SlideShare a Scribd company logo
1 of 36
Genetic Code
R.C. Gupta
Professor and Head
Dept. of Biochemistry
National Institute of Medical Sciences
Jaipur, India
An overview of protein synthesis
A gene consists of a specific sequence of
nucleotides
Information about its amino acid
sequence is present in a gene
Every protein has got a unique amino
acid sequence
The base sequence in the gene encodes
a specific sequence of amino acids
When a protein is to be synthesized, the
corresponding gene is transcribed
An mRNA molecule is formed
The base sequence of mRNA is comple-
mentary to the sense strand of the gene
The code words on mRNA are known as
codons
The mRNA goes to cytosol and binds to a
ribosome
Amino acids are present in cytosol
They bind to specific tRNA molecules
This is known as charging of tRNAs
Each tRNA possesses an anticodon for a
particular amino acid
The anticodon is complementary to a
codon
The charged tRNAs go to the ribosome
Charged tRNAs find the complementary
codons on mRNA
Amino acids are joined in a sequence
directed by the codons on mRNA
This process is called translation
Structural gene
Transcription
3´ hnRNA
3´ mRNA
40S Subunit
of ribosome
60S Subunit
of ribosome
5´
tRNAs
DNA
Addition of cap and tail, and splicing
5´
5´
3´
a1
a2
an
+ + +
Amino acids Amino acyl tRNAs
+
a1 a2
a3
an an
a2a1
a3
The code words for amino acids are made
up of purine and pyrimidine bases
The bases are A, T, C and G in DNA and
A, U, C and G in RNA
How 20 amino acids could be encoded by
four bases was a mystery until 1960
Genetic code
It was surmised that:
• If each base acted as a code word,
only four code words would be possible
• If a pair of bases formed a code word, 42
i.e. 16 code words could be formed
• These are not sufficient to encode
20 amino acids
If the code word consists of 3 bases,
43 = 64 combinations are possible
Gamow was the first to suggest that each
code word is made up of three bases
This was proved in 1961 by Crick and his
associates
Crick et al did their experiments on phage
T4
They induced mutations in a gene by
inserting or deleting nucleotides
When one, two or four nucleotides were
inserted/deleted, the gene became inactive
When three nucleotides were inserted or
deleted, the gene remained active
They concluded that the smallest coding
unit in the gene is made up of three bases
In the same year, Nirenberg and Matthaei
deciphered the first codon
They prepared a synthetic polyribonucleo-
tide to be used in place of mRNA
The polyribonucleotide had only one base,
uracil, repeated again and again
The poly-U polyribonucleotide was added
to a cell-free protein-synthesizing system
The system synthesized a protein
14C-labeled amino acids were used to find
out which amino acids were incorporated in
the protein
The protein was found to have only
phenylalanine repeated again and again
This showed that UUU is a codon for
phenylalanine
Polyribonucleotide 5’ UUU UUU UUU UUU 3’
Peptide H2N- Phe- Phe- Phe- Phe- COOH
↓
Nirenberg and Matthaei also found that:
▪ Poly-C resulted in the synthesis of poly-proline
This showed that:
▪ CCC is the codon for proline
5’ CCC CCC CCC CCC 3’
↓
H2N- Pro- Pro- Pro- Pro-COOH
Using the same technique,
Severo Ochoa found that:
▪ Poly-A resulted in the synthesis
of poly-lysine
This proved that:
▪ AAA is the codon for lysine
5’ AAA AAA AAA AAA 3’
↓
H2N- Lys- Lys- Lys- Lys- COOH
Har Gobind Khorana
prepared synthetic
polyribonucleotides having
different base sequences
These were used in cell-
free protein-synthesizing
system
Amino acid sequences of
the peptides synthesized
were determined
When two bases, U and C, were
