You have constructed a new reporter gene to help you find novel zebrafish mutations. The
reporter gene consists of several LEG/TCF binding domains in the enhancer fused to the coding
region for green fluorescent protein (GFP). Wild-type embryos that contain this transgene
normally express it in the brain and eye primordia and have no developmental defects. You then
mutagenize this reporter strain to look for new mutants that affect GFP expression.
Which developmental pathway are these mutants likely to be in and why?
You find a mutant (which you call GLO-1) that ubiquitously expresses your reporter gene
throughout the entire embryo. Which molecule in the above pathway is most likely to be mutated
and why?
Solution
Ans.) Nacre, a zebrafish homolog of MITF is required for pigment cell differentiation. We
isolated a promoter region of shell that contains Tcf/Lef binding sites which will mediate Wnt
responsiveness. This promoter binds to zebrafish Lef1 protein in vitro, and a nacre
communicator construct is powerfully inhibited by dominant-negative Tcf in malignant
melanoma cells. Mutation of Tcf/Lef sites abolishes Lef1 binding and reporter operates in vivo.
Wnt signaling so directly activates shell, which in flip ends up in pigment cell differentiation.
It was determined that the human melanocyte-specific MITF promoter contains many purported
Tcf/Lef binding sites, hallmarks of Wnt/-catenin-mediated transcriptional control. To test the
hypothesis that nacre could be a target of the Wnt/-catenin pathway in zebrafish, a
promoter/enhancer region is isolated for this sequence from a genomic bacteriophage library.
This genomic fragment contains the translation initiation site for nacre which is associated with a
836-bp upstream region with a possible transcription begin site, a cAMP response element
(CRE) and several agreement Tcf/Lef binding sites. These CRE and Tcf/Lef locations are not
fully preserved between the human and zebrafish promoters in either their sequences or their
positions from the transcription begin site. To examine whether the purported putative nacre
promoter/enhancer will direct correct abstraction management of organic phenomenon, injected
one -cell zebrafish embryos with the 836-bp deoxyribonucleic acid fragment driving a green
fluorescent macromolecule (GFP) communicator sequence. Mosaic gene expression is typical for
transient transgenics in zebrafish and because the neural crest springs from only a few precursor
cells, reporter potency is minimized. Despite these, it was ready to analyze the fate of the few
reporter-expressing cells in injected animals..
I am Stacy T. I am a Microbiology Assignment Expert at nursingassignmenthelp.com. I hold a Masters’ in Microbiology, from Torrens University, Australia. I have been helping students with their assignments for the past 7 years. I solve assignments related to Microbiology.
Visit nursingassignmenthelp.com or email info@nursingassignmenthelp.com. You can also call on +1 678 648 4277 for any assistance with Microbiology Assignments.
Genome editing tools form the basis for personalized medicine, especially for therapies requiring change in genome. Currently there are four contenders to this – Meganucleases, ZNF Nucleases, TALENs and CRISPRs. Although, the technologies are many, there are very few commercial providers of this technology. This is attributed to the fact that select few possess the intellectual property rights of turning these technologies to valid form of therapy; for example, ZFN patent with Sangamo BioSciences and TALENs with Cellectis, Transposagen and Life Technologies.
I am Stacy T. I am a Microbiology Assignment Expert at nursingassignmenthelp.com. I hold a Masters’ in Microbiology, from Torrens University, Australia. I have been helping students with their assignments for the past 7 years. I solve assignments related to Microbiology.
Visit nursingassignmenthelp.com or email info@nursingassignmenthelp.com. You can also call on +1 678 648 4277 for any assistance with Microbiology Assignments.
Genome editing tools form the basis for personalized medicine, especially for therapies requiring change in genome. Currently there are four contenders to this – Meganucleases, ZNF Nucleases, TALENs and CRISPRs. Although, the technologies are many, there are very few commercial providers of this technology. This is attributed to the fact that select few possess the intellectual property rights of turning these technologies to valid form of therapy; for example, ZFN patent with Sangamo BioSciences and TALENs with Cellectis, Transposagen and Life Technologies.
Does yeast have a post translation pathway for protein synthesisIf .pdfarjunhassan8
Does yeast have a post translation pathway for protein synthesis?If so how does it work? Please
start explaining from nucleus transcription to translation in yeast with the promoters or genes that
are specific to yeast.
Solution
Yes, yeast has post translational pathway for protein synthesis.
The central dogma of molecular biology proposes that information flows from DNA to RNA
through the process of transcription and from RNA to protein through translation.
In eukaryotic cells like yeast cells, they posses phospholipid membranes allowing diverse
biochemical and metabolic activities to be carried out simultaneously in distinct subcellular
compartments.The membrane-bound organelles creates a requirement for the efficient targeting
of proteins, which are primarily synthesised by ribosomes located in the cytosol, to the
appropriate intracellular location.These proteins are first targeted to and translocated across the
membrane of the endoplasmic reticulum (ER). The tail-anchor (TA) proteins are located at the
C-terminus of the polypeptide.Therefore, by the time that the ER targeting signal is exposed to
cytosolic factors the polypeptide will be released from the ribosome and TA proteins are post-
translationally inserted into the ER membrane.Tail-anchored proteins are inserted by
TRC40/Get3.
