356 MHR • Calculus and Vectors • Chapter 6 Eighth pages 356 MHR • Calculus and Vectors • Chapter 6 TA S K Taxi Cab Vectors A taxi has three passengers when it starts at A. It must drop off two people at B and the third at C. The arrows represent one-way streets. a) Using vectors, find two different routes that go from A to C via B. b) Show that the total displacement is equal in each case. In the taxi, travelling northbound takes 12 min per block, travelling southbound takes 5 min per block, travelling westbound takes 6 min per block, travelling eastbound takes 8 min per block, and travelling northeast or southwest takes 10 min per block. c) Which of your routes takes less time? d) Is there a best route? Is it unique? e) Identify which vector properties are used in your solution. f) If the taxi charges for mileage are $0.50/rectangular block and the time charges are $0.10/minute, what is the cheapest route from A to C? How much should each passenger pay? 8.1 RNA Polymerases and Sigma Factors RNA polymerase is a complex enzyme that carries out transcription by making RNA copies (called transcripts) of a DNA template strand. In bacteria, the RNA pol holoenzyme is made up of: Core polymerase: a2, b, b′ Required for the elongation phase Sigma factor: s Required for the initiation phase ‹#› 1 Subunit Structure of RNA Polymerase ‹#› 2 FIGURE 8.3 ■ Subunit structure of RNA polymerase. Two views of RNA polymerase. The channel for the DNA template is shown by the yellow line. Subunits (αI, αII, β, β′, and ω) are color-coded dark green, medium green, light green, cyan, and gold, respectively. The function of the omega (ω) subunit is currently unclear. Recent evidence suggests it may have a role in sigma factor competition for core polymerase. Sigma factor (red), which recognizes promoters on DNA, is shown separate from core polymerase in the left-hand panel. Different functional areas of sigma are labeled sigma 1 through sigma 4 (σ1–σ4). Sigma factor interacts with the alpha (α), beta (β), and beta-prime (β′) subunits. The molecule on the left is rotated 110° to give the image on the right. To view stereo images of RNA polymerase, locate code 1L9Z in the RCSB Protein Data Bank on the Internet. Source: Robert D. Finn et al. 2000. EMBO J. 19:6833–6844. Sigma Factors – 1 The sigma factor helps the core enzyme detect the promoter, which signals the beginning of the gene. Every cell has a “housekeeping” sigma factor. In Escherichia coli, it is sigma-70. Recognizes consensus sequences at the –10 and –35 positions, relative to the start of the RNA transcript (+1) A single bacterial species can make several different sigma factors. ‹#› 3 Sigma Factors – 2 ‹#› 4 FIGURE 8.4 ■ –10 and –35 sequences of E. coli promoters. A. Alignment of sigma-70 (σ70)-dependent promoters from different genes. Dots were added to help visualize alignments: biotin synthesis (bioB); cytochrome o (cyoA); galactose utilization (galE) ...

1. 356 MHR • Calculus and Vectors • Chapter 6
Eighth pages
356 MHR • Calculus and Vectors • Chapter 6
TA S K
Taxi Cab Vectors
A taxi has three passengers when it starts at A. It must drop off
two people at
B and the third at C. The arrows represent one-way streets.
a) Using vectors, find two different routes that go from A to C
via B.
b) Show that the total displacement is equal in each case.
In the taxi, travelling northbound takes 12 min per block,
travelling
southbound takes 5 min per block, travelling westbound takes 6
min per
block, travelling eastbound takes 8 min per block, and travelling
northeast or
southwest takes 10 min per block.
c) Which of your routes takes less time?
d) Is there a best route? Is it unique?
e) Identify which vector properties are used in your solution.