added alternately:
5’ UCU CUC UCU CUC 3’
H2N-Ser-Leu-Ser-Leu-COOH
This showed that UCU is the codon
for serine and CUC for leucine
The peptide synthesized had two
amino acids present alternately
A poly-ribonucleotide having four bases
repeated again and again was used
The peptide synthesized had four
amino acids repeated again and
again
These observations showed that:
UAU = Tyrosine
CUA = Leucine
UCU = Serine
AUC = Isoleucine
5’ UAUCUAUCUAUCUAUCUAUCUAUC 3’
H2N−Tyr−Leu−Ser−Ile−Tyr−Leu−Ser−Ile−COOH
↓
Using different base sequences,
Khorana deciphered the entire genetic
code by 1966
Of these, 61 are codons for amino
acids
It was found that all the 64 triplets are
code words
The remaining three codons do not code
for any amino acid
They are called nonsense codons
The nonsense codons also have a
function
They act as stop signals (chain
termination signals)
Codons on mRNA
UUU→Phe
UUC→Phe
UUA→Leu
UUG→Leu
UCU→Ser
UCC→Ser
UCA→Ser
UCG→Ser
UAU→Tyr
UAC→Tyr
UAA→Stop
UAG→Stop
UGU→Cys
UGC→Cys
UGA→Stop
UGG→Trp
CUU→Leu
CUC→Leu
CUA→Leu
CUG→Leu
CCU→Pro
CCC→Pro
CCA→Pro
CCG→Pro
CAU→His
CAC→His
CAA→Gln
CAG→Gln
CGU→Arg
CGC→Arg
CGA→Arg
CGG→Arg
AUU→Ile
AUC→Ile
AUA→Ile
AUG→Met
ACU→Thr
ACC→Thr
ACA→Thr
ACG→Thr
AAU→Asn
AAC→Asn
AAA→Lys
AAG→Lys
AGU→Ser
AGC→Ser
AGA→Arg
AGG→Arg
GUU→Val
GUC→Val
GUA→Val
GUG→Val
GCU→Ala
GCC→Ala
GCA→Ala
GCG→Ala
GAU→Asp
GAC→Asp
GAA→Glu
GAG→Glu
GGU→Gly
GGC→Gly
GGA→Gly
GGG→Gly
First base
at 5’-end
Third base
at 3’-end
U
C
A
G
Phe Ser Tyr Cys U
Phe Ser Tyr Cys C
Leu Ser Stop Stop A
Leu Ser Stop Trp G
Leu Pro His Arg U
Leu Pro His Arg C
Leu Pro Gln Arg A
Leu Pro Gln Arg G
Ile Thr Asn Ser U
Ile Thr Asn Ser C
Ile Thr Lys Arg A
Met Thr Lys Arg G
Val Ala Asp Gly U
Val Ala Asp Gly C
Val Ala Glu Gly A
Val Ala Glu Gly G
Second base
U C A G
UAA UAG UGA
AUG
Start Codon
Stop Codons
Codons having a special function
Salient features
of genetic code:
Degeneracy
Unambiguity
Universality
Absence of
punctuations
EMB-RCG
Degeneracy
EMB-RCG
Only tryptophan and methionine have a
single codon each
All the other amino acids are encoded by
more than one codons
Leucine, serine and arginine have six
codons each
Coding of one amino acid by multiple
codons is known as degeneracy
EMB-RCG
Degeneracy resides mainly in the third
base of the codon
For example, the four codons for alanine
are GCU, GCC, GCA and GCG
In these, the first two bases are common
and only the third base is different
Degeneracy confers an advantage
If the third base of a codon is subs-
tituted due to a mutation:
Amino acid sequence of
the protein may not change
The new codon may encode
the same amino acid
Unambiguity
A given codon codes only for one
particular amino acid
This is known as unambiguity of the
genetic code
Unambiguity ensures correct
translation of genetic information
EMB-RCG
Universality
The genetic code is identical in all
living organisms
However, some variations are found
in mitochondrial DNA
Therefore, the genetic code is nearly
universal
EMB-RCG
In mitochondria
AUA is the codon for methionine
instead of leucine
UGA is the codon for tryptophan
instead of being a stop signal
AGA and AGG are stop signals
instead of codons for arginine
EMB-RCG
Absence of punctuations
The genetic code is read continuously
from the start site
There are no commas or full stops
to indicate where a codon has ended
Therefore, insertion or deletion of a
base changes the reading frame
EMB-RCG
EMB-RCG
Addition of
G after the
third base
Removal of
U after the
third base
UGG UGG UGG UGG UGG
Trp Trp Trp Trp Trp
UGG GUG GUG GUG GUG
Trp Val Val Val Val
UGG GGU GGU GGU GGU
Trp Gly Gly Gly Gly
Altered code Altered code
Normal code