A promoter is a DNA sequence that can recruit transcriptional machinery and lead to
transcription of the downstream DNA sequence. All the yeast promoters depend on the
availability of RNA polymerase holoenzyme, but is not affected by any transcriptional
regulators..
Please describe in detaila. How to create and to use a transpo.pdf4babies2010
Please answer the discussion questions and TYPE you answers. MINICASE ARE YOU
REALLY BUYING AMERICAN? Consider the follawing scenario of a typical\" American fam
work, stopping for gas at the Shell station. At the grocery ily: The Osbornes, Jesse and Ann, live
in the suburbs of store, she fills her cart with a variety of items, including Chicago Jesse is a
manager at Trader Joe\'s specialty grocery Ragu spaghetti sauce, Hellmann\'s mayonnaise,
Carnation store chain. Ann is an edvertising executive for Leo Burnett Instant Breakfast drink, a
case of Arrowhead water, CoffeeMate nondairy coffee creamer, Chicken-of the-Sea Ann listens
to the new Adam Lambert CD on her Alpine car stereo in her Jeep Cherakes while driving homa
from canned tuna, Lipton tea, a hall-dozen cans of Slim-Fast. Dannon yogurt, and several
packages of Stouffer\'s Lean dinners and some Hot Packats. For a treat. Groupe Danone of
France produces Dannon yogurt she picks up some Ben & Jerry\'s ice cream, Toll House cook-
es, and a Butterfinger candy bar. She also grabs several cans af Alpo for thair dog, Sassy, and a
box of Friskies and a bag of Tidy Cat cat litter for their cat, Lily. She goes down the toilet- ries
aisle for some Dove soap, Q-tips cotton swabs, Vaseline Samsung smartphones are made by
South Korea\'s lip gloss, and Jergen\'s moisturizing lotion. Before fhng,Samsung- she calls Jesse
on her Samsung smartphone to see whetherBertelsmann AG of Germany owns 53 percent of
there is anything else he needs. Ho asks her to pick up some PowerBars for him to take to the
gym during his lunchtime the remaining 47 percent. workouts next week. She also stops at the
bookstore andSociete Bic of France produces Bic pens picks up the new John Grisham book
published by Random House, signing the credit card slip with her Bic pen. Chicken-of the Sea
tuna is made by Chicken of the Sea International, which is besed in Thailand. Japan\'s Kao owns
Jergen\'s. Penquin Random House, and Pearson plc of the UK owns ·Japan\'s Bridgestone
Corporation owns Firestone. BP of the United Kingdom owns BP gas stations. After leaving his
office, Jesse stops at the BP gas station to fili his gas tank and checks the air pressure in his
Firestone tires. He heads to the liquor store for a cese of Miller Genuine thSpiderman movies
Sony Pictures Tolovision distrib- Draft beer and a bottle of Wild Turkey bourbon. He walks next
door to the sporting goods store to pick up someSABMiller plc of the United Kingdom produces
Miller Columbia Pictures, owned by Sony of Japan, released utes Breaking Bad. Wilson
racquetballs for his workouts next week. boer, Ann\'s favorite TV show, Breaking Bad, is just
startinDavide Campari of Italy awns the Wild Turkay brand. comes in the door, so she pours
hersalf a glass af Amer Group of Finland owns Wilsan Sporting Goods. and turns on their Philips
high-. Baringer Winery of Napa, California, is owned by definition talevision while Jasse
prepares dinner loads the latest Spiderman inst.
I need help writing the methods for the song and playList class in J.pdfarihanthtextiles
I need help writing the methods for the song and playList class in Java. I already have the
interface and the getters and setter. Can someone help with the methods?
Song Class
public class Song
private String artist // the artist performing the song
private String title // the title of the song
private int minutes // number of min in length
private int seconds // number of seconds of length of the song (always less than 60)
// Add Getters / Setters for all fields
// Three constructors (remember to initialize ALL fields in each of the constructors - regardless
of the number of parameters!)
public Song(String artist, String title)
public Song(String artist, String title, int minutes, int seconds)
public Song(Song s)
public boolean equals(Object o) // a song is equal if all four fields are equal
public String toString() { // Use this code for toString EXACTLY
return \"{Song: title = \" + title + \" artist = \" + artist + \"}\";
}
public void play() { // Use this code for play EXACTLY
System.out.printf(\"Playing Song: artist = %-20s title = %s\ \", artist, title);
}
Make the Song class implement the interface Comparable, and make the ordering criteria as
follows: Songs will be ordered by artist in ascending order. If the artists are the same, then by
title in ascending order. If both artist and title are the same, then any order is acceptable.
Don’t forget to include any methods needed to implement the Playable interface.
PlayList Class
public class PlayList
Methods that modify the list should return a boolean return true if they successfully change the
list, otherwise they return false. Note that a PlayList can contain other PlayLists!
