factors involved
in the transcriptional regulation ofthe carnation senescence-
related GSTI gene.
Idencation of DNA Sequences Necess and Suit
for Ethylene-Responsive Gene Expression. We employed a
particle bombardment transient gene expression system to
functionally define the DNA sequences involved in ethylene-
inducible expression of the GST1 gene. A single positive
regulatory region of 197 bp between -667 and -470 of the
GSTI 5' flanking DNA was necessary for ethylene-respon-
sive expression (Fig. 1). The ERE was further localized to a
126-bpregion between -55% and -470. The sequences within
this ERE were sufficient to confer ethylene-responsive ex-
8928 Plant Biology: Itzhaki et al.
Downloaded
by
guest
on
October
29,
2020

5. Proc. Natl. Acad. Sci. USA 91 (1994) 8929
pression upon a minimal CaMV-35S TATA-box promoter.
The ERE functions in an orientation-independent manner
and thus may represent an ethylene-responsive enhancer
element. In addition, removal of sequences downstream of
the ERE did not alter ethylene responsiveness (Fig. 2)
indicating position-independent regulation. We previously
identified DNA sequences between -595 and -578 within
the ERE that shared homology with a region ofthe 5' flanking
DNA of a pathogen-induced wheat GST gene (29). In addi-
tion, an AP-1-like motif is present within the ERE between
-567 and -561. Similar sequences are present within the
EpRE ofthe mouse GST Yagene (15,16) and the antioxidant-
responsive element (ARE) of the rat GST Ya gene (17). The
EpRE of the mouse GST Ya subunit promoter contains two
adjacent AP-1-like binding sites and the close proximity of
these two sites was shown to be essential for inducible
expression (16). In contrast, the carnation GST1 ERE con-
tains only one AP-1-like binding site. The functional signif-
icance of this site remains to be determined. In addition to
AP-1-like sequences ofthe EpRE, the 5' flanking sequence of
the rat GST Ya gene was also found to include a xenobiotic-
responsive element similar to those found in the planar
aromatic-responsive cytochrome P1-450 genes (17). This does
not seem to contribute to the responsiveness of this gene to
planar aromatic inducers since deletion ofthe element did not
inhibit basal or inducible expression of the gene (17). The
carnation GSTI ERE does not contain sequences similar to
this xenobiotic-responsive element. Comparison of the se-
quences within the GSTI ERE to other ethylene-responsive
promoters, including the tomato E8 gene (30), the bean
chitinase gene (31), the PRB-lb gene (32), an avocado cel-
lulase gene (33), or the carnation SR12 gene (22), revealed no
significant homologies. The consensus sequences recently
identified in ethylene-responsive pathogenesis-related pro-
moters (32) were likewise not contained within the ERE of
GSTL.
Nuclear Proteins from Carnation Petals Interact with the
Defined ERE. The DNA sequences between -5% and -470,
which make up the functionally defined ERE, specifically
interact with nuclear proteins from carnation petals as de-
termined by gel mobility-shift assays and DNase I footprint-
ing. These proteins could represent trans-acting factors in-
volved in the formation of an active transcription complex.
The protein(s) that specifically bind to the ERE are present
in the nuclei of petals at anthesis, during the ethylene
climacteric and following treatment with exogenous ethyl-
ene. Since GSTI transcription is ethylene-inducible, post-
translational modifications or interactions with otherproteins
may be an essential part of ethylene-regulated expression.
Interestingly, cis elements of other ethylene-responsive
genes have been shown to interact with nuclearproteins in an
ethylene-independent manner (22, 27, 32). DNase I footprint-
ing was used to more precisely define the DNA sequences
bound by carnation nuclear proteins. Sequences between
-510 and -488 were protected from DNase I digestion by
interacting protein(s). The protected sequences do not rep-
resent the region of homology with the wheat gstlA gene or
the AP-1-like motif previously identified in the GSTI pro-
moter (18). However, within the footprinted region an 8-bp
sequence (ATTTCAAA) is very similar to sequences within
the ethylene-responsive region of the E4 gene from tomato
(27). The DNA sequence within the E4 gene (AATTCAAA)
was previously shown to be protected from DNase I digestion
by proteins from the nuclei of unripe fruit, and to a lesser
extent ripe fruit (27). Given the strict regulation of the GSTI
and E4 genes by ethylene, it is possible that these sequences
represent cis-acting EREs and the proteins that bind to these
sequences are trans-acting factors involved in transcriptional
activation. The symmetrical sequence motifwithin the GSTI
footprinted region may serve as contact points for a dimeric
trans-acting factor. The cloning ofcDNAs encoding proteins
that specifically interact with the GSTI ERE should allow us
to begin to address theirfunction in ethylene-responsive gene
expression during carnation petal senescence.
We thank Peter Goldsbrough and Clint Chapple for critical review
of the manuscript, Ron Somerville for valuable suggestions, and
Amanda Brandtforexcellent technical assistance. This is publication
no. 14,177 ofthe Purdue University Office of Agricultural Research
Programs. This research was supported by National Science Foun-
dation Grants DCB-8911205 and IBN-9206729.
