You have constructed a new reporter gene to help you find novel zebr.pdf

•

0 likes•2 views

You have constructed a new reporter gene to help you find novel zebrafish mutations. The reporter gene consists of several LEG/TCF binding domains in the enhancer fused to the coding region for green fluorescent protein (GFP). Wild-type embryos that contain this transgene normally express it in the brain and eye primordia and have no developmental defects. You then mutagenize this reporter strain to look for new mutants that affect GFP expression. Which developmental pathway are these mutants likely to be in and why? You find a mutant (which you call GLO-1) that ubiquitously expresses your reporter gene throughout the entire embryo. Which molecule in the above pathway is most likely to be mutated and why? Solution Ans.) Nacre, a zebrafish homolog of MITF is required for pigment cell differentiation. We isolated a promoter region of shell that contains Tcf/Lef binding sites which will mediate Wnt responsiveness. This promoter binds to zebrafish Lef1 protein in vitro, and a nacre communicator construct is powerfully inhibited by dominant-negative Tcf in malignant melanoma cells. Mutation of Tcf/Lef sites abolishes Lef1 binding and reporter operates in vivo. Wnt signaling so directly activates shell, which in flip ends up in pigment cell differentiation. It was determined that the human melanocyte-specific MITF promoter contains many purported Tcf/Lef binding sites, hallmarks of Wnt/-catenin-mediated transcriptional control. To test the hypothesis that nacre could be a target of the Wnt/-catenin pathway in zebrafish, a promoter/enhancer region is isolated for this sequence from a genomic bacteriophage library. This genomic fragment contains the translation initiation site for nacre which is associated with a 836-bp upstream region with a possible transcription begin site, a cAMP response element (CRE) and several agreement Tcf/Lef binding sites. These CRE and Tcf/Lef locations are not fully preserved between the human and zebrafish promoters in either their sequences or their positions from the transcription begin site. To examine whether the purported putative nacre promoter/enhancer will direct correct abstraction management of organic phenomenon, injected one -cell zebrafish embryos with the 836-bp deoxyribonucleic acid fragment driving a green fluorescent macromolecule (GFP) communicator sequence. Mosaic gene expression is typical for transient transgenics in zebrafish and because the neural crest springs from only a few precursor cells, reporter potency is minimized. Despite these, it was ready to analyze the fate of the few reporter-expressing cells in injected animals..

Education

Similar to You have constructed a new reporter gene to help you find novel zebr.pdf

Transcriptional and post transcriptional regulation of gene expression

Dr. Kirti Mehta

Gene regulation prokaryote spptx

aljeirou

Genentech Final Paper

Pavel Morales

Promoters used in expression vectors

NaSir32

Does yeast have a post translation pathway for protein synthesis?If so how does it work? Please start explaining from nucleus transcription to translation in yeast with the promoters or genes that are specific to yeast. Solution Yes, yeast has post translational pathway for protein synthesis. The central dogma of molecular biology proposes that information flows from DNA to RNA through the process of transcription and from RNA to protein through translation. In eukaryotic cells like yeast cells, they posses phospholipid membranes allowing diverse biochemical and metabolic activities to be carried out simultaneously in distinct subcellular compartments.The membrane-bound organelles creates a requirement for the efficient targeting of proteins, which are primarily synthesised by ribosomes located in the cytosol, to the appropriate intracellular location.These proteins are first targeted to and translocated across the membrane of the endoplasmic reticulum (ER). The tail-anchor (TA) proteins are located at the C-terminus of the polypeptide.Therefore, by the time that the ER targeting signal is exposed to cytosolic factors the polypeptide will be released from the ribosome and TA proteins are post- translationally inserted into the ER membrane.Tail-anchored proteins are inserted by TRC40/Get3. A promoter is a DNA sequence that can recruit transcriptional machinery and lead to transcription of the downstream DNA sequence. All the yeast promoters depend on the availability of RNA polymerase holoenzyme, but is not affected by any transcriptional regulators..