More Related Content

What's hot

Replication In Eukaryotes and Prokaryotes
Replication In Eukaryotes and ProkaryotesReplication In Eukaryotes and Prokaryotes
Replication In Eukaryotes and ProkaryotesM Nadeem Akram
 
DNA polymerase proofreading and processivity.pptx
DNA polymerase proofreading and processivity.pptxDNA polymerase proofreading and processivity.pptx
DNA polymerase proofreading and processivity.pptxArupKhakhlari1
 
Polyadenylation
PolyadenylationPolyadenylation
PolyadenylationEmaSushan
 
Post transcriptional modifications
Post transcriptional modificationsPost transcriptional modifications
Post transcriptional modificationsPrasanna R Kovath
 
Charging of tRNA, Aminoacyl tRNA Synthetases
Charging of tRNA, Aminoacyl tRNA Synthetases Charging of tRNA, Aminoacyl tRNA Synthetases
Charging of tRNA, Aminoacyl tRNA Synthetases J K COLLEGE,PURULIA
 
DNA replication, repair and recombination Notes
DNA replication, repair and recombination NotesDNA replication, repair and recombination Notes
DNA replication, repair and recombination NotesYi Fan Chen
 
Regulation of gene expression in eukaryotes
Regulation of gene expression in eukaryotesRegulation of gene expression in eukaryotes
Regulation of gene expression in eukaryotesAnna Purna
 
DNA Replication -
DNA Replication -DNA Replication -
DNA Replication -Ashok Katta
 
presentation on eukaryotic dna replication
presentation on eukaryotic dna replicationpresentation on eukaryotic dna replication
presentation on eukaryotic dna replicationDevendra Upreti
 

What's hot (20)

Dna replication
Dna replication Dna replication
Dna replication
 
Nucleic Acids and DNA
Nucleic Acids and DNA Nucleic Acids and DNA
Nucleic Acids and DNA
 
Replication In Eukaryotes and Prokaryotes
Replication In Eukaryotes and ProkaryotesReplication In Eukaryotes and Prokaryotes
Replication In Eukaryotes and Prokaryotes
 
DNA polymerase proofreading and processivity.pptx
DNA polymerase proofreading and processivity.pptxDNA polymerase proofreading and processivity.pptx
DNA polymerase proofreading and processivity.pptx
 
Polyadenylation
PolyadenylationPolyadenylation
Polyadenylation
 
Replication
ReplicationReplication
Replication
 
Post transcriptional modifications
Post transcriptional modificationsPost transcriptional modifications
Post transcriptional modifications
 
The central dogma
The central dogmaThe central dogma
The central dogma
 
Eukaryotic transcription
Eukaryotic transcription Eukaryotic transcription
Eukaryotic transcription
 
Dna and rna
Dna and rnaDna and rna
Dna and rna
 
Histones
HistonesHistones
Histones
 
R rna processing
R rna processingR rna processing
R rna processing
 
Charging of tRNA, Aminoacyl tRNA Synthetases
Charging of tRNA, Aminoacyl tRNA Synthetases Charging of tRNA, Aminoacyl tRNA Synthetases
Charging of tRNA, Aminoacyl tRNA Synthetases
 
TRANSLATION
TRANSLATIONTRANSLATION
TRANSLATION
 
DNA replication, repair and recombination Notes
DNA replication, repair and recombination NotesDNA replication, repair and recombination Notes
DNA replication, repair and recombination Notes
 
Regulation of gene expression in eukaryotes
Regulation of gene expression in eukaryotesRegulation of gene expression in eukaryotes
Regulation of gene expression in eukaryotes
 
DNA Replication -
DNA Replication -DNA Replication -
DNA Replication -
 
Translation
TranslationTranslation
Translation
 
Lecture 8
Lecture 8Lecture 8
Lecture 8
 
presentation on eukaryotic dna replication
presentation on eukaryotic dna replicationpresentation on eukaryotic dna replication
presentation on eukaryotic dna replication
 

