Genetics and Breeding for Stripe Rust Resistance in Bread Wheat Cultivars in Egypt

1. Genetics and Breeding for Stripe Rust Resistance in Bread Wheat
Cultivars in Egypt
2nd International and 3rd National Conference on Recent Advances in Drug Discovery and Development, 15-16 NOVEMBER 2023, The
University of Lahore, Pakistan.
By
Prof. Dr. Atef A. Shahin
Head of Wheat Diseases Dept.,
Department of Wheat Diseases Research,
Plant Pathology Research Institute (PPRI),
ARC, Egypt
E-mail: a.a.shahin@hotmail.com, a.shahin@arc.sci.eg
CAUTION:- Increasing risk of stripe (yellow) rust outbreaks North Africa to South Asia

3. The production of bread wheat is threatened by many biotic (diseases, insect pests, and
weeds) and abiotic (moisture stress, low soil fertility, repeated drought, and others)
problems, the most significant that is yellow or stripe rust caused by Puccinia striiformis f.
sp. tritici.
Wheat is one of
approximately 300,000
potentially edible plant
species, of which just
over 100 are commonly
cultivated (Fig. 1.1). Of
these just three – maize,
rice, and wheat – provide
nearly 60% of all human
calories and wheat alone
provides approximately
20% of all calories and
protein.
Wheat is a staple for both rich and poor

4. Typical stripe rust symptoms on the seedling and adult-plant leaves stage , spike 4
seedling leaves stage

5. Country /Year Crop losses Millions $
USA 2000-07
2010
6.5 million tones
2.2 millions tones $US 30 Washington State
Australia 2003-2006 AU$ 30-90
Australia 2009 AU$ 127
China 1950
64, 90,02
14.4 million tones
More than 20 million
Turkey 1992
1996
2000
2009-10
26.5% (Gereck > 1 m ha)
1.2 million tones
3% Gerek 79
568
53
10
Iran 1992-94
2007 and 09
2010
2.5 milliom tones
2 million ha
650.000 ha spray
258
?
?
Syria 2010 Cham 8 (80% yield loss) 80% of Area
Ethiopia 2010 $US 3.2 in fungicide application in
Ethiopia
Pakistan 2005 $100 million USD**
During the last decades, several yellow rust epidemics in most of the
wheat-growing areas
The last dramatic epidemic took place in 1997 in which stripe rust and national average loss in grain yield ranged from 14 % -
20 % in Delta region (El-Daoudi et al., 1998), Recently in 2020, Losses in grain yield per plot was 37.72% and 69.33% during
2018 and 2019 growing seasons, respectively at the Delta region in Egypt. The highest grain yield losses were recorded with
wheat cvs.; Gemmeiza 11 (Shahin et al., 2020).
* DOI: https://doi.org/10.3329/bjb.v51i4.63481 5

6. • Stripe (Yellow) rust and Virulence trends;
 Yr9 (1990)
 Yr27 aggressive race since 2010
 Yr32 race 2014
 Warrior race since 2015
 A unique race of the wheat stripe rust
pathogen (2019)
 Yr10 race 2022
Pathogenic variabilities: race analysis
• Yellow : Yr27 race and Warrior (Avirulence/ Virulence formula)
• 2+, 5,10,15 / 1, 2, 3, 4, 6, 7, 8, 9, 17, 25, 27, 32, Sp, Su
6
Aggressive yellow rusts
• The Warrior-type race of yellow rust was first found back in 2011 and it is
virulent against a wider range of resistance genes.
Warrior-type race
The Wheat Disease Research Department , at the Sakha Agriculture Research Station, Plant Pathology Research Institute (PPRI), Agricultural
Research Center (ARC), Egypt discovered the novel P. striiformis race. , 2019