Methods that return a Playable element return null if they fail to find the song in question.
private String name // contains the name of the playlist
private ArrayList playableList // ArrayList of Playable elements that make up the play list
// Add Getters / Setters for name and songList
// Add a toString() method that returns the name of the playlist followed by its contents (by
calling toString() on each item it contains). You should only have one name/title per line
// Two constructors (remember to initialize ALL fields in each of the constructors - regardless of
the number of parameters!)
public PlayList() // empty play list named \"Untitled\"
public PlayList(String newName) // empty play list
public boolean loadSongs(String fileName) // loads songs from file, more on this below
public boolean clear() // removes all playable elements in the play list
public boolean addSong(Song s) // adds Song s to the end of the play list
public Playable removePlayable(int index) // removes Playable element at index from the list and
returns it
public Playable removePlayable(Playable p) // removes every occurrence of Playable p from the
list and returns p
public Playable getPlayable(int index) // returns the Playable element at the appropriate index
public boolean addPlayList(PlayList pl) //adds the PlayList that is being pa.
How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdfarihanthtextiles
How do autopolyploidy and allopolyploidy differ? Only autopolyploidy involves an increase in
chromosome sets. The chromosomes of an autopolyploid individual come from the same
species, while an allopolyploid has sets of chromosomes from different species. Autopolyploidy
is a mechanism of speciation in plants, while allopolyploid is a mechanism of speciation animals.
Autopolyploidy is sympatric, while allopolyploidy is allopatric.
Solution
Answer:
b). The chromosomes of an autopolyploid individual come from the same species, while an
allopolyploid has sets of chromsomes from different species
Autopolyploidy arises from fusion of gametes of the same species (cell division errors, etc.). In
this process, polyploid individuals develop as a result of cell division errors that double the DNA
content of gametes in individuals from the same species or a self-fertilizing individual. When
these double-dose gametes fuse, the result is an organism with double the chromosome number
of its parent species.
Allopolyploidy occurs when the gametes from two species fuse to form a polyploid generation
and hybrid offspring..
More Related Content
Similar to You have constructed a new reporter gene to help you find novel zebr.pdf
Does yeast have a post translation pathway for protein synthesisIf .pdfarjunhassan8
Does yeast have a post translation pathway for protein synthesis?If so how does it work? Please
start explaining from nucleus transcription to translation in yeast with the promoters or genes that
are specific to yeast.
Solution
Yes, yeast has post translational pathway for protein synthesis.
The central dogma of molecular biology proposes that information flows from DNA to RNA
through the process of transcription and from RNA to protein through translation.
In eukaryotic cells like yeast cells, they posses phospholipid membranes allowing diverse
biochemical and metabolic activities to be carried out simultaneously in distinct subcellular
compartments.The membrane-bound organelles creates a requirement for the efficient targeting
of proteins, which are primarily synthesised by ribosomes located in the cytosol, to the
appropriate intracellular location.These proteins are first targeted to and translocated across the
membrane of the endoplasmic reticulum (ER). The tail-anchor (TA) proteins are located at the
C-terminus of the polypeptide.Therefore, by the time that the ER targeting signal is exposed to
cytosolic factors the polypeptide will be released from the ribosome and TA proteins are post-
translationally inserted into the ER membrane.Tail-anchored proteins are inserted by
TRC40/Get3.
A promoter is a DNA sequence that can recruit transcriptional machinery and lead to
transcription of the downstream DNA sequence. All the yeast promoters depend on the
availability of RNA polymerase holoenzyme, but is not affected by any transcriptional
regulators..
Please describe in detaila. How to create and to use a transpo.pdf4babies2010
Please answer the discussion questions and TYPE you answers. MINICASE ARE YOU
REALLY BUYING AMERICAN? Consider the follawing scenario of a typical\" American fam
work, stopping for gas at the Shell station. At the grocery ily: The Osbornes, Jesse and Ann, live
in the suburbs of store, she fills her cart with a variety of items, including Chicago Jesse is a
manager at Trader Joe\'s specialty grocery Ragu spaghetti sauce, Hellmann\'s mayonnaise,
Carnation store chain. Ann is an edvertising executive for Leo Burnett Instant Breakfast drink, a
case of Arrowhead water, CoffeeMate nondairy coffee creamer, Chicken-of the-Sea Ann listens
to the new Adam Lambert CD on her Alpine car stereo in her Jeep Cherakes while driving homa
from canned tuna, Lipton tea, a hall-dozen cans of Slim-Fast. Dannon yogurt, and several
packages of Stouffer\'s Lean dinners and some Hot Packats. For a treat. Groupe Danone of
France produces Dannon yogurt she picks up some Ben & Jerry\'s ice cream, Toll House cook-
es, and a Butterfinger candy bar. She also grabs several cans af Alpo for thair dog, Sassy, and a
box of Friskies and a bag of Tidy Cat cat litter for their cat, Lily. She goes down the toilet- ries
aisle for some Dove soap, Q-tips cotton swabs, Vaseline Samsung smartphones are made by
South Korea\'s lip gloss, and Jergen\'s moisturizing lotion. Before fhng,Samsung- she calls Jesse
on her Samsung smartphone to see whetherBertelsmann AG of Germany owns 53 percent of
there is anything else he needs. Ho asks her to pick up some PowerBars for him to take to the
gym during his lunchtime the remaining 47 percent. workouts next week. She also stops at the
bookstore andSociete Bic of France produces Bic pens picks up the new John Grisham book
published by Random House, signing the credit card slip with her Bic pen. Chicken-of the Sea
tuna is made by Chicken of the Sea International, which is besed in Thailand. Japan\'s Kao owns
Jergen\'s. Penquin Random House, and Pearson plc of the UK owns ·Japan\'s Bridgestone
Corporation owns Firestone. BP of the United Kingdom owns BP gas stations. After leaving his
office, Jesse stops at the BP gas station to fili his gas tank and checks the air pressure in his
Firestone tires. He heads to the liquor store for a cese of Miller Genuine thSpiderman movies
Sony Pictures Tolovision distrib- Draft beer and a bottle of Wild Turkey bourbon. He walks next
door to the sporting goods store to pick up someSABMiller plc of the United Kingdom produces
Miller Columbia Pictures, owned by Sony of Japan, released utes Breaking Bad. Wilson
racquetballs for his workouts next week. boer, Ann\'s favorite TV show, Breaking Bad, is just
startinDavide Campari of Italy awns the Wild Turkay brand. comes in the door, so she pours
hersalf a glass af Amer Group of Finland owns Wilsan Sporting Goods. and turns on their Philips
high-. Baringer Winery of Napa, California, is owned by definition talevision while Jasse
prepares dinner loads the latest Spiderman inst.
