this presentation is about genome editing tools این اسلاید در مورد ابزارهای ویرایش ژنوم می باشد

1. Genome editing
By: Shahnam Azizi
Autumn 2017
1

2. Genetic approaches
How do we identify a gene as being involved
in a disease or process?
Forward genetics -> mutagenise a population
of individuals or cells, screen for phenotype of
interest.
Reverse genetics -> Gene identified as
potentially involved in disease, process ->
modify to analyse function.
2

3. Genome editing
Genome editing, or genome editing with engineered
nucleases (GEEN) is a type of genetic engineering in which
DNA is inserted, replaced, or removed from a genome using
artificially engineered nucleases, or "molecular scissors”.
The nucleases create specific double-strand breaks (DSBs)
at desired locations in the genome and harness the cell’s
endogenous mechanisms to repair the induced break by
natural processes of Homologous Recombination (HR) and
Non-Homologous End Joining (NHEJ).
3

4. What is genome editing?
• Genome editing is a technique used to precisely and
efficiently modify DNA within a cell.
• It involves making cuts at specific DNA
sequences with enzymes called ‘engineered nucleases’.
• Genome editing can be used to add, remove, or alter
DNA in the genome.
• By editing the genome the characteristics of a cell or an
organism can be changed.
4

5. Genome editing applications
 gene knockout
 repression of gene activation
 gene therapy studies
 identify the properties of the gene
 For research
 Genome editing can be used to change the DNA in cells or organisms
to understand their biology and how they work.
 For biotechnology
 Genome editing has been used in agriculture to genetically modify
crops to improve their yields and resistance to disease and drought,
as well as to genetically modify cattle that don’t have horns and so
on.
5

6. How does genome editing work?
 Genome editing uses a type of enzyme called an ‘engineered
nuclease’ which cuts the genome in a specific place.
 Engineered nucleases are made up of two parts:
I. A nuclease part that cuts the DNA.
II. A DNA-targeting part that is designed to guide the nuclease to a
specific sequence of DNA.
 After cutting the DNA in a specific place, the cell will naturally repair
the cut.
 We can manipulate this repair process to make changes (or ‘edits’)
to the DNA in that location in the genome.
6

7. • The broad concept underlying the new genome editing tools is that by
stimulating DNA double-strand breaks (DSBs) at a target region.
• The double-strand breaks (DSBs) of DNA consequently result in cellular
DNA repair mechanisms, including homology-directed repair (HDR) and
error-prone non-homologous end joining breaks (NHEJ), leading to
gene modification at the target sites.
• the endogenous repair machinery of the cell could be hijacked to
introduce targeted mutations.
• In the absence of a homologous repair template, InDels
(insertions/deletions) may occur via error-prone non-homologous end
joining (NHEJ).
• These may alter the open reading frame (ORF) of the target gene
leading to a premature stop codon or translation of a scrambled amino
acid sequence.
• Notably, the InDels induced by NHEJ are random, therefore the
outcome cannot be predicted (Bibikova et al. 2002, Sander and Joung 2014).
How does genome editing work?
7

8. NHEJ Repair ( non-homologous end joining)
 NHEJ is more efficient than HDR, but has much lower fidelity and,
therefore, is much more error prone, resulting in insertions or
deletions (indels).
 NHEJ requires less sequence homology than HDR, does not
require a repair template, entails less DNA synthesis, and is faster.
 Additionally, unlike HDR, NHEJ occurs throughout the cell cycle.
After accurate repair, the sequence can be re-cleaved and
repaired again.
 This leads to an increasing proportion of cells with indels that are
heterogeneous. This can provide a population of cells with
mutations that cause loss of gene function, have residual
function, or sometimes gain of function.
 Due to the introduction of errors by NHEJ, it may not be
necessary to have any non-homologous target sequence in a
construct to generate knockouts.
Reference: http://www.bio-rad.com 8

9. HDR Repair (homology directed repair)
• HDR requires longer sequence similarity than NHEJ, which
requires alignment of only a few complementary bases for the
ligation of the two ends.
• If the sequence is completely homologous, HDR has a very low
error rate.
• HDR is most efficient if the DSB and modification site are within
10 nucleotides.
• To increase the level of repair by HDR, the repair template can
be engineered to have additional homologous sequence both
upstream (left homology arm) and downstream (right
homology arm) of the targeted area.
• HDR is less efficient than NHEJ, so there will be a reduced yield
of repair.
• HDR mostly occur in S and G2 phases of cell cycle.
• Additionally, there will still be a low level of NHEJ activity, and,
hence, the possibility (albeit very low) of an error.
Reference: http://www.bio-rad.com 9