Does yeast have a post translation pathway for protein synthesisIf .pdf

arjunhassan8

Oncotarget Olga´s paper

Olga Villamizar

Regulation of gene expression

MANSI

Gene Expression.pptx

MuhammadAli732496

Describe a growth factor signalling pathway highlighting components.pdf

bkbk37

Cell signaling her2 expression in breast cancer

Omid Yeganeh

PNAS-2013-Arambula-8212-7

Wenge Wong

Please answer the discussion questions and TYPE you answers. MINICASE ARE YOU REALLY BUYING AMERICAN? Consider the follawing scenario of a typical\" American fam work, stopping for gas at the Shell station. At the grocery ily: The Osbornes, Jesse and Ann, live in the suburbs of store, she fills her cart with a variety of items, including Chicago Jesse is a manager at Trader Joe\'s specialty grocery Ragu spaghetti sauce, Hellmann\'s mayonnaise, Carnation store chain. Ann is an edvertising executive for Leo Burnett Instant Breakfast drink, a case of Arrowhead water, CoffeeMate nondairy coffee creamer, Chicken-of the-Sea Ann listens to the new Adam Lambert CD on her Alpine car stereo in her Jeep Cherakes while driving homa from canned tuna, Lipton tea, a hall-dozen cans of Slim-Fast. Dannon yogurt, and several packages of Stouffer\'s Lean dinners and some Hot Packats. For a treat. Groupe Danone of France produces Dannon yogurt she picks up some Ben & Jerry\'s ice cream, Toll House cook- es, and a Butterfinger candy bar. She also grabs several cans af Alpo for thair dog, Sassy, and a box of Friskies and a bag of Tidy Cat cat litter for their cat, Lily. She goes down the toilet- ries aisle for some Dove soap, Q-tips cotton swabs, Vaseline Samsung smartphones are made by South Korea\'s lip gloss, and Jergen\'s moisturizing lotion. Before fhng,Samsung- she calls Jesse on her Samsung smartphone to see whetherBertelsmann AG of Germany owns 53 percent of there is anything else he needs. Ho asks her to pick up some PowerBars for him to take to the gym during his lunchtime the remaining 47 percent. workouts next week. She also stops at the bookstore andSociete Bic of France produces Bic pens picks up the new John Grisham book published by Random House, signing the credit card slip with her Bic pen. Chicken-of the Sea tuna is made by Chicken of the Sea International, which is besed in Thailand. Japan\'s Kao owns Jergen\'s. Penquin Random House, and Pearson plc of the UK owns ·Japan\'s Bridgestone Corporation owns Firestone. BP of the United Kingdom owns BP gas stations. After leaving his office, Jesse stops at the BP gas station to fili his gas tank and checks the air pressure in his Firestone tires. He heads to the liquor store for a cese of Miller Genuine thSpiderman movies Sony Pictures Tolovision distrib- Draft beer and a bottle of Wild Turkey bourbon. He walks next door to the sporting goods store to pick up someSABMiller plc of the United Kingdom produces Miller Columbia Pictures, owned by Sony of Japan, released utes Breaking Bad. Wilson racquetballs for his workouts next week. boer, Ann\'s favorite TV show, Breaking Bad, is just startinDavide Campari of Italy awns the Wild Turkay brand. comes in the door, so she pours hersalf a glass af Amer Group of Finland owns Wilsan Sporting Goods. and turns on their Philips high-. Baringer Winery of Napa, California, is owned by definition talevision while Jasse prepares dinner loads the latest Spiderman inst.

Please describe in detaila. How to create and to use a transpo.pdf

4babies2010

HLTF promotes hepatocellular carcinoma progression Juan David Ballut 00048379...

JuanDavidBallutRodri

Access to host receptors

Raffia Siddique

Section 20 n-20--20regulation-2

GGS Medical College/Baba Farid Univ.of Health Sciences.

Práctica de Transformación

CiberGeneticaUNAM

Undergraduate_Reseach_Conference_Poster

Tom Addison

1.27.2010 lecture

Greg

Gene regulation in prokaryotes

Jannat Iftikhar

Eukaryotic transcription

Marudhar Kesari Jain College for Women Vaniyambadi - 635 751, Tamil Nadu, INDIA.