I need help writing the methods for the song and playList class in J.pdfarihanthtextiles
I need help writing the methods for the song and playList class in Java. I already have the
interface and the getters and setter. Can someone help with the methods?
Song Class
public class Song
private String artist // the artist performing the song
private String title // the title of the song
private int minutes // number of min in length
private int seconds // number of seconds of length of the song (always less than 60)
// Add Getters / Setters for all fields
// Three constructors (remember to initialize ALL fields in each of the constructors - regardless
of the number of parameters!)
public Song(String artist, String title)
public Song(String artist, String title, int minutes, int seconds)
public Song(Song s)
public boolean equals(Object o) // a song is equal if all four fields are equal
public String toString() { // Use this code for toString EXACTLY
return \"{Song: title = \" + title + \" artist = \" + artist + \"}\";
}
public void play() { // Use this code for play EXACTLY
System.out.printf(\"Playing Song: artist = %-20s title = %s\ \", artist, title);
}
Make the Song class implement the interface Comparable, and make the ordering criteria as
follows: Songs will be ordered by artist in ascending order. If the artists are the same, then by
title in ascending order. If both artist and title are the same, then any order is acceptable.
Don’t forget to include any methods needed to implement the Playable interface.
PlayList Class
public class PlayList
Methods that modify the list should return a boolean return true if they successfully change the
list, otherwise they return false. Note that a PlayList can contain other PlayLists!
Methods that return a Playable element return null if they fail to find the song in question.
private String name // contains the name of the playlist
private ArrayList playableList // ArrayList of Playable elements that make up the play list
// Add Getters / Setters for name and songList
// Add a toString() method that returns the name of the playlist followed by its contents (by
calling toString() on each item it contains). You should only have one name/title per line
// Two constructors (remember to initialize ALL fields in each of the constructors - regardless of
the number of parameters!)
public PlayList() // empty play list named \"Untitled\"
public PlayList(String newName) // empty play list
public boolean loadSongs(String fileName) // loads songs from file, more on this below
public boolean clear() // removes all playable elements in the play list
public boolean addSong(Song s) // adds Song s to the end of the play list
public Playable removePlayable(int index) // removes Playable element at index from the list and
returns it
public Playable removePlayable(Playable p) // removes every occurrence of Playable p from the
list and returns p
public Playable getPlayable(int index) // returns the Playable element at the appropriate index
public boolean addPlayList(PlayList pl) //adds the PlayList that is being pa.
How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdfarihanthtextiles
How do autopolyploidy and allopolyploidy differ? Only autopolyploidy involves an increase in
chromosome sets. The chromosomes of an autopolyploid individual come from the same
species, while an allopolyploid has sets of chromosomes from different species. Autopolyploidy
is a mechanism of speciation in plants, while allopolyploid is a mechanism of speciation animals.
Autopolyploidy is sympatric, while allopolyploidy is allopatric.
Solution
Answer:
b). The chromosomes of an autopolyploid individual come from the same species, while an
allopolyploid has sets of chromsomes from different species
Autopolyploidy arises from fusion of gametes of the same species (cell division errors, etc.). In
this process, polyploid individuals develop as a result of cell division errors that double the DNA
content of gametes in individuals from the same species or a self-fertilizing individual. When
these double-dose gametes fuse, the result is an organism with double the chromosome number
of its parent species.
Allopolyploidy occurs when the gametes from two species fuse to form a polyploid generation
and hybrid offspring..
How do you find the order of growth for the following recurrenceT.pdfarihanthtextiles
How do you find the order of growth for the following recurrence?
T(n) = 9T(n/3) + n2
Solution
The Master Theorem applies to recurrences of the following form:
T (n) = aT (n/b) + f (n)
where a 1 and b > 1 are constants and f (n) is an asymptotically positive function.
There are 3 cases:
Case First:-- f(n) is O(nlogba ). Since the leaves grow faster than f, all work is done at the
leaves, so T(n) is (nlogb a).
