1. Preliminary observations on the role of sirtuin genes in grapevine physiology
Result and discussion
In order to investigate on the deacetylase activity of grapevine pSIRT4 and pSIRT7, in vitro assays were
performed. A very weak NAD+-dependent deacetylase function for both sirtuins, was detected either in presence
and in absence of resveratrol (fig.1). Since Human SIRT1 is activated by resveratrol and shows a strong
deacetylase activity, it was used as control in our analysis (data not shown).
Ribosyltrasferase activity was also tested in vitro with the NAD analogue 6-Biotin-17-NAD in presence or
absence of bovine GDH (Glutammate dehydrogenase). No signal was detected on western blot, suggesting that
the NAD analogue was not covalently incorporated (data not shown).
The assays listed above were carried out using hypothetical SIRT4 (1200 bp) and SIRT7 (1404 bp) coding
sequences predicted by automated computational analysis of the sequenced grapevine genome. By reverse
transcriptase PCR (RT-PCR), we obtained long fragments of the true coding sequences: one SIRT4 fragment of
913 bp and one of 730 bp for SIRT7 (fig.2).
Also, by RT-PCR, we found that a basal transcription level of both genes is present in grape cell cultures (data not
shown).
In order to test the influence of MeJA and UV-C rays on SIRT4 and SIRT7 expression, RT-qPCR assays were
performed on extracted RNA from leaves. Actin and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were
used as reference genes.
MeJA and UV-C seem to have no influence on SIRT4 expression (fig.3a and fig.4a), contrarily, the expression of
SIRT7 gene following the treatments is more complex and it presents a non linear expression, needing further
investigations (fig.3b and 4b).
An outstanding feature, in UV-C analysis, is a SIRT4 down regulation in the range 0-24 hours in both treated and
NT sample and a SIRT7 progressive up regulation for the sample SIRT7 NT (range 0-48 hours). Stressful events
like, for example, the detachment of leaf from plant, could be a possible explanation of these trends.
Finally, in order to fully understand the role of both sirtuins, embryogenic lines of table grapes and Gamay red
berry-derived cell suspensions were transformed with a vector for SIRT4 and SIRT7 overexpression and
silencing. Plantlets and cell lines obtained are still under evaluation.
Conclusion
In the present work, we obtained, for SIRT4 and SIRT7 grapevine genes, long fragments of the true coding
sequences which show a great correspondence with the respective hypothetical coding sequences.
Moreover we observed, for both sirtuins, weak NAD+- deacetylase activity, also in presence of resveratrol and no
ADP ribosil transferase activity.
Finally, after a basal transcription observation of both genes in cell cultures, we investigated on SIRT4 and SIRT7
expression under stressful conditions as Methyl Jasmonate presence and UV-C irradiation. Preliminary data show
no changes in SIRT4 expression, while for SIRT7, no linear trend can be found.
Our work might be a starting point to shed some light on the function of SIRT4 and SIRT7 proteins, to better
understand their role in grapevine physiologic conditions and their involvement in the grapevine stress response
mechanisms.
Introduction
Two putative sirtuin genes encoding a SIRT4-like protein on chromosome 7 and a SIRT7-like protein on chromosome 19 have been previously identified in the V. vinifera genome (Busconi et al. 2009). Sirtuins discovery in
the grape genome is intriguing because stressed grapevine cells synthesize compounds with hydroxylated trans-stilbene ring structure, such as, resveratrol (trans 3,3′,5-trihydroxystilbene) which is able to activate sirtuins in
yeast (Howitz et al. 2003), in C. elegans and D. melanogaster, extending life span.
Aiming to study the role of grapevine sirtuins SIRT4 and SIRT7, in vitro and in vivo assays were carried out.
Since sirtuin/Sir2 (Silent information regulator 2) family is a family of proteins (sirtuins) NAD+- dependent histone/protein deacetylases and mono ADP-ribosyltransferases, we analyzed both activities by in vitro analysis.
Furthermore, in order to investigate abiotic stresses influence on SIRT4 and SIRT7 expression, Vitis vinifera (cv. Merlot) was treated with MeJA (Methyl Jasmonate) and UV-C rays. In fact, it’ s well known that these abiotic
elicitors increase trans-resveratrol content in leaves and berries (Cantos et al. 2003; Vezzuli et al. 2007).
Marco Cucurachi 1), Basil Hubbard 2), Laszlo G Kovacs 3), Matteo Busconi 1), Corrado Fogher 1), Róbert Oláh 4), Patrick Winterhagen 5), Avichai Perl 6), David A. Sinclair 2), Luigi Bavaresco 7)
1) Istituto di Agronomia, Genetica e Coltivazioni Erbacee, Sezione Botanica e Genetica Vegetale, Università Cattolica del Sacro Cuore, Piacenza (Italy); 2) Harvard Medical School, Pathology, Boston (USA);
3)Department of Fruit Science, Missouri State University, Mountain Grove (USA); 4) Department of Genetics and Plant Breeding, Corvinus University of Budapest, (Hungary) ; 5) Institute of Specialty Crops
and Crop Physiology Fruit Sciences , University of Hohenheim, Stuttgart (Germany) ; 6) Institute of Plant Sciences, The Volcani Center, Bet Dagan (Israel) ; 7) Istituto di Frutti-Viticoltura, Università Cattolica
del Sacro Cuore, Piacenza (Italy) and CRA-Centro di Ricerca per la Viticoltura, I-31015 Conegliano.
Materials and Methods
Deacetylase activity analysis.