7. SCIENCE AND TECHNOLOGY
AARHUS UNIVERSITY
Report for Puccinia striiformis race analyses 2013, Global Rust Reference Center
(GRRC), Denmark. January 31, 2014.
Race identification by GRRC (Denmark)
GRRC race analyses of Puccinia striiformis in 2012 and 2013
-,-,-,-,-,6,7,-,-,-,-,-,-,-,-,-,AVS,-
-,2,-,-,-,6,7,-,-,-,-,-,-,-,-,-,AVS,-
-,(2),-,-,-,6,7,9,-,-,-,-,25,27,-,-,AVS,-
×
Yr 27 virulent strain of yellow rust has caused significant losses in some countries in
North Africa, Near East and Central and South Asia during the serious epidemics in
2009, 2010 and 2013
7

9. Adult plant infection type
Resistant
Susceptible Intermediate
Stripe Rust Reaction
9
0
10
20
30
40
50
60
70
80
90
Old race Yr27 race Warrior race
Stripe rust severity of selected wheat
genotypes inoculated with old races, Yr27
race and warrior races at adult stage.

10. Giza 167
Gemmeiza5
Sids1
Beni Sweif1
Sakha93
Shandaweel1
Beni Sweif6
Sakha61
Gemmeiza10
Gemmeiza11
Beni Sweif4
Beni Sweif5
Shandweel 1
Sohag3
Giza168
Giza171
Sakha94
Sakha 95
Gemmeiza7
Sids12
Sids13
Sids 14
Sids 14
Misr1
Misr2
Misr3
Misr4
Some representative Egyptian wheat cultivars

11. Yellow rust reaction during 2018/2019
growing season for the two inbred line
(IL) populations Gemmeiza11/Avocet S
and Sids12/Avocet S developed by
wheat research section at Sakha
Agricultural Research Station.
inbred line (IL) populations stripe rust field
reaction
The adult plant field response to stripe rust under field condition for the two Egyptian bread wheat
cultivars Sids12 and Gemmeiza11, four monogenic lines and their eight F1 crosses.
Cross name
Adult plant field response to stripe rust‡
P1 P2 F1
Sids12//Yr5/6* Avocet S S R R
Sids12//Yr10/6* Avocet S S R R
Sids12//lYr15/6* Avocet S S R R
Sids12//YrSp/6* Avocet S S MRMS R
Gemmeiza11//Yr5/6* Avocet S S R R
Gemmeiza11//Yr10/6* Avocet S S R R
Gemmeiza11//Yr15/6* Avocet S S R R
Gemmeiza11//YrSp/6* Avocet S S MRMS MR
‡ R= resistance, MR= moderately resistance, MS= moderately susceptible and S = susceptible .

12. Adult plant response for stripe rust, observed hypothetical ratios, chi-square and probability
values for nine wheat F2 populations inoculated with Pst under field conditions.
Cross
No. of plants
Ratio 2 P. value
Number of
genes and
mode of
inheritance†
Resistant Susceptible Total
Sids12//Yr5/6* Avocet S 214 19 233 15 : 1 1.44 0.23 2D
Sids12//Yr10/6* Avocet S 170 93 263 11 : 5 2.07 0.15 1R, 1D
Sids12//Yr15/6* Avocet S 266 30 296 57 : 7 0.20 0.66 3D
Sids12//YrSp/6* Avocet S 226 92 318 11 : 5 0.80 0.37 1R, 1D
Gemmeiza11//Yr5/6* Avocet S 218 28 246 57 : 7 0.02 0.89 3D
Gemmeiza11//Yr10/6* Avocet S 172 54 226 3 : 1 0.15 0.70 1D
Gemmeiza11//Yr15/6* Avocet S 178 35 213 13 : 3 0.75 0.39 1R, 1D
Gemmeiza11//YrSp/6* Avocet S 110 122 232 7 : 9 1.27 0.30 2R
†D = dominant and R = recessive. Interpretation for some ratios can be found in Fasoulas (1980).

