Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Αθανάσιος Τσαυτάρης_ Η Ελλάδα Μετά


Published on

Παρουσίαση Αθανάσιου Τσαυτάρη στο Συνέδριο του Κύκλου Ιδεών, Η Ελλάδα Μετά, 12 κ 13 Ιουνίου.
Κύκλος 4 «Η επανάσταση του αυτονόητου-Πεδία ανάπτυξης.»

Published in: Government & Nonprofit
  • Be the first to comment

  • Be the first to like this

Αθανάσιος Τσαυτάρης_ Η Ελλάδα Μετά

  1. 1. Eξελίξεις στη Γονιδιωματική και Βιοπληροφορική και οι Εφαρμογές τους Αθανάσιος Τσαυτάρης
  2. 2. ΓΕΝΕΤΙΚΗ
  3. 3. Οι Ολυμπιακοί ήταν οι παλαιότεροι και πιο σημαντικοί από όλους τους ελληνικούς αγώνες. Ήταν η μεγαλύτερη θρησκευτική γιορτή, ανάμεσα στις γιορτές τις αφιερωμένες στο Δία, τον ανώτατο θεό. Το ιερό της Ολυμπίας επέβαλλε το κύρος του σε ολόκληρο τον ελληνικό κόσμο, ενώ σύντομα οι Ολυμπιακοί Αγώνες έγιναν το σύμβολο της πανελλήνιας ενότητας. Οι Ολυμπιακοί Αγώνες τελούνταν κάθε τέσσερα χρόνια τις πιο ζεστές ημέρες του καλοκαιριού. Μια σειρά αθλητικών αγώνων γίνονταν στο Στάδιο, το Ιπποδρόμιο και άλλους χώρους της θέσης, μπροστά σε χιλιάδες θεατές από όλες τις πόλεις του γνωστού ελληνικού κόσμου. Οι νικητές στεφανώνονταν με ένα στεφάνι αγριελιάς και απολάμβαναν ιδιαίτερες τιμές από την πατρίδα τους. Γενετική Γονιδιωματική Αναγνώριση βάσης Ποιότητα αλληλουχίας Απομάκρυνση φορέα Σύνδεση αλληλουχιών Αυτόματη αλληλούχιση λογισμικό >Gene ACCTGTCAGTGTCAACTGCTTCAA TAGCTAATGCTAGGCTCGATAATC GCTGGCCTCAGCTCAGTCT
  5. 5. NGS
  7. 7. Αλληλουχημένα Γονιδιώματα Φυτών
  8. 8. Γενετική Επιγενετική Κληρονομήσιμη αλλαγή χαρακτήρων που δεν περιλαμβάνει αλλαγή στην αλληλουχία του DNA Κληρονομήσιμη αλλαγή χαρακτήρων που περιλαμβάνει αλλαγή στην αλληλουχία του DNA M M M M M M M M M M M M M ΚΑΛΟΣ ΚΑΚΟΣ ΠΑΝΩΡΑΙΑ ΩΡΑΙΑ Καλός Κάλος
  9. 9. Μικρός καρπόςΜικρός καρπός Μεγάλος καρπόςΜεγάλος καρπός Γονική αποτύπωση
  10. 10. Small Seed Large Seed
  11. 11. CH3 Φολικό οξύ
  12. 12. CH3 Φολικό οξύ σε τρόφιμα ζωϊκής προέλευσης
  13. 13. CH3 Φολικό οξύ σε τρόφιμα φυτικής προέλευσης
  14. 14. Principle Nutrient Value Percentage of RDA Energy 573 Kcal 29% Carbohydrates 23.45 g 18% Protein 17.73 g 32% Total Fat 49.67 g 166% Cholesterol 0 mg 0% Dietary Fiber 11.8 g 31% Vitamins Folates 97 µg 25% Niacin 4.515 mg 28% Pantothenic acid 0.050 mg 1% Pyridoxine 0.790 mg 61% Riboflavin 0.247 mg 19% Thiamin 0.791 mg 66% Vitamin A 9 IU <1% Vitamin C 0 0% Vitamin E 0.25 mg 2% Electrolytes Sodium 11 mg 1% Potassium 468 mg 10% Minerals Calcium 975 mg 98% Copper 4.082 mg 453% Iron 14.55 mg 182% Magnesium 351 mg 88% Manganese 2.460 mg 107% Phosphorus 629 mg 90% Selenium 34.4 µg 62.5% Zinc 7.75 mg 70% Phyto-nutrients Carotene-ß 5 µg -- Crypto-xanthin-ß 0 µg -- Lutein-zeaxanthin 0 µg -- Nutritional value per 100 g. (Source: USDA National Nutrient data base) ΣΟΥΣΑΜΙ ΩΣ SUPER FOOD
  15. 15. Yellow Mouse Agouti Mouse Cooney et al. J Nutr 132:2393S (2002) Maternal Supplements with zinc methionine betaine choline, folate B12 High risk cancer, diabetes, obesity & reduced lifespan Lower risk of cancer, diabetes, obesity and prolonged life LTR Hypomethylated LTR HypermethylatedWhen to Intervene??
  16. 16. Epigenetic Mechanisms
  18. 18. Epigenetic Bioactive compounds in plants