Similar to You have constructed a new reporter gene to help you find novel zebr.pdf (20)

Transcriptional and post transcriptional regulation of gene expression

Gene regulation prokaryote spptx

Genentech Final Paper

Promoters used in expression vectors

Does yeast have a post translation pathway for protein synthesisIf .pdf

Oncotarget Olga´s paper

Regulation of gene expression

Gene Expression.pptx

Describe a growth factor signalling pathway highlighting components.pdf

Cell signaling her2 expression in breast cancer

PNAS-2013-Arambula-8212-7

Please describe in detaila. How to create and to use a transpo.pdf

HLTF promotes hepatocellular carcinoma progression Juan David Ballut 00048379...

Access to host receptors

Section 20 n-20--20regulation-2

Práctica de Transformación

Undergraduate_Reseach_Conference_Poster

1.27.2010 lecture

Gene regulation in prokaryotes

Eukaryotic transcription

More from arihanthtextiles

I need help writing the methods for the song and playList class in Java. I already have the interface and the getters and setter. Can someone help with the methods? Song Class public class Song private String artist // the artist performing the song private String title // the title of the song private int minutes // number of min in length private int seconds // number of seconds of length of the song (always less than 60) // Add Getters / Setters for all fields // Three constructors (remember to initialize ALL fields in each of the constructors - regardless of the number of parameters!) public Song(String artist, String title) public Song(String artist, String title, int minutes, int seconds) public Song(Song s) public boolean equals(Object o) // a song is equal if all four fields are equal public String toString() { // Use this code for toString EXACTLY return \"{Song: title = \" + title + \" artist = \" + artist + \"}\"; } public void play() { // Use this code for play EXACTLY System.out.printf(\"Playing Song: artist = %-20s title = %s\ \", artist, title); } Make the Song class implement the interface Comparable, and make the ordering criteria as follows: Songs will be ordered by artist in ascending order. If the artists are the same, then by title in ascending order. If both artist and title are the same, then any order is acceptable. Don’t forget to include any methods needed to implement the Playable interface. PlayList Class public class PlayList Methods that modify the list should return a boolean return true if they successfully change the list, otherwise they return false. Note that a PlayList can contain other PlayLists! Methods that return a Playable element return null if they fail to find the song in question. private String name // contains the name of the playlist private ArrayList playableList // ArrayList of Playable elements that make up the play list // Add Getters / Setters for name and songList // Add a toString() method that returns the name of the playlist followed by its contents (by calling toString() on each item it contains). You should only have one name/title per line // Two constructors (remember to initialize ALL fields in each of the constructors - regardless of the number of parameters!) public PlayList() // empty play list named \"Untitled\" public PlayList(String newName) // empty play list public boolean loadSongs(String fileName) // loads songs from file, more on this below public boolean clear() // removes all playable elements in the play list public boolean addSong(Song s) // adds Song s to the end of the play list public Playable removePlayable(int index) // removes Playable element at index from the list and returns it public Playable removePlayable(Playable p) // removes every occurrence of Playable p from the list and returns p public Playable getPlayable(int index) // returns the Playable element at the appropriate index public boolean addPlayList(PlayList pl) //adds the PlayList that is being pa.

I need help writing the methods for the song and playList class in J.pdf

arihanthtextiles

How do autopolyploidy and allopolyploidy differ? Only autopolyploidy involves an increase in chromosome sets. The chromosomes of an autopolyploid individual come from the same species, while an allopolyploid has sets of chromosomes from different species. Autopolyploidy is a mechanism of speciation in plants, while allopolyploid is a mechanism of speciation animals. Autopolyploidy is sympatric, while allopolyploidy is allopatric. Solution Answer: b). The chromosomes of an autopolyploid individual come from the same species, while an allopolyploid has sets of chromsomes from different species Autopolyploidy arises from fusion of gametes of the same species (cell division errors, etc.). In this process, polyploid individuals develop as a result of cell division errors that double the DNA content of gametes in individuals from the same species or a self-fertilizing individual. When these double-dose gametes fuse, the result is an organism with double the chromosome number of its parent species. Allopolyploidy occurs when the gametes from two species fuse to form a polyploid generation and hybrid offspring..