13. Cross name
No. of
planted F3
families++
Total no.
of plants
No. of
selected
zero type
plants*
No. of
nun-
segregati
ng zero
type
families
Percentage
of zero
type
plants/cros
s
Percentage
of zero type
plants/
cultivar
Sids12//Yr5/6* Avocet S 10 141 57 1 40
29
Sids12//Yr10/6* Avocet S 3 47 10 0 21
Sids12//lYr15/6* Avocet S 5 78 20 0 26
Sids12//YrSp/6* Avocet S 10 115 24 0 21
Gemmeiza11//Yr5/6* Avocet S 10 99 35 1 35
27
Gemmeiza11//Yr10/6* Avocet S 5 71 24 0 34
Gemmeiza11//Yr15/6* Avocet S 10 136 29 0 21
Gemmeiza11//YrSp/6* Avocet S 10 128 28 0 22
Total 63 815 227 2 -
Number of resistant plants selected from F3 families during the wheat growing season 2019/2020.
++ Selected F2 plants are resistance and phenotypically similar to the commercial cultivar.
*The selected plants have the same reaction like the monogenic line (zero type).

14. Molecular Markers
*Syed et al., 2011, J. Gen. Plant Pathol 77:174-177

15. Molecular characterization of wheat germplasm for strip
resistance genes (Yr5 , Yr10 and Yr15)
 A yellow rust resistance genes, Yr5 , Yr10, Yr15 shows immunity or high resistance to all
races . Establishment of DNA Markers for Yr5,Yr10,Yr15 genes facilitated marker assisted
selection and gene pyramiding in breeding programs.
 Molecular characterization and identification of candidate lines for stripe rust
resistance genes Yr5 , Yr10 , Yr15 depicted that genes Yr5 was found in 640 entries ,
Yr10 in 272 entries , Yr15 in 306 entries including the reference lines , while the
susceptible control didn’t amplify any of the resistance genes used in the study . single
gene-based resistance was detected in 347 entries , two genes in 132 entries .

16. No.
Stripe
rust
resistan
ce gene
Details of primer
sequences
Type of
primer
Allele
size
(bp)
References
1 Yr5
Sequence(5’-3’)
Sequence(5’-3’)
GTACAATTCACCTAGAGT
GCAAGTTTTCTCCCTATT
STS-7
STS-8
490 Chen et al
2 Yr10
Forward sequence
(5’-3’)
Reverse sequence
(5’-3’)
GCAGACCTGTGTCATTGGTC
GATATAGTGGCAGCAGGATA
Xpsp3000 230 Wang et al
3 Yr15
Forward sequence
(5’-3’)
Reverse sequence
(5’-3’)
GCGGGAATCATGCATAGGAA
AGAA
GCGGGGGCGAAACATACACA
AAAACA
Xbarc8 230 Yaniv et al
Sequences (F/R) of SSR marker used for 3 yellow rust
resistance genes.

17. The gene Yr5 was detected in 260 including 91 cultivar carrying Yr5 in heterozygous
condition. The stripe rust resistance gene by investigating two codominant STS
primers YrSTS7/8 and YrSTS9/10 in 640 entries , it has been concluded that these
markers are completely linked to Yr5. Based on epidemiological studies, Yr5 was
found effective against all rust virulent races.
STS primers marker, YrSTS7/8 and YrSTS9/10 analyses revealed that, out of
the tested genotypes 91 cultivar carrying Yr5 showed an indicative band
for Y5

18. The stripe rust resistance gene Yr10 was molecularly validated in 199 entries
. of which 11 cultivars were heterozygous , From 640 entries . the Xpsp3000
marker is suitable for identifying resistant genotypes at different plant growth
stages. designed two primer pairs (Yr10 F/R & Yr10 F1/R1) based on the
Yr10 sequence and produced markers completely linked to Yr10 .the findings
reported that varieties with gene Yr10 amplify a 230-bps fragment and those
lacking this gene amplify only 190 bps band fragment, which is confirmed in
the present investigation.

19. The stripe rust resistance gene Yr15 was detected in 152 entries , depicting
heterozygous condition of this gene in 32 genotypes producing both resistance and
susceptibility specific fragments as heterozygotes .Xbarc8 was used which showed
the presence of Yr15 gene in 306 entries. So, this gene was present in maximum
cultivars showing its effectiveness against the predominant and virulent pathogen.
PCR amplification of Yr15 gene by using Xbarc8, which produces two fragments, viz., 230 bp
as resistant and 200 bp as susceptible.