Similar to Genetic code

Similar to Genetic code (20)

Genetic code
Genetic codeGenetic code
Genetic code
 
Deciphering of the genetic code
Deciphering of the genetic codeDeciphering of the genetic code
Deciphering of the genetic code
 
Genetic code
Genetic codeGenetic code
Genetic code
 
Lesson 13.2
Lesson 13.2Lesson 13.2
Lesson 13.2
 
Dna and protein synthesis
Dna and protein synthesisDna and protein synthesis
Dna and protein synthesis
 
Powerpoint 13.2
Powerpoint 13.2Powerpoint 13.2
Powerpoint 13.2
 
Genetic Code and Translation.pdf
Genetic Code and Translation.pdfGenetic Code and Translation.pdf
Genetic Code and Translation.pdf
 
THE GENETIC CODE.pptx
THE GENETIC CODE.pptxTHE GENETIC CODE.pptx
THE GENETIC CODE.pptx
 
Translation of of mRNA to protein
Translation of of mRNA to proteinTranslation of of mRNA to protein
Translation of of mRNA to protein
 
Genetic code properties
Genetic code properties Genetic code properties
Genetic code properties
 
Genetic code
Genetic codeGenetic code
Genetic code
 
The-Genetic-code-converted.pptx
The-Genetic-code-converted.pptxThe-Genetic-code-converted.pptx
The-Genetic-code-converted.pptx
 
Synthesis of Proteins or the Formation of the Conga Line
Synthesis of Proteins or the Formation of the Conga LineSynthesis of Proteins or the Formation of the Conga Line
Synthesis of Proteins or the Formation of the Conga Line
 
Translation
TranslationTranslation
Translation
 
Genetic code.pptx
Genetic code.pptxGenetic code.pptx
Genetic code.pptx
 
Genetic code and transcription
Genetic code and transcriptionGenetic code and transcription
Genetic code and transcription
 
Genetic code and transcription
Genetic code and transcriptionGenetic code and transcription
Genetic code and transcription
 
Subin cology
Subin cologySubin cology
Subin cology
 
The genetic material
The genetic materialThe genetic material
The genetic material
 
3.5 transcription & translation
3.5 transcription & translation3.5 transcription & translation
3.5 transcription & translation
 

More from Ramesh Gupta

Ethical issues in research.pptx
Ethical issues in research.pptxEthical issues in research.pptx
Ethical issues in research.pptxRamesh Gupta
 
Writing a research paper.pptx
Writing a research paper.pptxWriting a research paper.pptx
Writing a research paper.pptxRamesh Gupta
 
Research - An Overview.pptx
Research - An Overview.pptxResearch - An Overview.pptx
Research - An Overview.pptxRamesh Gupta
 
MCQs on Chemistry of Lipids
MCQs on Chemistry of LipidsMCQs on Chemistry of Lipids
MCQs on Chemistry of LipidsRamesh Gupta
 
MCQs on Chemistry of Carbohydrates
MCQs on Chemistry of CarbohydratesMCQs on Chemistry of Carbohydrates
MCQs on Chemistry of CarbohydratesRamesh Gupta
 
Cell mediated immunity
Cell mediated immunityCell mediated immunity
Cell mediated immunityRamesh Gupta
 
Indian medical graduate - goals, roles and competencies
Indian medical graduate -  goals, roles and competenciesIndian medical graduate -  goals, roles and competencies
Indian medical graduate - goals, roles and competenciesRamesh Gupta
 
Educational networking
Educational networkingEducational networking
Educational networkingRamesh Gupta
 
Acid base balance - Regulation of pH of body fluids
Acid base balance - Regulation of pH of body fluidsAcid base balance - Regulation of pH of body fluids
Acid base balance - Regulation of pH of body fluidsRamesh Gupta
 
Enzymes - The biological catalysts
Enzymes - The biological catalystsEnzymes - The biological catalysts
Enzymes - The biological catalystsRamesh Gupta
 
Chemistry of amino acids
Chemistry of amino acidsChemistry of amino acids
Chemistry of amino acidsRamesh Gupta
 
Metabolism of nucleotides
Metabolism of nucleotidesMetabolism of nucleotides
Metabolism of nucleotidesRamesh Gupta
 