10. 10

11. • The NHEJ mechanism can disrupt a gene by introducing
frame-shift mutations while the HR mechanism will result in
gene deletion, gene insertion or gene correction .
Reference: Sun N. Engineering of transcription activator-like effector nucleases (talens) for targeted
genome editing. University of Illinois at Urbana-Champaign; 2013. 11

12. schematic function of Engineered
nucleases
12
Engineered nucleases
Double Stranded Binding

13. 13

14. Schematic of genome editing tools
14
zinc finger nuclease
transcription activator-like effector nucleases
clustered regularly interspaced short palindromic repeats

15. Nuclease-based genome editing
ZFNs,TALENs and CRISPRS
Nuclease-induced DSB
NHEJ-mediated repair
Insertion or deletion mutations
HDR-mediated repair
Single nucleotide alterations
Donor Template
Donor Template
Precise sequence insertion
15

16. For an engineered DNA endonuclease to be widely used in
targeted genome engineering, two criteria must be met
• it must recognize a long DNA sequence with
high specificity in order to avoid cytotoxic off-
target DNA cleavage
• it must be readily designed to recognize and
cleave a defined sequence in the genome.
16

17. Meganucleases (MNs)
 Meganucleases are found in a large number of organisms -Archaea or
archaebacteria, bacteria, phages, fungi, yeast, algae and some plants.
 They can be expressed in different compartments of the cell –
the nucleus, mitochondria or chloroplasts.
 characterized by a large recognition site (double-stranded DNA
sequences of 12 to 40 base pairs); as a result this site generally occurs
only once in any given genome.
 This feature making them highly specific.
 Meganucleases are therefore considered to be the most specific
naturally occurring restriction enzymes.
 The longer the recognition sequence, the lower the probability that
there will be off-target events.
 Meganucleases promote efficient gene targeting through
double‐strand‐break‐induced homologous recombination.
Reference: http://www.bio-rad.com 17

18. Meganucleases (MNs)
 By modifying their recognition sequence through protein
engineering, the targeted sequence can be changed.
 Meganucleases are used to modify all genome types, whether
bacterial, plant or animal.
 Several studies have demonstrated that these nucleases can be
retargeted to DNA sequences of interest, albeit with
considerable effort
 Meganucleases are highly specific and easy to deliver to cells
but difficult to redesign for new targets.
 this method is costly and time-consuming.
Reference: https://en.wikipedia.org/wiki/Meganuclease 18

19.  ZFNs are the first generation EENs (engineered endonucleases)
 An individual zinc-finger consists of approximately 30 amino acids
in a conserved ββα configuration.
 Several amino acids on the surface of the a-helix typically contact
3 bp in the major groove of DNA, with varying levels of selectivity.
 Each ZF protein is able to recognize 3 contiguous nucleotide bases
within the DNA substrate.
Zinc finger nucleases (ZFNs) in gene modification
19αHelix
β Sheet
His
His
𝒁𝒏+𝟐
Cys
Cys

20. ZFNs
 A generic ZFN monomer is fused by two
functional distinct domains: an artificially
prepared Cys2-His2 ZF domain at the N-terminal
and a nonspecific DNA cleavage domain of
the Fok I DNA restriction enzyme at the C-
terminal.
The dimerization of the Fok I domain is crucial for
its enzymatic activity.
Therefore, a ZFN dimer composed of two 3- or 4-
ZF domains will recognize an 18- or 24-base
target sequence that, statistically, forms a unique
site in the genomes of most organisms.
20

21. Zinc finger nucleases (ZFNs) in gene
modification
21
Each ZF recognizes three baseWhen Fok1 make dimer structure it become active

22. ZFNs limitations
obtaining functional ZFNs requires an extensive
and time-consuming screening process.
toxic to the host cells
ZF domains have limited modularity due to the
context-dependent DNA-binding effects, making
it difficult for ZFNs to target any desired DNA
sequence (62).
lack of specificity of some ZF domains can
generate off-target cleavage, leading to undesired
mutations and chromosomal aberrations (38,63).
Recently, TALENs have rapidly emerged as an
alternative genome editing tool to ZFNs .
22

23. ZFNs (Zinc Finger Nucleases)
• ZFNs are created by fusing a zinc finger DNA-binding
domain, a small structural motif stabilized by coordinated
metal ions, to the DNA-cleavage domain of the nonspecific
FokI endonuclease.
• Zinc finger motifs are designed to bind to specific DNA
sequences, which are then cleaved by the nuclease active
site.
23

