2. OBJECTIVE
To evaluate the potential of a subunit vaccine based on a
fusion protein between two immunodominant antigens, Ag85B
and the 6-kDa early secretory antigenic target (ESAT-6)
3. Introduction
Tuberculosis(T.B)- contagious disease
Mycobacterium tuberculosis-causative agent
Gram positive
Acid fast bacilli
highly aerobic
Resistant to dessication
Infects lungs
Lipoarabinomannan and mycolic acids
Divides every 15-20 hrs
4. Types of tuberculosis
Latent TB disease
Active TB infection
Miliary TB infection
Symptoms
Cough with bloody sputum
Fever
Loss of appetite
Night sweat
Chest pain
Weight loss
7. Diagnosis
Tuberculin Skin Test (TST)
Chest Radiograph (X-ray)
Sputum Smear Microscopy (SSM)
Culture
Polymerase Chain Reaction (PCR)
Blood Test (e.g. the T-SPOT.TB test)
8. BCG vaccine
Effective vaccine against TB
Albert Calmette and Camille Guerin
Live attenuated Mycobacterium bovis
Need for subunit vaccine
BCG vaccine
• Revert back to virulent form
• Infection in immunocompromised patient
• Emergence of MDR strain
• False positive in diagnostic test
9. ESAT-6
Early secreted protein(6KDa)
Encoded by esxA in RD1 loci
ESX-Bacterial virulence
Mtb specific T cell antigen
Low immunogenicity molecule
diagnostic tool
10. Antigen 85B
30 kDa protein
Part of Ag85 complex
Mycolyl transferase activity
Cell wall of Mtb
Phagosome of Mtb infected macrophages
T cell and B cell epitopes
Elicit protective immune response
11. Expression of recombinant ESAT-6
Amplification of ESAT-6 gene from H37Rv by PCR
Restriction of PCR product by BglII and NcoI
Cloning of ESAT-6 into BglII and NcoI sites of pMCT6 containing
His tag sequence
Expression of ESAT-6 in E.coli XL1 blue
Purification of recombinant protein by metal ion affinity
chromatography containing Ni2+ ions
Analysis of ESAT-6 by SDS PAGE
Primers used:
Forward- 5’GAAGATCTATGACAGAGCAGCAGTGG (BglII site)
Reverse- 5’ CCGCCATGGTAAACACGAGAAAGGGCG (NcoI site)
12. Expression of recombinant Ag85B
Amplification of Ag85B from H37Rv by PCR
Cloning of PCR product into BglII and BamHII site of pMCT16
Expression of His tagged protein in E.coli XL1 blue
Purification of expressed protein on talon column followed by protein
anion exchange chromatography
Analysis of purified protein by SDS PAGE
Primers used: BglII
Ag85B-F1 - GGCAACCGCGAGATCTTTCTCCCGGCCGGGC
Ag85B-R2 –CCTTCGGTGGATCCCGTCAG
BamHI
13. Expression of fusion protein
PCR Amplification of ESAT-6 and Ag 85B using corresponding
primers
Fusion of Ag 85B-ESAT-6 and ESAT-6-Ag85B molecule at HindIII
site using F1-R1 and F2-R2 primer set accordingly
Cloning of fusion molecule into BglII/BamH1 pMCT6 in frame
with eight His residues
Expression of fusion protein, Ag85B and ESAT-6 in E.coli XL1 blue
Purification by ion exchange chromatography and analysis by SDS
PAGE
16. Vaccine preparation and immunization
procedure
Emulsification of vaccine doses from 0.01-50 µg with 250 µg
of dimethyl dioctadecylammonium bromide
Addition of 25 µg monophosphoryl lipid A (MPL)
Subcutaneous injection of C57BL/6J mice with 0.2 mL of
subunit vaccine with 2 weeks interval and BCG vaccine
An adjuvant alone as a negative control and naive mice as
control
17. IFN-γ releasing assay
After five weeks of first immunisation, isolation of PBMC on a
density gradient
Culturing of cells in 96 well microtitre plate containing 2 × 105
cells in a volume of 200 µL of RPMI 1640 medium supplemented
with 5× -10-5 M 2-mercaptoethanol, 1 mM glutamine, penicillin-
strepotmycine and 5% (vol/vol) fetal calf serum
Incubation of cells with Ag85B, ESAT-6 and fusion protein (5, 2.5
and 1.3 µg/mL)
After 72h of incubation, harvesting of culture supernatant.