Biochemistry an overview
Biochemistry   an overviewBiochemistry   an overview
Biochemistry an overviewRamesh Gupta
 
Cell cycle and apoptosis
Cell cycle and apoptosisCell cycle and apoptosis
Cell cycle and apoptosisRamesh Gupta
 
Recombinant dna technology applications
Recombinant dna technology   applicationsRecombinant dna technology   applications
Recombinant dna technology applicationsRamesh Gupta
 
Recombinant dna technology tools and techniques
Recombinant dna technology   tools and techniquesRecombinant dna technology   tools and techniques
Recombinant dna technology tools and techniquesRamesh Gupta
 

More from Ramesh Gupta (20)

Ethical issues in research.pptx
Ethical issues in research.pptxEthical issues in research.pptx
Ethical issues in research.pptx
 
Writing a research paper.pptx
Writing a research paper.pptxWriting a research paper.pptx
Writing a research paper.pptx
 
Research - An Overview.pptx
Research - An Overview.pptxResearch - An Overview.pptx
Research - An Overview.pptx
 
MCQs on Chemistry of Lipids
MCQs on Chemistry of LipidsMCQs on Chemistry of Lipids
MCQs on Chemistry of Lipids
 
MCQs on Chemistry of Carbohydrates
MCQs on Chemistry of CarbohydratesMCQs on Chemistry of Carbohydrates
MCQs on Chemistry of Carbohydrates
 
Cell mediated immunity
Cell mediated immunityCell mediated immunity
Cell mediated immunity
 
Humoral immunity
Humoral immunityHumoral immunity
Humoral immunity
 
Indian medical graduate - goals, roles and competencies
Indian medical graduate -  goals, roles and competenciesIndian medical graduate -  goals, roles and competencies
Indian medical graduate - goals, roles and competencies
 
Educational networking
Educational networkingEducational networking
Educational networking
 
Acid base balance - Regulation of pH of body fluids
Acid base balance - Regulation of pH of body fluidsAcid base balance - Regulation of pH of body fluids
Acid base balance - Regulation of pH of body fluids
 
Enzymes - The biological catalysts
Enzymes - The biological catalystsEnzymes - The biological catalysts
Enzymes - The biological catalysts
 
Chemistry of amino acids
Chemistry of amino acidsChemistry of amino acids
Chemistry of amino acids
 
Metabolism of nucleotides
Metabolism of nucleotidesMetabolism of nucleotides
Metabolism of nucleotides
 
Biochemistry an overview
Biochemistry   an overviewBiochemistry   an overview
Biochemistry an overview
 
Cell cycle and apoptosis
Cell cycle and apoptosisCell cycle and apoptosis
Cell cycle and apoptosis
 
Cancer and genes
Cancer and genesCancer and genes
Cancer and genes
 
Recombinant dna technology applications
Recombinant dna technology   applicationsRecombinant dna technology   applications
Recombinant dna technology applications
 
Recombinant dna technology tools and techniques
Recombinant dna technology   tools and techniquesRecombinant dna technology   tools and techniques
Recombinant dna technology tools and techniques
 
Rna interference
Rna interferenceRna interference
Rna interference
 
Protein synthesis
Protein synthesisProtein synthesis
Protein synthesis
 

Recently uploaded

Call Girls Hosur Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hosur Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hosur Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hosur Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...narwatsonia7
 
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingCall Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingNehru place Escorts
 
Call Girl Lucknow Mallika 7001305949 Independent Escort Service Lucknow
Call Girl Lucknow Mallika 7001305949 Independent Escort Service LucknowCall Girl Lucknow Mallika 7001305949 Independent Escort Service Lucknow
Call Girl Lucknow Mallika 7001305949 Independent Escort Service Lucknownarwatsonia7
 
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service LucknowVIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknownarwatsonia7
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service SuratCall Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service Suratnarwatsonia7
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...narwatsonia7
 
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original PhotosCall Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photosnarwatsonia7
 
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service MumbaiLow Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...narwatsonia7
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowRiya Pathan
 
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort ServiceCall Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Serviceparulsinha
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliRewAs ALI
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...narwatsonia7
 

Recently uploaded (20)

Call Girls Hosur Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hosur Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hosur Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hosur Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
 
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Servicesauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
 
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Electronic City Just Call 7001305949 Top Class Call Girl Service A...
 