Case Second:-- f(n) is (nlogba). The leaves grow at same rate as f, so the same order of work is
done at every level of tree. Therfore tree has O(log n) levels times the work done on one level,
yielding T(n) is (nlogb a log n).
Case Third:-- f(n) is (nlogba + ). Here f grows faster than the number of leaves, which means that
asymptotically the total amount of work is dominated by the work done at the root node. For the
upper bound, we also need an extra smoothness condition on f in this case i.e af(n/b) cf(n) for
some constant c < 1 and large n. In this case T(n) is (f(n)).
Therefore, using Master Method on your above Question
a=9, b=3, =log39 = 2, f(n) = n2, so Case 2, i.e. T(n) = (nlogn) = (n2logn)..
Explain SEAD, SAR and SPAAR routing protocols in more details.So.pdfarihanthtextiles
Explain SEAD, SAR and SPAAR routing protocols in more details.
Solution
SEAD Protocols: SEAD is a proactive secure routing protocol based on DSDV-SQ-protocol. It
does not rely on asymmetric encryption primitive but instead it relies on one-way hash chain for
security. The algorithm expects that there is some authenticated and secure way to deliver the
initial key KN. This could be done by key delivery in advance or by using public key encryption
and signatures for key delivery. The basic idea of SEAD is, to authenticate the sequence number
and metric of a routing table update message using hash chains elements. In addition, the
receiver also authenticates the sender ensuring that the routing information originates from the
correct node. The source of each routing update message in SEAD must also be authenticated
since an attacker may be able to create routing loops through the impersonation attack. There are
two different approaches proposed such as broadcast authentication mechanism, TESLA and
Message Authentication Codes
SAR routing protocols: SAR takes an approach to routing that incorporates security level of
nodes into traditional routing metrics. In most protocols the length of the route is the only metric
used. It does not target any protocol, but it rather provides security at a more generalized level of
security. The goal is exposing security to the application and to the routing protocol. SAR uses
AODV or DSR as a base protocol; it embeds the security metric into RREQ packet itself and
changes the forwarding behavior of the protocol. When intermediate nodes receive an RREQ
packet with a particular security metric or trust level, the node can only process the packet or
forward it if it can provide the required security or trust level.
SPAAR routing protocols: The SPAAR protocol was developed with the classical managed-
hostile environment in mind, thus meant to provide a very high level of security, and sometimes
at the cost of performance. Among other things, SPAAR also requires that each device to use a
GPS locator to determine its position, although some leeway is given to nodes using a so-called
“locator-proxy” if absolute security is not required. In SPAAR packets are only accepted
between neighboring nodes one hop away from each other, this is to avoid the “invisible node-
attack”. The basic transmission procedure is quite similar to ARAN, although the group
neighborhood key is used for encryption in order to ensure one-hop communication only. Since
all nodes also have information on their location they only forward RREQs if their position is
closer to the destination position.
Dynamic routing protocols are used toa) establish paths real ti.pdfarihanthtextiles
Dynamic routing protocols are used to:
a) establish path\'s real time between routers
b) define overhead bits within the packet
c) encapsulate the IP packet into a Layer 2 frame
d) reroute traffic during circuit failures and network congestion
e) a and b
f) a, c, and d
g) all of the above
Solution
a,c,d.
Evaluate expression without a calculator. Write answer in radians..pdfarihanthtextiles
Evaluate expression without a calculator. Write answer in radians.
Please show step by step so I can check my work. My answer -pi/6
Solution
sin^-1(-1/2) =y
range of sin^-1(x) : -pi/2<=y<=pi/2
So, value of y would be less than pi/2and its is -ve so it should be between -pi/2 and 0
y = sin^-1(-1/2)
siny = -1/2
y = -pi/6 radians.
Epithelial tissues that are only one cell thick are called _____ Epi.pdfarihanthtextiles
Epithelial tissues that are only one cell thick are called _____ Epithelial tissues that are more
than one cell thick are called _____ Of these two basic types of epithelial tissues, which is most
likely better at transport of substances? What structural aspect of this tissue makes it good at
doing this? What is the major function of the other basic type of epithelial tissue? What
structural aspect of this tissue makes It good at doing this? If the cells in an epithelial tissue are
wider than they are tall, they are called _____ cells. If the cells in an epithelial tissue are taller
than they are wide, they are called _____ cells. If the cells In an epithelial tissue are as wide as
they are tall, they are called _____ cells. Of these three types of cell shapes found In epithelial
tissues, which one is best at allowing for simple diffusion? What structural aspect of this tissue
makes it good at doing this? Of these three types of cell shapes found in epithelial tissues, which
ate best at allowing for active transport processes? What structural aspect of this tissue makes it
good at doing this? What type of cell-surface characteristic helps an epithelial tissue reduce
friction? What type of cell-surface characteristic helps an epithelial tissue in absorption and/or
secretion? What type of cell-surface characteristic helps an epithelial tissue allows it to move
particles across its surface?