24. Applications of ZFN technology
1. gene disruption
2. gene insertion
3. gene correction
4. chromosomal rearrangement
1. Gene disruption
 The errors introduced during NHEJ-mediated chromosomal
DSB repair can be used to achieve gene disruption
 This approach has been applied in various mammalian cells to
efficiently knock out targeted genes in a single step .
 Cradick and coworkers (41) described a novel therapeutic
strategy for treatment of hepatitis B by using ZFNs to target
the hepatitis B virus genome.
 HR repair induced by DSB can be used for gene disruption 24

25. Applications of ZFN technology
2. Gene insertion
 Precise gene insertion can be achieved by ZFN-induced DNA repair .
3. Gene correction
 Gene correction is mediated by DSB-induced HR, which can be exploited
for gene replacement, especially for the treatment of monogenic diseases.
 Compared with gene insertion, in situ gene correction is more challenging
because the designed ZFN cleavage site must be close to or directly at the
site of the mutation .
 Zou and coworkers (53) achieved site-specific gene correction of the β-
globin gene in patient-derived human iPSCs.
3. Chromosomal rearrangements
 Chromosomal rearrangements include large-scale gene deletions,
insertions, duplications and inversions, which are associated with many
genetic diseases and cancer (57).
 ZFNs have been utilized to generate targeted chromosomal
rearrangements, which enables researchers to study gene functions at the
genomic level.
25

26. The concurrent DSBs generated by two endonucleases on different chromosomal loci will be
ligated by the NHEJ mechanism, resulting in chromosomal deletion, inversion or duplication.
Chromosomal rearrangements by ZFNs
26

27. TALENs(Transcription activator-like effector nucleases )
 Similar to ZFNs, TALENs use the non-specific FokI domain as the DNA
cleavage module and function as dimmers .
 the DNA binding domains of TALENs are composed of a series of tandem
repeats as in TALEs of the plant pathogenic bacteria from the genus
Xanthomonas .
 Each repeat comprises 33-35 aa and recognizes a single nucleotide.
 The last repeat typically has only 20 aa, and is therefore called a ‘half-
repeat’.
 The DNA recognition specificity is conferred by the highly variable amino
acids at positions 12 and 13 (e.g. NI recognizes adenine, HD recognizes
cytosine, NG recognizes thymine, and NN recognizes guanine and
adenine) (67,68).
 Unlike the context-dependent DNA binding of ZFNs, TALENs can be easily
and rapidly constructed to target essentially any DNA sequence due to the
simple protein-DNA code and the modular nature.
 TALENs exhibit significantly reduced off-target effects and cytotoxicities
compared with ZFNs, making them an efficient genome editing tool
(69,70).
27

28. TALENs and TAL Effectors
 TAL: Transcription Activator-Like
 Class of specific DNA binding protein
 Produced by plant bacteria in Xantomonas
 Modulates host gene expression
 RVD: Repeat-variable di-residue
 Residues at position 12 & 13 that give target specificity
 Double Strand Break Repair:
– Non-homologous End Joining (NHEJ)
– Homologous Recombination (HR)
28

29. TALLENs:Nuclease-based genome editing
Xanthomonas bacteria express TAL arrays to bind and
activate host promoters
TAL array is a series of DNA binding domains assembled to
recognise a specific sequence
33-34 amino acid sequence – only 12th and 13th residue
vary – and determine nucleotide binding.
We can construct these arrays, add a nuclease and use for
genome editing
TGAGGAGGCGGCAACGGCGGGCGCCGGGGCGGCGGGCCCCGGGGCGAGCA
ACTCCTCCGCCGTTGCCGCCCGCGGCCCCGCCGCCCGGGGCCCCGCTCGT
Fok1
Fok1
Cleavage
29

30. TALENs
Both the number of amino acid residues
between the TALE DNA binding domain and
the FokI cleavage domain and the number of
bases between the two individual TALEN
binding sites appear to be important
parameters for achieving high levels of
activity.
Changing RVD will change recognition site
(nucleotide type) and increases specify of
targeting region.
30

31. TALENs (Transcription activator-like effector nucleases )
Schematic of TALEN architecture. A TALEN is composed of a NTS (pink
box), a central repeat domain, a CTS (cyan box) and a FokI catalytic
domain (orange oval). The central repeat domain comprises a series of
repeat units that are responsible for specific recognition of thymine
(red boxes), adenine (green boxes), cytosine (blue boxes) and guanine
(yellow boxes). The formation of a heterodimer by two TALENs in a
tail-to-tail orientation at the target site executes a site-specific DNA
DSB. The TALE binding sites on the target DNA are shown in black and
the spacer is shown in grey.
31