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment BookingCall Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
Call Girls Service Nandiambakkam | 7001305949 At Low Cost Cash Payment Booking
 
Call Girl Lucknow Mallika 7001305949 Independent Escort Service Lucknow
Call Girl Lucknow Mallika 7001305949 Independent Escort Service LucknowCall Girl Lucknow Mallika 7001305949 Independent Escort Service Lucknow
Call Girl Lucknow Mallika 7001305949 Independent Escort Service Lucknow
 
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service LucknowVIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
VIP Call Girls Lucknow Nandini 7001305949 Independent Escort Service Lucknow
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
 
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
 
Call Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service SuratCall Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service Surat
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
 
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
 
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original PhotosCall Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
Call Girl Service Bidadi - For 7001305949 Cheap & Best with original Photos
 
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service MumbaiLow Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
 
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort ServiceCall Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
Call Girls Service In Shyam Nagar Whatsapp 8445551418 Independent Escort Service
 
Aspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas AliAspirin presentation slides by Dr. Rewas Ali
Aspirin presentation slides by Dr. Rewas Ali
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
 

Genetic code

  • 1. Genetic Code R.C. Gupta Professor and Head Dept. of Biochemistry National Institute of Medical Sciences Jaipur, India
  • 2. An overview of protein synthesis A gene consists of a specific sequence of nucleotides Information about its amino acid sequence is present in a gene Every protein has got a unique amino acid sequence
  • 3. The base sequence in the gene encodes a specific sequence of amino acids When a protein is to be synthesized, the corresponding gene is transcribed An mRNA molecule is formed
  • 4. The base sequence of mRNA is comple- mentary to the sense strand of the gene The code words on mRNA are known as codons The mRNA goes to cytosol and binds to a ribosome
  • 5. Amino acids are present in cytosol They bind to specific tRNA molecules This is known as charging of tRNAs
  • 6. Each tRNA possesses an anticodon for a particular amino acid The anticodon is complementary to a codon The charged tRNAs go to the ribosome
  • 7. Charged tRNAs find the complementary codons on mRNA Amino acids are joined in a sequence directed by the codons on mRNA This process is called translation
  • 8. Structural gene Transcription 3´ hnRNA 3´ mRNA 40S Subunit of ribosome 60S Subunit of ribosome 5´ tRNAs DNA Addition of cap and tail, and splicing 5´ 5´ 3´ a1 a2 an + + + Amino acids Amino acyl tRNAs + a1 a2 a3 an an a2a1 a3
  • 9. The code words for amino acids are made up of purine and pyrimidine bases The bases are A, T, C and G in DNA and A, U, C and G in RNA How 20 amino acids could be encoded by four bases was a mystery until 1960 Genetic code
  • 10. It was surmised that: • If each base acted as a code word, only four code words would be possible • If a pair of bases formed a code word, 42 i.e. 16 code words could be formed • These are not sufficient to encode 20 amino acids
  • 11. If the code word consists of 3 bases, 43 = 64 combinations are possible Gamow was the first to suggest that each code word is made up of three bases This was proved in 1961 by Crick and his associates
  • 12. Crick et al did their experiments on phage T4 They induced mutations in a gene by inserting or deleting nucleotides
  • 13. When one, two or four nucleotides were inserted/deleted, the gene became inactive When three nucleotides were inserted or deleted, the gene remained active They concluded that the smallest coding unit in the gene is made up of three bases
  • 14. In the same year, Nirenberg and Matthaei deciphered the first codon They prepared a synthetic polyribonucleo- tide to be used in place of mRNA The polyribonucleotide had only one base, uracil, repeated again and again