How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdf

arihanthtextiles

How do you find the order of growth for the following recurrence? T(n) = 9T(n/3) + n2 Solution The Master Theorem applies to recurrences of the following form: T (n) = aT (n/b) + f (n) where a 1 and b > 1 are constants and f (n) is an asymptotically positive function. There are 3 cases: Case First:-- f(n) is O(nlogba ). Since the leaves grow faster than f, all work is done at the leaves, so T(n) is (nlogb a). Case Second:-- f(n) is (nlogba). The leaves grow at same rate as f, so the same order of work is done at every level of tree. Therfore tree has O(log n) levels times the work done on one level, yielding T(n) is (nlogb a log n). Case Third:-- f(n) is (nlogba + ). Here f grows faster than the number of leaves, which means that asymptotically the total amount of work is dominated by the work done at the root node. For the upper bound, we also need an extra smoothness condition on f in this case i.e af(n/b) cf(n) for some constant c < 1 and large n. In this case T(n) is (f(n)). Therefore, using Master Method on your above Question a=9, b=3, =log39 = 2, f(n) = n2, so Case 2, i.e. T(n) = (nlogn) = (n2logn)..

How do you find the order of growth for the following recurrenceT.pdf

arihanthtextiles

Explain SEAD, SAR and SPAAR routing protocols in more details. Solution SEAD Protocols: SEAD is a proactive secure routing protocol based on DSDV-SQ-protocol. It does not rely on asymmetric encryption primitive but instead it relies on one-way hash chain for security. The algorithm expects that there is some authenticated and secure way to deliver the initial key KN. This could be done by key delivery in advance or by using public key encryption and signatures for key delivery. The basic idea of SEAD is, to authenticate the sequence number and metric of a routing table update message using hash chains elements. In addition, the receiver also authenticates the sender ensuring that the routing information originates from the correct node. The source of each routing update message in SEAD must also be authenticated since an attacker may be able to create routing loops through the impersonation attack. There are two different approaches proposed such as broadcast authentication mechanism, TESLA and Message Authentication Codes SAR routing protocols: SAR takes an approach to routing that incorporates security level of nodes into traditional routing metrics. In most protocols the length of the route is the only metric used. It does not target any protocol, but it rather provides security at a more generalized level of security. The goal is exposing security to the application and to the routing protocol. SAR uses AODV or DSR as a base protocol; it embeds the security metric into RREQ packet itself and changes the forwarding behavior of the protocol. When intermediate nodes receive an RREQ packet with a particular security metric or trust level, the node can only process the packet or forward it if it can provide the required security or trust level. SPAAR routing protocols: The SPAAR protocol was developed with the classical managed- hostile environment in mind, thus meant to provide a very high level of security, and sometimes at the cost of performance. Among other things, SPAAR also requires that each device to use a GPS locator to determine its position, although some leeway is given to nodes using a so-called “locator-proxy” if absolute security is not required. In SPAAR packets are only accepted between neighboring nodes one hop away from each other, this is to avoid the “invisible node- attack”. The basic transmission procedure is quite similar to ARAN, although the group neighborhood key is used for encryption in order to ensure one-hop communication only. Since all nodes also have information on their location they only forward RREQs if their position is closer to the destination position.

Explain SEAD, SAR and SPAAR routing protocols in more details.So.pdf

arihanthtextiles

Dynamic routing protocols are used toa) establish paths real ti.pdf

arihanthtextiles

Evaluate expression without a calculator. Write answer in radians..pdf

arihanthtextiles

Epithelial tissues that are only one cell thick are called _____ Epithelial tissues that are more than one cell thick are called _____ Of these two basic types of epithelial tissues, which is most likely better at transport of substances? What structural aspect of this tissue makes it good at doing this? What is the major function of the other basic type of epithelial tissue? What structural aspect of this tissue makes It good at doing this? If the cells in an epithelial tissue are wider than they are tall, they are called _____ cells. If the cells in an epithelial tissue are taller than they are wide, they are called _____ cells. If the cells In an epithelial tissue are as wide as they are tall, they are called _____ cells. Of these three types of cell shapes found In epithelial tissues, which one is best at allowing for simple diffusion? What structural aspect of this tissue makes it good at doing this? Of these three types of cell shapes found in epithelial tissues, which ate best at allowing for active transport processes? What structural aspect of this tissue makes it good at doing this? What type of cell-surface characteristic helps an epithelial tissue reduce friction? What type of cell-surface characteristic helps an epithelial tissue in absorption and/or secretion? What type of cell-surface characteristic helps an epithelial tissue allows it to move particles across its surface? Solution - epithelium cells that are only one cell thick are known as simple epithelial tissues - epithelium cells that are more than one cell thickness are known as stratified epithelial tissue - simple epithelial tissue is good at transport of substances - epithelial tissue consists of basement membrane on which it rests. this membrane acts as a scaffold. through this membrane ther is nerve supply as this membrane is permeable hence it allows the transport of substances -the major function of stratified epithelial tisue is protection of the cells -epithelial tissues acts as a lining surface to the body organs -.