32. TALENs(Transcription activator-like effector nucleases )
• There are four different TALE domains, one for each DNA
base, so they can be engineered to bind to specific DNA
sequences much more easily than ZFNs
• Like ZFNs, the nuclease part of TALENs is normally a FokI
nuclease.
• Two FokI molecules must come together to make a cut in
the DNA, so two TALENs are made, one for each strand.
32

33. TALENs
• TALENs are truly modular and not limited by
sequence requirements, but their large size
makes cell delivery challenging
33

34. Structure of TAL Effector & TALEN
RVD’s
34

35. CRISPR – Cas systems
 These are the part of the Bacterial immune system which detects
and recognize the foreign DNA and cleaves it.
 The CRISPR stand for Clustered Regularly Interspaced Short
Palindromic Repeats
 Cas (CRISPR- associated) proteins can target and cleave invading DNA
in a sequence-specific manner.
 A CRISPR array is composed of a series of repeats interspaced by
spacer sequences acquired from invading genomes.
35

36. History of CRISPR/Cas9 system
36

37. Action of CRISPR in bacteria
The CRISPR immune system works to protect
bacteria from repeated viral attack via three
basic steps:
Adaptation
Production of cr RNA
Targeting
37

38. Mechanism of adaptive immune sysytem against phage in Bacteria
(CRISPR/Cas System)
38

39. Spacer acquisition
When a microbe is invaded by a virus, the first
stage of the immune response is to capture viral
DNA and insert it into a CRISPR locus in the form
of a spacer.
 Cas1 and Cas2 are found in all three types of
CRISPR-Cas immune systems, which indicates that
they are involved in spacer acquisition.
New spacers are always added at the beginning of
the CRISPR next to the leader sequence creating a
chronological record of viral infections
39

40. CRISPR/cas system
 CRISPR-Cas system – an form of acquired immunity
found in bacteria.
 The guide RNA directs the Cas9 protein to a target site.
 Creating a guide RNA is very simple.
Cas9 Protein
Cleavage
Guide RNA
Nuclease-based genome editing
40

41. CRISPR Terms
 Cas (CRISPR Associate protein)—Genes found to be
associated with CRISPR sequences that encode the nuclease
or helicase proteins needed to identify and cut the targeted
DNA sequence.
- The first Cas protein to have its activity characterized was Cas9
from Streptococcus pyogenes and it is currently the preferred
Cas for CRISPR/Cas gene editing
 crRNA (CRISPR targeting RNA)—The transcribed region of the
unique “spacer” sequences found in CRISPR regions; crRNA
guides Cas proteins to foreign genetic elements. Requires
tracrRNA for complexing with Cas proteins.
 “Spacer” Sequence—Sequence found between palindromic
repeats on the CRISPR locus encoding phage DNA or – in the
case of engineered CRISPR gene targeting – sequences of the
target of interest.
41

42. CRISPR Terms
 TracrRNA (Trans-Activating crRNA)—A key small RNA in the
CRISPR mechanism. This RNA maintains two functions,
hybridizing with the crRNA repeat sequence and binding Cas
protein. The TracrRNA contains a sequence complementary
to the palindromic repeat section of the transcribed crRNA
Upon duplexing of this palindromic region, the
crRNA/tracrRNA complex can then bind to Cas proteins for
DNA targeting and cleavage.
 gRNA (Guide RNA)—The result of fusing the crRNA and
tracrRNA components of the CRISPR/Cas system into one
RNA molecule to targeted a specific sequence of genomic
DNA. gRNAs are not found in nature. The crRNA sequence
is synthesized in order to target the desired genomic DNA
while the tracrRNA sequence comes from bacterial
sequences needed to complex with Cas proteins. Guide
RNA can also be referred to as a single guide RNA (sgRNA).
42

43. CRISPR Terms
PAM (Protospacer Adjacent Motif)—Specific
DNA sequence that must follow the target DNA
sequence in order for Cas9 to bind and cut
DNA. Cas9 from Streptococcus pyogenes has a
PAM sequence of NGG. New and novel PAM
sequences have been identified in other Cas-like
proteins.
Target sequence—Genomic DNA targeted by the
CRISPR/Cas system. Typically the target sequence
is 20 nucleotides long and is immediately
followed by the PAM sequence.
43

44. CRISPR/Cas9 system components
1. CRISPR-RNA (crRNA) (Repeats plus Spacers) 2. tracrRNA (Trans-
Activating crRNA) 3. gRNA ( crRNA fused with tracrRNA) 4. Cas9 5.
target 6. Protospacer adjacent motif (PAM)
3. trans-activating crRNA(tracrRNA)
44