  • 15. The poly-U polyribonucleotide was added to a cell-free protein-synthesizing system The system synthesized a protein 14C-labeled amino acids were used to find out which amino acids were incorporated in the protein
  • 16. The protein was found to have only phenylalanine repeated again and again This showed that UUU is a codon for phenylalanine Polyribonucleotide 5’ UUU UUU UUU UUU 3’ Peptide H2N- Phe- Phe- Phe- Phe- COOH ↓
  • 17. Nirenberg and Matthaei also found that: ▪ Poly-C resulted in the synthesis of poly-proline This showed that: ▪ CCC is the codon for proline 5’ CCC CCC CCC CCC 3’ ↓ H2N- Pro- Pro- Pro- Pro-COOH
  • 18. Using the same technique, Severo Ochoa found that: ▪ Poly-A resulted in the synthesis of poly-lysine This proved that: ▪ AAA is the codon for lysine 5’ AAA AAA AAA AAA 3’ ↓ H2N- Lys- Lys- Lys- Lys- COOH
  • 19. Har Gobind Khorana prepared synthetic polyribonucleotides having different base sequences These were used in cell- free protein-synthesizing system Amino acid sequences of the peptides synthesized were determined
  • 20. When two bases, U and C, were added alternately: 5’ UCU CUC UCU CUC 3’ H2N-Ser-Leu-Ser-Leu-COOH This showed that UCU is the codon for serine and CUC for leucine The peptide synthesized had two amino acids present alternately
  • 21. A poly-ribonucleotide having four bases repeated again and again was used The peptide synthesized had four amino acids repeated again and again
  • 22. These observations showed that: UAU = Tyrosine CUA = Leucine UCU = Serine AUC = Isoleucine 5’ UAUCUAUCUAUCUAUCUAUCUAUC 3’ H2N−Tyr−Leu−Ser−Ile−Tyr−Leu−Ser−Ile−COOH ↓
  • 23. Using different base sequences, Khorana deciphered the entire genetic code by 1966 Of these, 61 are codons for amino acids It was found that all the 64 triplets are code words
  • 24. The remaining three codons do not code for any amino acid They are called nonsense codons The nonsense codons also have a function They act as stop signals (chain termination signals)
  • 26. First base at 5’-end Third base at 3’-end U C A G Phe Ser Tyr Cys U Phe Ser Tyr Cys C Leu Ser Stop Stop A Leu Ser Stop Trp G Leu Pro His Arg U Leu Pro His Arg C Leu Pro Gln Arg A Leu Pro Gln Arg G Ile Thr Asn Ser U Ile Thr Asn Ser C Ile Thr Lys Arg A Met Thr Lys Arg G Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly G Second base U C A G
  • 27. UAA UAG UGA AUG Start Codon Stop Codons Codons having a special function
  • 28. Salient features of genetic code: Degeneracy Unambiguity Universality Absence of punctuations EMB-RCG
  • 29. Degeneracy EMB-RCG Only tryptophan and methionine have a single codon each All the other amino acids are encoded by more than one codons Leucine, serine and arginine have six codons each Coding of one amino acid by multiple codons is known as degeneracy
  • 30. EMB-RCG Degeneracy resides mainly in the third base of the codon For example, the four codons for alanine are GCU, GCC, GCA and GCG In these, the first two bases are common and only the third base is different
  • 31. Degeneracy confers an advantage If the third base of a codon is subs- tituted due to a mutation: Amino acid sequence of the protein may not change The new codon may encode the same amino acid
  • 32. Unambiguity A given codon codes only for one particular amino acid This is known as unambiguity of the genetic code Unambiguity ensures correct translation of genetic information EMB-RCG
  • 33. Universality The genetic code is identical in all living organisms However, some variations are found in mitochondrial DNA Therefore, the genetic code is nearly universal EMB-RCG
  • 34. In mitochondria AUA is the codon for methionine instead of leucine UGA is the codon for tryptophan instead of being a stop signal AGA and AGG are stop signals instead of codons for arginine EMB-RCG
  • 35. Absence of punctuations The genetic code is read continuously from the start site There are no commas or full stops to indicate where a codon has ended Therefore, insertion or deletion of a base changes the reading frame EMB-RCG
  • 36. EMB-RCG Addition of G after the third base Removal of U after the third base UGG UGG UGG UGG UGG Trp Trp Trp Trp Trp UGG GUG GUG GUG GUG Trp Val Val Val Val UGG GGU GGU GGU GGU Trp Gly Gly Gly Gly Altered code Altered code Normal code