This document describes the UGene laboratory for Molecular Research and Development located near the University of Qadisiyah gate in Missan, Iraq. It provides contact information for the lab and lists research equipment and materials used, including sources. The document also details the lab's DNA extraction process from blood samples and agarose gel electrophoresis protocol for analyzing DNA quality and visualizing PCR products. It describes preparing the agarose gel, loading the PCR products, and running electrophoresis at 90 Volts for 45 minutes to separate the DNA fragments by size.

1. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
1
Researcher: Adel
University of Qadisiyah
Species: Homo sapiens
Type of samples: Blood
Total number of tested samples: 20
‫ﻧﻨﺼﺢ‬ ‫ﻟﺬا‬ ‫ﻣﻨﮭﺎ‬ ‫ﺑﻨﺴﺨﺔ‬ ‫اﻟﻜﺮام‬ ‫ﺑﺎﺣﺜﯿﻨﺎ‬ ‫ﺟﻤﯿﻊ‬ ‫ﺗﺠﮭﯿﺰ‬ ‫وﯾﺘﻢ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﺑﻤﺨﺘﺒﺮ‬ ‫ﺧﺎﺻﺔ‬ ‫ھﻲ‬ ‫اﻟﻔﻮرم‬ ‫ھﺬه‬ :‫ﻣﻼﺣﻈﺔ‬
‫اﻟﺒﺎﺣﺜﯿﻦ‬
‫ﺑﺈﻋﺎدة‬
‫ﻟﻠـ‬ ‫ﺗﺠﻨﺒﺎ‬ ‫اﻟﺨﺎﺻﺔ‬ ‫ﺑﻄﺮﯾﻘﺘﮭﻢ‬ ‫اﻟﻜﺘﺎﺑﺔ‬ ‫ﺻﯿﺎﻏﺔ‬
Plagiarism
‫اﻟﺘﻘﺪﯾﺮ‬ ‫ﻣﻊ‬
1: Materials and Methods
A: Materials
Material Cat. No. Company
1 Agarose LE 32034-50 Intron/Korea
2 RedSafe nucleic acid staining solution 21141 Intron/Korea
3 1kb DNA Ladder Plus, Marker, OEM M1191 GDSBio/China
4 GoTaq® Long PCR Master Mix M4021 Promega/USA
5 10X TAE (Tris Acetate EDTA) buffer V4271 Promega/USA
6 Primers --- Macrogen/Korea
B: Equipments
Material Company Country
1 Microfuge IB Centrifuge Beckman Coulter Germany
2 Dry microtubes incubator ae UK
3 Optimus 96G thermal Cycler QLS UK
4 Electrophoresis system Cleaver UK
5 Kern PFB balance Kern & Sohn Germany
6 UVP Analytik Jena UK
7 Pipettes DARWELL China
8 NanoDrop™ 2000 Spectrophotometers ND-2000
Thermo Fisher
Scientific, USA

2. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
2
DNA extraction from whole Blood (AddPrep Genomic DNA Extraction Kit)
1. Transfer 200 µl of blood into a 1.5 ml micro-centrifuge tube and add 200 µl of Lysis
discard the supernatant, and add 200 µl of Lysis Solution, and resuspend the cell pellet by
pipetting.
2. Add 20 µl of Proteinase K solution (20 mg/ml) to the sample tube, mix by vortexing, and
incubate at 56 until the tissue is completely lysed: Vortex occasionally during
incubation to disperse the sample, or place in a shaking water bath or on a rocking
platform.
3. Spin down the tube briefly to remove any drops form inside of sample tube lid.
4. (Optional RNase A treatment): If RNA-free genomic DNA is required, add the 20 µl of RNase
A Solution (10 mg/ml).
5. Add 200 µl of Binding Solution to the sample tube, and mix well by pulse-vortexing for 15
sec.
6. Incubate at 56 for 10 min: Longer incubation times have no effect on yield or quality of
the purified DNA.
7. Add 200 µl of absolute ethanol and mix well by pulse-vortexing for 15 sec.: After this step,
briefly spin down to get the drops clinging under the lid.
8. Carefully transfer the lysate into the upper reservoir of the spin column with 2.0ml
collection tube without wetting the rim.
9. Centrifuge at 13,000 rpm for 1 min: Pour off the flow-through and assemble the spin
column with the 2.0 ml collection tube.
10. Add 500 µl of Washing 1 Solution to the spin column with collection tube and centrifuge
at 13,000 rpm for 1 min: Pour off the flow through and assemble the spin column with
the 2.0 ml collection tube.
11. Add 500 µl of Washing 2 Solution to the spin column with collection tube and centrifuge
at 13,000 rpm for 1 min: Pour off the flow through and assemble the spin column with
the 2.0 ml collection tube.
12. Dry the spin column by additional centrifugation at 13,000 rpm for 1 min to remove the
residual ethanol in spin column.
13. Transfer the spin column to the new 1.5 ml micro-centrifuge tube.

3. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
3
14. Add 100 ~ 200 µl of Elution Solution to the spin column with micro-centrifuge tube, and
let stand for at least 1 min.
15. Elute the genomic DNA by centrifugation at 13,000 rpm for 1 min.
Agarose gel electrophoresis of DNA
The electrophoresis has been performed to determine the quality of the DNA
extractions and to visualise the PCR product size after finishing the PCR
programme. The concentration of the gels was depending on the type of the
product. In general, for DNA quality the agarose gel was 0.7%, while it was 1-2%
for the regular PCR products.
Preparing of the Agarose gel
The preparation of agarose gel was performed according to the protocol that
was described by Sambrook et al (1989). Briefly, 1 gm of agarose was dissolved
in about 100 ml of a 1X TAE buffer and heated to be boiled in a microwave
machine.
Following a cooling step at 45-50 ᵒC, 5 μl of RedSafe nucleic acid staining solution
was added to the gel and poured into the gel cast and left for about 30 minutes
to be completely solidified.
The gel-plate was transferred into the gel tank and filled with 1X TAE buffer to
point of covering the gel surface.
Loading the PCR products
About 10 μl of each PCR products were inserted into the middle of it’s
correspondence hole in the 1% gel. About 5 μl of 1kb DNA Ladder Plus, Marker
was added to the first hole in the lines of the gel to be served as a marker for
measuring the size of the PCR products.

4. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
4
Electrophoresis
Following the loading of 1kb DNA Ladder Plus, Marker and the samples, the
electrophoresis system was set as following: 90 Volt, constant current, 45
minutes time. Finally, the gel was transferred into UVP system to fisualise the
PCR products under 320nm UV light source.
1kb DNA Ladder Plus, Marker, OEM
Preparation of primers
According to instruction of the primer synthesiser company, the primers
(originally lyophilized), were dissolved in the free ddH2O to obtain a final
concentration of 100 μM/µl which served as a stock solution that stored at -20
ᵒC. A concentration of 10 μM/µl was prepared from the stock primers to be used
as a work primer.

5. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
5
Primers used in this study
Target
gene
Sequence (5’-3’)
Ta
(ᵒC)
Product
size
Accession
number
Reference
mtDNA
F TCTAAGCCTCCTTATTCGAGCCGA
63 8.9 Kb OM990735.1
Akbari et
al., 2015
R TTTCATCATGCGGAGATGTTGGATGG
GoTaq® Long PCR Master Mix
GoTaq® Long PCR Master Mix is a ready-to-use solution for long PCR targets. The
master mix contains everything needed to perform long PCR—optimized buffer,
dNTPs, MgCl2 and an optimized hot-start enzyme blend for long PCR. The
GoTaq® Long PCR Master Mix requires little or no reagent optimization and can
amplify up to 30kb of genomic DNA and 40kb of lower-complexity targets.
The GoTaq® Long PCR Master Mix uses a blend of hot-start, recombinant Taq
DNA polymerase and a recombinant proofreading DNA polymerase. The
recombinant Taq DNA polymerase is bound by proprietary antibodies that
inhibit activity at lower temperatures. This allows reactions to be set up at room
temperature. The polymerase activity is restored after an initial denaturation
cycle at high temperature. In addition to Taq DNA polymerase, the GoTaq® Long
PCR Master Mix contains a small amount of DNA polymerase with 3 ́-5 ́
exonuclease (i.e., proofreading) activity.
DNA damage analysis assay
Total cellular DNA was extracted using the AddPrep Genomic DNA Extraction Kit.
DNA was quantified using NanoDrop 2000 spectrophotometer. PCR primers
were previously described (Akbari et al., 2015). For mtDNA damage analysis we
used forward primer; 5ʹ-TCTAAGCCTCCTTATTCGAGCCGA-3ʹ, and reverse primer;
5ʹ-TTTCATCATGCGGAGATGTTGGATGG-3ʹ, to amplify an 8.9kb region of mtDNA.
The basic idea for this experiment is that the presence of damage in a DNA
template halts polymerase elongation resulting in a lower amount of PCR

6. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
6
product compared with an undamaged DNA template. The PCR reaction
contained; 10ng DNA template, 20pmol of each primer, GoTaq® Long PCR
Master Mix, in 30μl reaction. PCR was carried out according to the listed data in
the table 2.1 and table 2.2.
Table 1.1: Preparation of PCR solutions
Components Concentration Volume (50 µl)
GoTaq® G2 Green Master Mix 1X 25 µl
Forward primer 10 µM/µl 4 µl
Reverse primer 10 µM/µl 4 µl
ddH2O - 13 µl
DNA 10 ng 4 µl
Table 1.2: PCR conditions
Phase Tm (ᵒC) Time Cycles
Initial denaturation 94ᵒC 5 min 1X
Denaturation 94ᵒC 30 sec.
35X
Annealing 63ᵒC 30 sec.
Extension 72ᵒC 9 min
Final extension 72ᵒC 10 min 1X

7. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
7
2: Results
2.1: Optimisation step:
PCR products of the amplification of a specific region of mitochondrion of
Homo sapiens
The size of the PCR product is 8.9 kb. One sample was used at this step (Sample=
Q01). The gel was 1% and the DNA dye is RedSafe (Intron, Korea). V: 90, Time:
45 minutes. M: DNA ladder
M 54˚C
50˚C 56˚C
700
400
10000
1500
3000
500
8000
300
200
100

8. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
8
PCR products of the amplification of a specific region of mitochondrion of
Homo sapiens
The size of the PCR product is 8.9 kb. The gel was 1% and the DNA dye is RedSafe
(Intron, Korea). V: 90, Time: 45 minutes. M: DNA ladder.
PCR products of the amplification of a specific region of mitochondrion of
Homo sapiens
The size of the PCR product is 8.9 kb. The gel was 1% and the DNA dye is RedSafe
(Intron, Korea). V: 90, Time: 45 minutes. M: DNA ladder.

9. ‫اﻟﺠﺰﯾﺌﯿﺔ‬ ‫ﻟﻸﺑﺤﺎث‬ ‫اﻟﺘﺨﺼﺼﻲ‬ ‫ﯾﻮﺟﯿﻦ‬ ‫ﻣﺨﺘﺒﺮ‬
–
UGene lab for Molecular R&D
‫اﻻﺷﺮف‬ ‫اﻟﻨﺠﻒ‬
/
‫اﻟﻜﻮﻓﺔ‬
–
‫ﺣﻲ‬
‫اﻟﺮﺋﯿﺴﻲ‬ ‫اﻟﺪم‬ ‫ﻣﺼﺮف‬ ‫ﻣﻘﺎﺑﻞ‬ ، ‫ﻣﯿﺴﺎن‬
‫ﻣﯿﺴﺎن‬ ‫ﺟﮭﺔ‬ ‫اﻟﻜﻮﻓﺔ‬ ‫ﺟﺎﻣﻌﺔ‬ ‫ﺑﻮاﺑﺔ‬ ‫ﻗﺮب‬ ،
Facebook @UGeneLab | E-mail: ugene.ulab@gmail.com
07810415762 - 07711696105
9