Epithelial tissues that are only one cell thick are called _____ Epi.pdf

arihanthtextiles

Describe in five sentences how the TLR system is used to fight HSV-1 encephalitis. Solution Toll like receptors are one type of PRRs, which are associate in the recognition of pathogen, associated molecular patterns. These receptors are initially identified in Drosophila, they are also found in macrophages, mast cells, dendritic cells in mammals. Toll-like receptors trigger the production and release of cytokines and also activate other host defense responses associated with innate and adaptive immune response. In response to HSV -1 (herpes simplex virus 1), the TLR-2 releases cytokines that cause severe inflammatory response (innate immune response), which leads to encephalitis. Antagonism of these receptors is likely to provide protection against encephalitis caused by HSV-1. The TLR-2 are mainly located on the surface of microglia and astrocytes..

Describe in five sentences how the TLR system is used to fight HSV-1 .pdf

arihanthtextiles

Daunte is frustrated about management\'s recent decision to merge his two teams into one. He discusses this issue with Claire, a so-worker. Claire responds by saying, \"Its sounds like management\'s decision really bothers you.\" In the context of listening skills, Clarire\'s statement best exemplifies a (n) sarcastic tone that blocks responses. (b) active response that mirrors feelings (c) active response that advises the speaker. (d) blocking response that criticies the speaker (e) negative response that magnifies the problem. Solution (b) active response that mirrors feelings.

Daunte is frustrated about managements recent decision to merge hi.pdf

arihanthtextiles

Concern over the weather associated with El Nino has increased interest in the possibility that the climate on earth is getting warmer. The most common theory relates an increase in atmospheric levels of carbon dioxide (CO_2), a greenhouse gas, to increases in temperature. A regression analysis of the mean annual CO_2 concentration (in parts per million) in the atmosphere at the top of Mauna Loa in Hawaii and the mean annual air temperature (in degrees Celsius) over both land and sea across the globe for 37 years was performed. Assume all conditions are met for simple linear regression inference. A hypothesis test is to be performed to determine if CO_2 levels is a significant predictor of air temperature. What is the correct conclusion based on the results of the hypothesis test? Choose the correct answer below. Solution Here, the t statistic is t = B1 / sB1 here, B1 = 0.004, sB1 = 0.009. Thus, t = 4.444444444 For a 0.001 level, the critical t value is, as df = n - 1 = 36, tcrit= 3.582149701 Thus, as t > 3.5821, then it is OPTION D. [ANSWER].

Concern over the weather associated with El Nino has increased intere.pdf

arihanthtextiles

Clostridium difficile is a bacteria currently making headlines. It has long been the considered the most common health-care associated infection, causing death to a large number of patients when they contract it during hospital stays. The CDC is now reporting an increase in C. difficile cases even outside of hospitals, which is raising concern. Below is an electron micrograph of C. difficile. If you were able to do a Gram stain on a sample of the bacteria, you would find that the cells stain a dark purple. Given this information, how would you classify C. difficile? A. Gram negative, rod shaped B. Gram positive, coccus shaped C. Gram negative, coccus shaped D. Gram positive, rod shaped Many protists have evolved complex life cycles that include sexual reproduction. This means that: A. haploid cells must undergo meiotic divisions to form gametes. B. complex mating behavior likely evolved at the same time as sexual reproduction. C. genetic material from two haploid cells is combined at some point in the life cycle. D. diploid cells must undergo mitotic cell division in order to reproduce. Protists: A. are all eukaryotes. B. are all heterotrophs. C. are all photosynthetic. D. are all single-celled. E. All of the above are correct. All of the following are examples of the evidence that supports the endosymbiotic theory EXCEPT: A. Mitochondria and chloroplasts have their own genomes. B. Mitochondria and chloroplasts divide in a process resembling binary fission. C. Mitochondria and chloroplasts are similar in size to bacteria. D. Mitochondria and chloroplasts have linear chromosomes. Solution Clostridium difficle is a Gram positive, rod shaped bacteria.(option-D) Many protists have evolved complex sexual reproductive life cycles which includes haploid cells undergo meiotic division to form gametes. Protists are all eukaryotes, not an animal, plant or fungus. The point \"mitochondria and chloroplaats have linear chromosomes\" is not an evidence that supports for endosymbiotic theory..