45. CRISPR/Cas gene editing
45

46. CRISPR-Cas9
 It is faster
 cheaper
 more accurate than previous techniques of editing
DNA
 wide range of potential applications
46

47. Mussolino, C., & Cathomen, T. (2013). RNA guides genome engineering. Nature biotechnology, 31(3), 208-209.
47

48. Comparison of ZFN, TALEN and CRISPR/Cas9 engineered nucleases.
* reported to greatly reduce cleavage activity of the TALEN (Meckler et al. 2013).
** can be overcomed since TALEs recognize methylated citosines as thymines in the major
groove
48

49. 49

50. References
• Mussolino, C., & Cathomen, T. (2013). RNA guides genome engineering. Nature
biotechnology, 31(3), 208-209.
• Sun N. Engineering of transcription activator-like effector nucleases (talens) for targeted
genome editing. University of Illinois at Urbana-Champaign; 2013.
• 41: Cradick, T.J., Keck, K., Bradshaw, S., Jamieson, A.C. and McCaffrey, A.P. (2010) Zinc-
finger nucleases as a novel therapeutic strategy for targeting hepatitis B virus DNAs. Mol
Ther, 18, 947-954.
• 53. Zou, J., Mali, P., Huang, X., Dowey, S.N. and Cheng, L. (2011) Site-specific gene
correction of a point mutation in human iPS cells derived from an adult patient with
sickle cell disease. Blood, 118, 4599-4608.
• 57. Feuk, L. (2010) Inversion variants in the human genome: role in disease and genome
architecture. Genome medicine, 2, 11.
• 38. Pattanayak, V., Ramirez, C.L., Joung, J.K. and Liu, D.R. (2011) Revealing off-target
cleavage specificities of zinc-finger nucleases by in vitro selection. Nat Methods, 8, 765-
770.
• 62. Ramirez, C.L., Foley, J.E., Wright, D.A., Muller-Lerch, F., Rahman, S.H., Cornu, T.I.,
Winfrey, R.J., Sander, J.D., Fu, F., Townsend, J.A. et al. (2008) Unexpected failure rates
for modular assembly of engineered zinc fingers. Nat Methods, 5, 374-375.
• 63. Radecke, S., Radecke, F., Cathomen, T. and Schwarz, K. (2010) Zinc-finger nuclease-
induced gene repair with oligodeoxynucleotides: wanted and unwanted target locus
modifications. Mol Ther, 18, 743-753.
50

51. References
• 67. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T.,
Nickstadt, A. and Bonas, U. (2009) Breaking the code of DNA binding specificity of
TAL-type III effectors. Science, 326, 1509-1512.
• 68. Moscou, M.J. and Bogdanove, A.J. (2009) A simple cipher governs DNA
recognition by TAL effectors. Science, 326, 1501.
• 69. Ding, Q., Lee, Y.K., Schaefer, E.A., Peters, D.T., Veres, A., Kim, K., Kuperwasser,
N., Motola, D.L., Meissner, T.B., Hendriks, W.T. et al. (2013) A TALEN Genome-
Editing System for Generating Human Stem Cell-Based Disease Models. Cell Stem
Cell, 12, 238-251.
• 70. Mussolino, C., Morbitzer, R., Lutge, F., Dannemann, N., Lahaye, T. and
Cathomen, T. (2011) A novel TALE nuclease scaffold enables high genome editing
activity in combination with low toxicity. Nucleic Acids Res, 39, 9283-
• http://www.bio-rad.com
• BIBIKOVA M, GOLIC M, GOLIC KG AND CARROLL D. 2002. Targeted chromosomal
cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics
161(3): 1169-1175.
• SANDER JD AND JOUNG JK. 2014. CRISPR-Cas systems for editing, regulating and
targeting genomes. Nat Biotechnol 32(4): 347-355.
51

52. References
• MECKLER JF ET AL. 2013. Quantitative analysis of TALE-DNA interactions suggests
polarity effects. Nucleic Acids Res 41(7): 4118-4128.
• 21: Pabo CO, Peisach E, Grant RA. Design and selection of novel Cys2His2 zinc
finger proteins. Annu Rev Biochem 2001; 70: 313–340.
• 22:Cathomen T, Joung JK. Zinc-finger nucleases: the next generation emerges. Mol
Ther 2008; 16: 1200–1207.
• 23:Pavletich NP, Pabo CO. Zinc finger-DNA recognition: crystal structure of a
Zif268-DNA complex at 2.1 A. Science 1991; 252: 809–817
• https://en.wikipedia.org/wiki/Meganuclease
52