Solution
- epithelium cells that are only one cell thick are known as simple epithelial tissues
- epithelium cells that are more than one cell thickness are known as stratified epithelial tissue
- simple epithelial tissue is good at transport of substances
- epithelial tissue consists of basement membrane on which it rests. this membrane acts as a
scaffold. through this membrane ther is nerve supply as this membrane is permeable hence it
allows the transport of substances
-the major function of stratified epithelial tisue is protection of the cells
-epithelial tissues acts as a lining surface to the body organs
-.
Describe in five sentences how the TLR system is used to fight HSV-1 .pdfarihanthtextiles
Describe in five sentences how the TLR system is used to fight HSV-1 encephalitis.
Solution
Toll like receptors are one type of PRRs, which are associate in the recognition of pathogen,
associated molecular patterns. These receptors are initially identified in Drosophila, they are also
found in macrophages, mast cells, dendritic cells in mammals. Toll-like receptors trigger the
production and release of cytokines and also activate other host defense responses associated
with innate and adaptive immune response. In response to HSV -1 (herpes simplex virus 1), the
TLR-2 releases cytokines that cause severe inflammatory response (innate immune response),
which leads to encephalitis. Antagonism of these receptors is likely to provide protection against
encephalitis caused by HSV-1. The TLR-2 are mainly located on the surface of microglia and
astrocytes..
Daunte is frustrated about managements recent decision to merge hi.pdfarihanthtextiles
Daunte is frustrated about management\'s recent decision to merge his two teams into one. He
discusses this issue with Claire, a so-worker. Claire responds by saying, \"Its sounds like
management\'s decision really bothers you.\" In the context of listening skills, Clarire\'s
statement best exemplifies a (n) sarcastic tone that blocks responses. (b) active response that
mirrors feelings (c) active response that advises the speaker. (d) blocking response that criticies
the speaker (e) negative response that magnifies the problem.
Solution
(b) active response that mirrors feelings.
Concern over the weather associated with El Nino has increased intere.pdfarihanthtextiles
Concern over the weather associated with El Nino has increased interest in the possibility that
the climate on earth is getting warmer. The most common theory relates an increase in
atmospheric levels of carbon dioxide (CO_2), a greenhouse gas, to increases in temperature. A
regression analysis of the mean annual CO_2 concentration (in parts per million) in the
atmosphere at the top of Mauna Loa in Hawaii and the mean annual air temperature (in degrees
Celsius) over both land and sea across the globe for 37 years was performed. Assume all
conditions are met for simple linear regression inference. A hypothesis test is to be performed to
determine if CO_2 levels is a significant predictor of air temperature. What is the correct
conclusion based on the results of the hypothesis test? Choose the correct answer below.
Solution
Here, the t statistic is
t = B1 / sB1
here, B1 = 0.004, sB1 = 0.009.
Thus,
t = 4.444444444
For a 0.001 level, the critical t value is, as df = n - 1 = 36,
tcrit= 3.582149701
Thus, as t > 3.5821, then it is OPTION D. [ANSWER].
Clostridium difficile is a bacteria currently making headlines. It h.pdfarihanthtextiles
Clostridium difficile is a bacteria currently making headlines. It has long been the considered the
most common health-care associated infection, causing death to a large number of patients when
they contract it during hospital stays. The CDC is now reporting an increase in C. difficile cases
even outside of hospitals, which is raising concern. Below is an electron micrograph of C.
difficile. If you were able to do a Gram stain on a sample of the bacteria, you would find that the
cells stain a dark purple.
Given this information, how would you classify C. difficile?
A.
Gram negative, rod shaped
B.
Gram positive, coccus shaped
C.
Gram negative, coccus shaped
D.
Gram positive, rod shaped
Many protists have evolved complex life cycles that include sexual reproduction. This means
that:
A.
haploid cells must undergo meiotic divisions to form gametes.
B.
complex mating behavior likely evolved at the same time as sexual reproduction.
C.
genetic material from two haploid cells is combined at some point in the life cycle.
D.
diploid cells must undergo mitotic cell division in order to reproduce.
Protists:
A.
are all eukaryotes.
B.
are all heterotrophs.
C.
are all photosynthetic.
D.
are all single-celled.
E.
All of the above are correct.
All of the following are examples of the evidence that supports the endosymbiotic theory
EXCEPT:
A.
Mitochondria and chloroplasts have their own genomes.
B.
Mitochondria and chloroplasts divide in a process resembling binary fission.
C.
Mitochondria and chloroplasts are similar in size to bacteria.
D.
Mitochondria and chloroplasts have linear chromosomes.
Solution
Clostridium difficle is a Gram positive, rod shaped bacteria.(option-D) Many protists have
evolved complex sexual reproductive life cycles which includes haploid cells undergo meiotic
division to form gametes. Protists are all eukaryotes, not an animal, plant or fungus. The point
\"mitochondria and chloroplaats have linear chromosomes\" is not an evidence that supports for
endosymbiotic theory..
You cloned an EcoRI digested DNA fragment into a unique EcoRI site o.pdfarihanthtextiles
You cloned an EcoRI digested DNA fragment into a unique EcoRI site of a vector. You identify
a recombinant vector that you believe has the DNA of interest. To generate a restriction map of
the recombinant plasmid, you take three individual samples of the plasmid and digest them with
EcoRI, HindIII, and with both EcoRI and HindIII. You then run the digested DNA on an
agarose
gel to see the fragments. The gel is then subjected to a Southern hybridization using the EcoRI
insert as a probe. Assume that the insert fragment is smaller than the vector.