Clostridium difficile is a bacteria currently making headlines. It h.pdf

arihanthtextiles

You cloned an EcoRI digested DNA fragment into a unique EcoRI site of a vector. You identify a recombinant vector that you believe has the DNA of interest. To generate a restriction map of the recombinant plasmid, you take three individual samples of the plasmid and digest them with EcoRI, HindIII, and with both EcoRI and HindIII. You then run the digested DNA on an agarose gel to see the fragments. The gel is then subjected to a Southern hybridization using the EcoRI insert as a probe. Assume that the insert fragment is smaller than the vector. 15. Which fragment (s) on the gel would hybridize to the probe which represents the inert? 16. Which fragment (s) on the gel would hybridize to a probe representing the 5.3 kb band observed in the EcoRI lane? 17. Which fragment (s) in the EcoRI lane would hybridize to a probe representing the 4.1 kb band observed in the HindIII lane? 18. The cloning strategy used being non-directional, the recombinant plasmid may represent one of two possible orientations of the insert. You perform a hybridization with the 1.5 kb band observed in the EcoRI lane. Which fragment (s) would not be observed in the opposite orientation of that represented on the gel? PLEASE EXPLAIN THOUGHT PROCESS 5.3 4.1 2.7 1.5 EcoRI HindIII EcoRI Hind 3.0 2.3 1.1 0.4 Solution The band of HINDIII (2.7) and the band of EcoRI+HINDIII (2.3) represent the fragments that will hybridize to 5.3kb band probe. The band of EcoRI+HINDIII (3.0) and the band of EcoRI (1.5) represent the fragments that will hybridize to 4.1kb band probe. The fragments which will mot be observed in opposite direction are the ones which are dual enzyme digested. The reason behind this is that when dual enzyme digestion occurs it causes an incompatible recognition sequence in the opposite direction. Therefore such fragments are found in the middle of two individual enzyme digestions..

You cloned an EcoRI digested DNA fragment into a unique EcoRI site o.pdf

arihanthtextiles

Write a Java program that will incorporate either a sequential searc.pdf

arihanthtextiles

Answer only with excel instructions. Assume that 96% of ticket holders show up for an airline flight. If a plane seats 200 people, how many tickets should be sold to make the chance of an overbooked flight (more ticket holders show up for a flight than there are seats available) is at most 10%. Solution Say no. of tickets booked = x Now only 0.96x will turn up No. of seats = 200 Now these 0.96x people should get a seat with 90% probability 200 / (0.96x) >=0.9 200/0.864 >= x x <=231.48 x = 231 Airline will make 231 reservations.

Answer only with excel instructions.Assume that 96 of ticket hold.pdf

arihanthtextiles

A new species of sea horse has been discovered and is being sequenced The genome of the new species is being aligned using the reference sequence from a already-known species of sea horse Since the two species are evolutionary diverged, there may be some differences between their sequences Reference sequence: ACCTACATTCACAGAATGAT Fragments a) Align the set of mini-fragments above. b) How are the sequences of the two sea horse species different? c) Would this alignment have been easier or more difficult if you didn\'t have any reference sequence at all (alignment without a reference is called \"de novo\")? Explain d) If there had been sequencing errors, would this alignment have been easier or more difficult? Explain. Solution A) TAGATT TGAATG TCACTGA B) There is a form of polymorphism occurring in the new sequence of the genes for the new species of sea horses. There is single nucleotide polymorphism in the new species as C is replaced by T and A instead of G which may probably occurred due to some sort of mutation during genetic sequencing. C) The given alignment would be difficult without reference DNA sequence as reference sequence gives basic DNA information and a reference database techniques is much easier than performing a de novo technique though de novo methods are well established using mass spectra nowadays but still having a reference database helps and gives the better coding information of protein sequence. D) if there had been a sequence error there would be difficulty in alignment and in that case we have to perform de novo sequencing using mass spectra analysis. To know the sequence of the species and other information regarding the DNA characters..