1. Mattoo, A. K. & Suttle, J. C. (1991) The Plant Hormone
Ethylene (CRC, Boca Raton, FL).
2. Borochov, A. & Woodson, W. R. (1989) Hortic. Rev. 11,
15-43.
3. Lawton, K. A., Huang, B., Goldsbrough, P. B. & Woodson,
W. R. (1989) Plant Physiol. 90, 690-696.
4. Lawton, K. A., Raghothama, K. G., Goldsbrough, P. B. &
Woodson, W. R. (1990) Plant Physiol. 93, 1370-1375.
5. Meyer, R. C., Jr., Goldsbrough, P. B. & Woodson, W. R.
(1991) Plant Mol. Biol. 17, 277-281.
6. Pickett, C. B. & Lu, A. Y. H. (1989) Annu. Rev. Biochem. 58,
743-764.
7. Mozer, T. J., Tiemeier, D. C. & Jaworski, E. G. (1987) Bio-
chemistry 22, 1068-1072.
8. Timmerman, K. P. (1989) Physiol. Plant. 77, 465-471.
9. Bilang, J., Macdonald, H., King, P. J. & Sturm, A. (1993)Plant
Physiol. 102, 29-34.
10. Zhou, J. & Goldsbrough, P. B. (1993) Plant Mol. Biol. 22,
517-523.
11. Wiegand, R. L., Shah, D. M., Mozer, T. J., Harding, E. I.,
Diaz-Collier, J., Sauders, C., Jaworski, E. G. & Tiemeier,
D. C. (1986) Plant Mol. Biol. 7, 235-243.
12. Droog, F. N. J., Hooykaas, P. J. J., Libbenga, K. R. & van
der Zaal, E. J. (1993) Plant Mol. Biol. 21, 965-972.
13. Dudler, R., Hertig, C., Rebmann, G., Bull, J. & Mauch, F.
(1991) Mol. Plant-Microbe Interact. 4, 14-18.
14. Daniel, V. (1993) Crit. Rev. Biochem. Mol. Biol. 28, 173-207.
15. Friling, R. S., Bensimon, A., Tichauer, Y. & Daniel, V. (1990)
Proc. Natl. Acad. Sci. USA 87, 6258-6262.
16. Friling, R. S., Bergelson, S. & Daniel, V. (1992) Proc. Natl.
Acad. Sci. USA 89, 668-672.
17. Rushmore, T. H. & Pickett, C. B. (1990) J. Biol. Chem. 265,
14648-14658.
18. Itzhaki, H. & Woodson, W. R. (1993) Plant Mol. Biol. 22,
43-58.
19. Klein, T. M., Wolf, E. D., Wu, R. & Sanford, J. L. (1987)
Nature (London) 327, 70-73.
20. Jefferson, R. A., Kavanagh, T. A. & Bevan, M. W. (1987)
EMBO J. 6, 3901-3907.
21. Jefferson, R. A. (1987) Plant Mol. Biol. Rep. 5, 387-405.
22. Raghothama, K. G., Lawton, K. A., Goldsbrough, P. B. &
Woodson, W. R. (1991) Plant Mol. Biol. 17, 61-71.
23. Miskimins, K., Roberts, M. P., McClelland, A. & Ruddle,
F. H. (1985) Proc. Natl. Acad. Sci. USA 82, 6741-6744.
24. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular
Cloning: A Laboratory Manual (Cold Spring Harbor Lab.
Press, Plainview, NY).
25. Bansal, K. C., Viret, J.-F., Haley, J., Khan, B. M., Schantz,
R. & Bogorad, L. (1992) Proc. Natl. Acad. Sci. USA 89,
3654-3658.
26. Twell, D., Klein, T. M., Fromm, M. E. & McCormick, S.
(1989) Plant Physiol. 91, 1270-1274.
27. Montgomery, J., Goldman, S., Deikman, J., Margossian, L. &
Fischer, R. L. (1993) Proc. Natl. Acad. Sci. USA 90, 5939-
5943.
28. Benfey, P. N. & Chua, N.-H. (1990) Science 250, 959-966.
29. Mauch, F., Hertig, C., Rebmann, G., Bull, J. & Dudler, R.
(1991) Plant Mol. Biol. 16, 1089-1091.
30. Deikman, J. & Fischer, R. L. (1988) EMBO J. 7, 3315-3320.
31. Broglie, K. E., Biddle, P., Cressman, R. & Broglie, R. (1989)
Plant Cell 1, 599-607.
32. Eyal, Y., Meller, Y., Lev-Yadun, S. & Fluhr, R. (1993) Plant
J. 4, 225-234.
33. Cass, L. G., Kirven, K. A. &Christoffersen, R. E. (1990) Mol.
Gen. Genet. 223, 76-86.
Plant Biology: Itzhaki et al.
Downloaded
by
guest
on
October
29,
2020