15. Which fragment (s) on the gel would hybridize to the probe which represents the inert?
16. Which fragment (s) on the gel would hybridize to a probe representing the 5.3 kb band
observed in the EcoRI lane?
17. Which fragment (s) in the EcoRI lane would hybridize to a probe representing the 4.1 kb
band observed in the HindIII lane?
18. The cloning strategy used being non-directional, the recombinant plasmid may represent one
of two possible orientations of the insert. You perform a hybridization with the 1.5 kb band
observed in the EcoRI lane. Which fragment (s) would not be observed in the opposite
orientation of that represented on the gel?
PLEASE EXPLAIN THOUGHT PROCESS 5.3 4.1 2.7 1.5 EcoRI HindIII EcoRI Hind 3.0 2.3
1.1 0.4
Solution
The band of HINDIII (2.7) and the band of EcoRI+HINDIII (2.3) represent the fragments that
will hybridize to 5.3kb band probe.
The band of EcoRI+HINDIII (3.0) and the band of EcoRI (1.5) represent the fragments that will
hybridize to 4.1kb band probe.
The fragments which will mot be observed in opposite direction are the ones which are dual
enzyme digested. The reason behind this is that when dual enzyme digestion occurs it causes an
incompatible recognition sequence in the opposite direction. Therefore such fragments are found
in the middle of two individual enzyme digestions..
Write a Java program that will incorporate either a sequential searc.pdfarihanthtextiles
Write a Java program that will incorporate either a sequential search method or a sort method
Solution
class Search
{
public static void main(String args[])
{ int array[],n;
System.out.println(\"Please enter the sixe of array\");
Scanner s = new Scanner(System.in);
int n = s.nextInt();
System.out.println(\"Please enter\"+ n +\"elements of array\");
for(int i= 0;i.
Answer only with excel instructions.Assume that 96 of ticket hold.pdfarihanthtextiles
Answer only with excel instructions.
Assume that 96% of ticket holders show up for an airline flight. If a plane seats 200 people, how
many tickets should be sold to make the chance of an overbooked flight (more ticket holders
show up for a flight than there are seats available) is at most 10%.
Solution
Say no. of tickets booked = x
Now only 0.96x will turn up
No. of seats = 200
Now these 0.96x people should get a seat with 90% probability
200 / (0.96x) >=0.9
200/0.864 >= x
x <=231.48
x = 231
Airline will make 231 reservations.
A new species of sea horse has been discovered and is being sequenced.pdfarihanthtextiles
A new species of sea horse has been discovered and is being sequenced The genome of the new
species is being aligned using the reference sequence from a already-known species of sea horse
Since the two species are evolutionary diverged, there may be some differences between their
sequences Reference sequence: ACCTACATTCACAGAATGAT Fragments a) Align the set
of mini-fragments above. b) How are the sequences of the two sea horse species different? c)
Would this alignment have been easier or more difficult if you didn\'t have any reference
sequence at all (alignment without a reference is called \"de novo\")? Explain d) If there had
been sequencing errors, would this alignment have been easier or more difficult? Explain.
Solution
A) TAGATT TGAATG TCACTGA
B) There is a form of polymorphism occurring in the new sequence of the genes for the new
species of sea horses. There is single nucleotide polymorphism in the new species as C is
replaced by T and A instead of G which may probably occurred due to some sort of mutation
during genetic sequencing.
C) The given alignment would be difficult without reference DNA sequence as reference
sequence gives basic DNA information and a reference database techniques is much easier than
performing a de novo technique though de novo methods are well established using mass spectra
nowadays but still having a reference database helps and gives the better coding information of
protein sequence.
D) if there had been a sequence error there would be difficulty in alignment and in that case we
have to perform de novo sequencing using mass spectra analysis. To know the sequence of the
species and other information regarding the DNA characters..
Which of the following is the mechanism of action for Herceptin Her.pdfarihanthtextiles
Which of the following is the mechanism of action for Herceptin? Herceptin binds to the HER2
promoter to prevent transcription, thus lowering amounts of receptor. Herceptin binds to
intracellular HER2 proteins to prevent cancer cells from dividing. Herceptin binds to HER3 and
HER4 cell surface receptors to activate the immune system. Herceptin binds to extracellular
domain of HER2 and prevents internalization and subsequent cancer cell division. Herceptin
targets TNF alpha.
Solution
B) herceptin binds to intracellular ER2 proteins to prevent cancer cells from dividing
Trastuzumab (herceptin) activates p27 factor by inhibiting PI3K/Akt, Mirk and hKIS pathways.
HER2 protein can be expressed up to 100 times more in cancer cells. PI3K/Akt, Mirk and hKIS
are intracellular proteins in HER2 pathways are activated which promote cell proliferation.
Signals present in these pathways promote growth of blood vessels in order to supplement for
tumour formation or angiogenesis and therefore resulting in cell proliferation. Thus, when
herceptin inhibits PI3K/Akt, Mirk and hKIS pathways, the cell proliferation is inhibited..