A new species of sea horse has been discovered and is being sequenced.pdf

arihanthtextiles

Which of the following is the mechanism of action for Herceptin? Herceptin binds to the HER2 promoter to prevent transcription, thus lowering amounts of receptor. Herceptin binds to intracellular HER2 proteins to prevent cancer cells from dividing. Herceptin binds to HER3 and HER4 cell surface receptors to activate the immune system. Herceptin binds to extracellular domain of HER2 and prevents internalization and subsequent cancer cell division. Herceptin targets TNF alpha. Solution B) herceptin binds to intracellular ER2 proteins to prevent cancer cells from dividing Trastuzumab (herceptin) activates p27 factor by inhibiting PI3K/Akt, Mirk and hKIS pathways. HER2 protein can be expressed up to 100 times more in cancer cells. PI3K/Akt, Mirk and hKIS are intracellular proteins in HER2 pathways are activated which promote cell proliferation. Signals present in these pathways promote growth of blood vessels in order to supplement for tumour formation or angiogenesis and therefore resulting in cell proliferation. Thus, when herceptin inhibits PI3K/Akt, Mirk and hKIS pathways, the cell proliferation is inhibited..

Which of the following is the mechanism of action for Herceptin Her.pdf

arihanthtextiles

Which of these statements best describes an element? An element is composed of three subatomic particles. An element is formed when two atoms of the same kind are bonded together. An element is formed when two or more different atoms combine chemically. An element is composed of identical atoms. Solution An element is composed of identical atoms. Molecules can be made of elements, but elements arent made from molecules. 2 or more atoms of the same kind make up an element.For example H is hydrogen which is an element formed from H atoms only whereas H2O is a compount formed from 2 different atoms H and O..

Which of these statements best describes an element An element is c.pdf

arihanthtextiles

What is the general goal for descriptive statistics? How is the goal served by putting scores in a frequency distribution? How is the goal served by computing a measure of central tendency? How is the goal served by computing a measure of variability? Solution What is the general goal of descriptive statistics ? Answer : To simplify , organize, and summarize data so that it is easier for researchers to see patterns. How is the goal served by putting scores in a frequency distribution? A frequncy distribution provides an organized summary of the complete set of scores. How is the goal served by computing a measure of central tendency? Summarizes an entires set of scores with a single value that is representative of the whole set. How is the goal served by computing a measure of variability? Provides a single number that describes the differences that exist from complete score to another..

What is the general goal for descriptive statistics How is the goal.pdf

arihanthtextiles

What effects are shown on this graph? (assume that all effects where the marginal means differ are significant) Choose as many as applicable. A. Main effect of A where scores are higher at A1 than A2 B. Main effect of A where scores are higher at A2 than A1 C, Main effect of B where scores are higher at B1 than B2 D, Main effect of B where scores are higher at B2 than B1 E. Interaction where the effect of A is larger at B1 than B2 F. Interaction where the effect of A is larger at B2 than B1 Solution.

What effects are shown on this graph (assume that all effects where.pdf

arihanthtextiles

What are adaptive peaks? How do organisms move from one adaptive peak to another? 100 words or more please Solution An equilibrium state in a population when the gene pool has allele frequencies that maximize the average fitness of a population\'s members. In other words, A high point (perhaps one of several) on an adaptive landscape; selection tends to drive the genotype composition of the population toward a combination corresponding to an adaptive peak. Most extant organisms are thought to sit on the “peaks” of such adaptive landscapes. However, how does a phenotype shift from one peak to another is not clear. Common hypotheses include (1) There are “ridges” connecting the adaptive peaks, such that phenotypes along the ridge are more or less equally fit under a specific environment; (2) There are no ridges connecting the peaks but when effective population size is small enough, phenotypes may be able to traverse the less-adaptive region (i.e. adaptive valley) by genetic drift..

What are adaptive peaks How do organisms move from one adaptive pea.pdf

arihanthtextiles

More from arihanthtextiles (20)