Determination of IFN- γ by enzyme-linked immunosorbent assay
19. Experimental infections and bacterial
enumeration in organs.
After first immunization, injection of 100CFU of Mtb per lung through
aerosol route or i.v injection of 5*104 CFU of Mtb H37Rv suspended
in PBS in a volume of 0.2 ml.
Sacrification of mice after 2 weeks (i.v route) and 6 weeks (aerosol
route)
Removal and homogenization of lung and spleen in sterile saline and
plating onto Middlebrook 7H11 agar with 2 mg of 2-thiophene-
carboxylic acid hydrazide per ml
Incubation for 2 weeks at 37ºC and counting of colonies
21. Conclusion
Induces long term memory of immunity
Fusion protein and BCG vaccine-same efficacy
Superior protective efficacy
Multiple epitopes for B cell and T cell
Diagnostic tool
More defined product
22. REFERENCES1. Brandt, L., Elhay, M., Rosenkrands, I., Lindblad, E. B. and Andersen, P. (2000)
“ESAT-6 subunit vaccination against Mycobacterium tuberculosis”, Infection
and Immunity Vol.68, No.2,pp.791–795.
2. Brock, I., Munk, M. E., Kok-Jensen, A. and Andersen, P. (2001) “Performance of
whole blood IFN-gamma test for tuberculosis diagnosis based on PPD or the
specific antigens ESAT-6 and CFP-10”, The International Journal of
Tuberculosis and Lung Disease : The Official Journal of the International
Union against Tuberculosis and Lung Disease Vol.5, pp.462–467.
3. Brodin, P., Rosenkrands, I., Andersen, P., Cole, S. T. and Brosch, R. (2004)
“ESAT-6 proteins: Protective antigens and virulence factors”, Trends in
Microbiology Vol.2, No.11, pp.500–508.
4. Cockle, P. J., Gordon, S. V, Lalvani, a, Buddle, B. M., Hewinson, R. G. and
Vordermeier,H. M. (2002) “Identification of Novel Mycobacterium tuberculosis
Antigens with Potential as Diagnostic Reagents or Subunit Vaccine Candidates
by Comparative Genomics Identification of Novel Mycobacterium tuberculosis
Antigens with Potential as Diagnostic Reagents”, Infection and Immunity
Vol.70, pp.6996–7003
23. 5.Harboe, M., Malin, A. S., Dockrell, H. S., Wiker, H. G., Ulvund, G., Holm,
A., & Jørgensen, M. C. (1998). "B-Cell Epitopes and Quantification of the
ESAT-6 Protein of Mycobacterium tuberculosis", 66(2), 717–723.
6.Philips, J. A. and Ernst, J. D. (2012) “Tuberculosis Pathogenesis and
Immunity”, Annual Review of Pathology: Mechanisms of Disease Vol.7,
pp.353–384.
7.Ravn, P., Demissie, A., Eguale, T., Wondwosson, H., Lein, D., Amoudy, H.
A. And Andersen, P. (1999) “Human T cell responses to the ESAT-6 antigen
from Mycobacterium tuberculosis”, The Journal of Infectious Diseases
Vol.179, pp.637–645.
8. Zarif, Reza, Mojtaba Sankian, Aida Gholubi, Zahra Farshadzadeh, Saman
Soleimanpour, Forough Youssefi, Mehrangiz Khaje Karamoddini, Kiarash
Ghazvini, and Abdol Reza Varasteh. 2013. “Cloning and Expression of
Mycobacterium Tuberculosis Major Secreted Protein Antigen 85B (Ag85B)
in Escherichia Coli.” Jundishapur Journal of Microbiology 6 (2): 112–16