Which of these statements best describes an element An element is c.pdfarihanthtextiles
Which of these statements best describes an element? An element is composed of three
subatomic particles. An element is formed when two atoms of the same kind are bonded
together. An element is formed when two or more different atoms combine chemically. An
element is composed of identical atoms.
Solution
An element is composed of identical atoms.
Molecules can be made of elements, but elements arent made from molecules. 2 or more atoms
of the same kind make up an element.For example H is hydrogen which is an element formed
from H atoms only whereas H2O is a compount formed from 2 different atoms H and O..
What is the general goal for descriptive statistics How is the goal.pdfarihanthtextiles
What is the general goal for descriptive statistics? How is the goal served by putting scores in a
frequency distribution? How is the goal served by computing a measure of central tendency?
How is the goal served by computing a measure of variability?
Solution
What is the general goal of descriptive statistics ?
Answer : To simplify , organize, and summarize data so that it is easier for researchers to see
patterns.
How is the goal served by putting scores in a frequency distribution?
A frequncy distribution provides an organized summary of the complete set of scores.
How is the goal served by computing a measure of central tendency?
Summarizes an entires set of scores with a single value that is representative of the whole set.
How is the goal served by computing a measure of variability?
Provides a single number that describes the differences that exist from complete score to another..
What effects are shown on this graph (assume that all effects where.pdfarihanthtextiles
What effects are shown on this graph? (assume that all effects where the marginal means differ
are significant)
Choose as many as applicable.
A. Main effect of A where scores are higher at A1 than A2
B. Main effect of A where scores are higher at A2 than A1
C, Main effect of B where scores are higher at B1 than B2
D, Main effect of B where scores are higher at B2 than B1
E. Interaction where the effect of A is larger at B1 than B2
F. Interaction where the effect of A is larger at B2 than B1
Solution.
What are adaptive peaks How do organisms move from one adaptive pea.pdfarihanthtextiles
What are adaptive peaks? How do organisms move from one adaptive peak to another? 100
words or more please
Solution
An equilibrium state in a population when the gene pool has allele frequencies that maximize the
average fitness of a population\'s members. In other words, A high point (perhaps one of several)
on an adaptive landscape; selection tends to drive the genotype composition of the population
toward a combination corresponding to an adaptive peak.
Most extant organisms are thought to sit on the “peaks” of such adaptive landscapes. However,
how does a phenotype shift from one peak to another is not clear. Common hypotheses include
(1) There are “ridges” connecting the adaptive peaks, such that phenotypes along the ridge are
more or less equally fit under a specific environment;
(2) There are no ridges connecting the peaks but when effective population size is small enough,
phenotypes may be able to traverse the less-adaptive region (i.e. adaptive valley) by genetic drift..
Acetabularia Information For Class 9 .docxvaibhavrinwa19
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
You have constructed a new reporter gene to help you find novel zebr.pdf
1. You have constructed a new reporter gene to help you find novel zebrafish mutations. The
reporter gene consists of several LEG/TCF binding domains in the enhancer fused to the coding
region for green fluorescent protein (GFP). Wild-type embryos that contain this transgene
normally express it in the brain and eye primordia and have no developmental defects. You then
mutagenize this reporter strain to look for new mutants that affect GFP expression.
Which developmental pathway are these mutants likely to be in and why?
You find a mutant (which you call GLO-1) that ubiquitously expresses your reporter gene
throughout the entire embryo. Which molecule in the above pathway is most likely to be mutated
and why?
Solution
Ans.) Nacre, a zebrafish homolog of MITF is required for pigment cell differentiation. We
isolated a promoter region of shell that contains Tcf/Lef binding sites which will mediate Wnt
responsiveness. This promoter binds to zebrafish Lef1 protein in vitro, and a nacre
communicator construct is powerfully inhibited by dominant-negative Tcf in malignant
melanoma cells. Mutation of Tcf/Lef sites abolishes Lef1 binding and reporter operates in vivo.
Wnt signaling so directly activates shell, which in flip ends up in pigment cell differentiation.
It was determined that the human melanocyte-specific MITF promoter contains many purported
Tcf/Lef binding sites, hallmarks of Wnt/-catenin-mediated transcriptional control. To test the
hypothesis that nacre could be a target of the Wnt/-catenin pathway in zebrafish, a
promoter/enhancer region is isolated for this sequence from a genomic bacteriophage library.
This genomic fragment contains the translation initiation site for nacre which is associated with a
836-bp upstream region with a possible transcription begin site, a cAMP response element
(CRE) and several agreement Tcf/Lef binding sites. These CRE and Tcf/Lef locations are not
fully preserved between the human and zebrafish promoters in either their sequences or their
positions from the transcription begin site. To examine whether the purported putative nacre
promoter/enhancer will direct correct abstraction management of organic phenomenon, injected
one -cell zebrafish embryos with the 836-bp deoxyribonucleic acid fragment driving a green
fluorescent macromolecule (GFP) communicator sequence. Mosaic gene expression is typical for
transient transgenics in zebrafish and because the neural crest springs from only a few precursor
cells, reporter potency is minimized. Despite these, it was ready to analyze the fate of the few
reporter-expressing cells in injected animals.