20. The responses of crosses to two races of Pst at seedling stage in the greenhouse and at the adult-
plant stage and molecular marker
No. Cross
Seedlinga
Adult plant b Marker
2E4 262E31
1 27 (??? × Yr??) 0; 0 0
2 41 0; 0 0/TR
3 28 (Yr10+15) 0; 0 0 Yr15
4 12 0; 0 0
5 19 (Yr10+Sp ) 0; 3 0
6 1 0; 0 TR
7 34- (Yr10+15) 0 0 0 Yr15
8 26 0; 2 0 Yr15
9 24 0; 0 0
10 37 (Yr10+15) 1 0 0
11 39 (Yr10+15) 0; 0 0-HN
12 44-Misr 3 7 8 MR ??
13 40 0; 0 0
14 8 0; 3 0 Yr15
15 25 0 2 0 Yr15
16 7 0; 0 0
17 33 (Yr10+15) 3 0 0/5R
18 35 (Yr10+15) 0; 0 0/5R
19 36 1 0 0
20 18 (Yr10+15) 6 6 0/TR Yr10
21 23 0; 0 0
22 9 0; 0 0
23 10 0; 2 0
25 22 0; 0 0
26 11(Yr10+5) 6 0 0/5R
27 3 (Yr5+Sp) 7 3 0/TR

21. Conclusion
• Close cooperation between (the wheat pathologists, wheat breeders) in Egypt and International research
center and labs, e.g. ICARDA, CIMMYT, GRRC, and USDA,. Such cooperation includes exchange and improved
crop genotypes, sharing of good practices, and joint training.
• Close cooperation between the wheat pathologists in Egypt and International research center and labs, e.g.
Global rust reference center (GRRC), led to confirm observe of a new novel race of wheat stripe rust- in
Egypt, 2019.
• Race analysis results indicated the presence the Yr27 virulence (2010), the Warrior-races was detected in
Egypt (2015), in addition to and YrSp virulence race. Recently, detection of Yr10 virulence race (2022) in
Egypt.
• Despite of presence of Warrior-races and new aggressive race in Egypt, high level of stripe rust resistance is
observed on most of the Egyptian wheat promising lines.
• The strip rust resistant genes Yr5, Yr10, Yr15, Yr51, Yr57 and Yrkk were effective against the dominating Pst
races in Egypt.
• Close cooperation has been established in Egypt between wheat breeders and wheat pathologist from long
time ago, generated a good system for rust diseases breeding. Recently, breeders and pathologists now use
the effective genes to develop wheat varieties to enhance resistance for the dominating stripe rust races in
Egypt.

22. Egyptian Noble prize-winners

27. You need to do is hard work to achieve your dream
That's my constructive advice to you today
Egyptian chemist Noble prize-winner The world's most famous football player

28. Acknowledgements
• Agricultural Research Center, ARC, Egypt.
• Department of Wheat Diseases Research,
• Plant Pathology Research Institute (PPRI)
• The University of Lahore
• Prof. Dr. Mohammad Ashraf, H.I.SI. POP, Rector University of Lahore, Pakistan
• Prof. Dr. Ahsan Sheikh, Director Immb/CRiMM, University of Lahore, Pakistan
Dr. Asma Ahmed, and Dr. Anam Naz, Lahore University, Pakistan
Rehana Badar, Lahore University, Pakistan
Prof. Dr. Adel Hagras, ARC, Egypt
Dr. Khaled E. Ragab, ARC, Egypt
Dr. Sedahom A. Abdelkhalik, ARC, Egypt
Thanks to all the people who have contributed to organizing this
great event
2nd International and 3rd National Conference on Recent Advances in Drug Discovery and Development, 15-16 NOVEMBER 2023, The
University of Lahore, Pakistan.
Thanks for your attention