The coding sequences used for this assay were synthesized according to the SIRT4 and SIRT7
hypothetical Vitis vinifera coding sequences (SIRT4 accession number: XM_002274418.1; SIRT7
accession number: XM_002265801.1). Full length pSIRT4 or pSIRT7 cDNA were inserted in pTrc-
HisA bacterial expression vector. Bacteria BL21 were transformed with the expression constructs and
purified proteins were tested by the Flour de Lys BIOMOL assay according to the manufacturers’
instructions (BIOMOL). B-NAD+ 100 µM, FdL-p53 (Human SIRT1 substrate) 50 µM were used for
each reaction . Approximately 2.5 µg of recombinant plant sirtuin was added to each reaction, and 1 μg
of human SIRT1 was used as control. All reactions were normalized to control reactions in the absence
of B-NAD (Ffinal= F+NAD - F-NAD). Resveratrol was dissolved in DMSO and used at a final concentration
of 100µM. The experiment was repeated two times and +/- stdeviation of three replicates was
calculated.
Determination of the true coding sequences and investigation on sirtuins transcription.
The primers used were designed on SIRT4 and SIRT7 hypothetical sequences.
The following primers were used in RT-PCR (Reverse Transcriptase PCR) to amplify sequence
fragments:
forward5’GGTTCCTGAATCAGATCCTC3’/reverse5’CTAGATCACAGGTATGCTTAG3’for SIRT4
forward 5’ATGTCTCTGGGCTACCA-3’/reverse5’CTTGTCCTTTGGAGTTTCCT3’for SIRT7.
Primers from Aquea F. et al. (2010) were used to check sirtuin genes basal transcription.
All the obtained fragments were sequenced by using an ABI Prism 3100 Genetic Analyzer.
Preliminary gene expression analysis.
Vitis Vinifera (cv. Merlot) plants were sprayed with a non-phytotoxic dosage of 10 mM MeJA dissolved
in 100% EtOH (ethanol). Sample controls were sprayed with 100% ethanol and with water. Each
treatment was carried out on three replicates. For each treatment, leaves were detached and RNA was
extracted at 0, 24, 48 and 72 hours (h) after each treatment.
Concerning UV-C treatment, leaves were detached from Vitis Vinifera (cv. Merlot) exposed for 12
minutes to UV rays (λ=254 nm). RNA was extracted at time 0 and at time 24, 48 and 72 hours, for both
treated and not treated sample controls (NT). For MeJA and UV-C rays treatments, sirtuin expression
was evaluated by RT-qPCR (reverse transcription quantitative PCR ).
Fig.1:
pSIRT4 and pSIRT7 deacetylation assay without Resveratrol (+NAD) and in presence of Resveratrol (+NAD+Resv.)
.The experiment was carried out twice. The graphs presented are means +/ stdeviation of 3 replicates.
References
Aquea, F.; Timmermann, T.; Arce-Johnson. P.; 2010. Analysis of histone acetyltransferase and deacetylase families of Vitis vinifera. Plant Physiol Biochem. 48(2-3):194-9.
Busconi, M.; Reggi, S.; Fogher, C.; Bavaresco, L.; 2009. Evidence of a sirtuin gene family in grapevine (Vitis vinifera L.). Plant Physiol Biochem. 47(7):650-2.
Cantos, E.; Espín, J.C.; Fernández, M.J.; Oliva, J.; Tomás-Barberán, F.A.; 2003. Postharvest UV-C-irradiated grapes as a potential source for producing stilbene-enriched red wines. J Agric Food Chem. 26;51(5):1208-14.
Howitz, K.T., Bitterman, K.J.; Cohen, H.Y.; Lamming, D.W.; Lavu, S.; Wood, J.G.; Zipkin, R.E.; Chung, P.; Kisielewski, A.; Zhang, L.L.; Scherer, B.; Sinclair, D.A.; 2003. Small molecule activators of sirtuins extend
Saccharomyces cerevisiae lifespan. Nature 425(6954):191-6.
Vezzulli, S.; Civardi, S.; Ferrari, F.; Bavaresco, L.; 2007. Methyl Jasmonate Treatment as a Trigger of Resveratrol Synthesis in Cultivated Grapevine. Am. J. Enol. Vitic. 58(4):530-3.
Fig.2:
a). Alignment between the hypothetical SIRT4 sequence (Hypothetic) and the SIRT4 sequence fragment obtained (SIRT4 cds).
b). Alignment between the hypothetical SIRT7 sequence (Hypothetic) and the SIRT7 sequence fragment obtained (SIRT7 cds).
SIRT4 and SIRT7 fragments show respectively 99% and 100% of identity with their corresponding hypothetical sequences.
SIRT4 SIRT7
a b
0,00
0,30
0,60
0,90
1,20
1,50
0 h 24 h 48 h 72 h
SIRT4expressionlevel
SIRT4
Water EtOH MeJA
0,00
1,00
2,00
3,00
4,00
0 h 24 h 48 h 72 h
SIRT7expressionlevel
SIRT7
Water EtOH MeJA
0,00
1,00
2,00
3,00
4,00
5,00
6,00
7,00
0 h 24 h 48 h 72 h
SIRT4expressionlevel
SIRT4
control (NT) UV-C
0,00
1,00
2,00
3,00
4,00
5,00
6,00
0 h 24 h 48 h 72 h
SIRT7expressionlevel
SIRT7
control (NT) UV-C
Fig.3:
Overtime effect on SIRT4 and SIRT7 expression level induced by Methyl Jasmonate (MeJA), ethanol (EtOH) and
water.
a b
Fig.4:
Overtime effect on SIRT4 and SIRT7 expression level in UV-C induced leaves and non treated control leaves (NT).
ba