2. f) If the taxi charges for mileage are $0.50/rectangular block
and the time
charges are $0.10/minute, what is the cheapest route from A to
C? How
much should each passenger pay?
8.1 RNA Polymerases and Sigma Factors
RNA polymerase is a complex enzyme that carries out
transcription by making RNA copies (called transcripts) of a
DNA template strand.
In bacteria, the RNA pol holoenzyme is made up of:
Core polymerase: a2, b, b′
Required for the elongation phase
Sigma factor: s
Required for the initiation phase
‹#›
1
Subunit Structure of RNA Polymerase
‹#›
2
FIGURE 8.3 ■ Subunit structure of RNA polymerase. Two
views of RNA polymerase. The channel for the DNA template is
shown by the yellow line. Subunits (αI, αII, β, β′, and ω) are
color-coded dark green, medium green, light green, cyan, and
gold, respectively. The function of the omega (ω) subunit is

3. currently unclear. Recent evidence suggests it may have a role
in sigma factor competition for core polymerase. Sigma factor
(red), which recognizes promoters on DNA, is shown separate
from core polymerase in the left-hand panel. Different
functional areas of sigma are labeled sigma 1 through sigma 4
(σ1–σ4). Sigma factor interacts with the alpha (α), beta (β), and
beta-prime (β′) subunits. The molecule on the left is rotated
110° to give the image on the right. To view stereo images of
RNA polymerase, locate code 1L9Z in the RCSB Protein Data
Bank on the Internet. Source: Robert D. Finn et al. 2000. EMBO
J. 19:6833–6844.
Sigma Factors – 1
The sigma factor helps the core enzyme detect the promoter,
which signals the beginning of the gene.
Every cell has a “housekeeping” sigma factor.
In Escherichia coli, it is sigma-70.
Recognizes consensus sequences at the –10 and –35 positions,
relative to the start of the RNA transcript (+1)
A single bacterial species can make several different sigma
factors.
‹#›
3
Sigma Factors – 2
‹#›
4

4. FIGURE 8.4 ■ –10 and –35 sequences of E. coli promoters. A.
Alignment of sigma-70 (σ70)-dependent promoters from
different genes. Dots were added to help visualize alignments:
biotin synthesis (bioB); cytochrome o (cyoA); galactose
utilization (galE); lactose utilization (lacP); RNA polymerase
(rpoD); small-subunit ribosome protein (rpsL); tryptophan
synthesis (trp); glucose 6-phosphate dehydrogenase (zwf,
zwischenferment). Yellow indicates conserved nucleotides;
brown denotes transcript start sites (+1). B. The alignment in
(A) generates a consensus sequence of σ70-dependent promoters
(red-screened letters indicate nucleotide positions where
different promoters show a high degree of variability). “N”
indicates that any of the four standard nucleotides can occupy
the position.
Sigma Factors – 3
Mutations in the consensus sequence can affect the strength of
the promoter.
Some mutations can cause decreased transcription (called
“down mutations”), while others cause increased transcription
(“up mutations”).
‹#›
5
FIGURE 8.4 ■ –10 and –35 sequences of E. coli promoters. C.
Mutations in the lacP promoter that affect promoter strength
(lac genes encode proteins that are used to metabolize the
carbohydrate lactose). Some mutations can cause decreased
transcription (called “down mutations”), while others cause
increased transcription (“up mutations”).
Some E. coli Promoter Sequences Recognized by Different
Sigma Factors - 2

5. ‹#›
6
FIGURE 8.5 ■ RNA polymerase holoenzyme bound to a
promoter. A. The initial open complex forms when holoenzyme
binds to a promoter. DNA –10 and –35 contacts with sigma
factor are shown. Nontemplate strand is color-coded magenta;
template strand, green. B. Blowup of (A), with the beta subunit
removed to view the transcription bubble. Some bases in the
nontemplate strand are flipped outward (yellow) to interact with
sigma factor or the beta subunit after the transcription bubble is
formed. The base at position +1 is the first base transcribed.
8.2 Transcription of DNA to RNA
Transcription occurs in three phases:
1. Initiation: RNA pol holoenzyme binds to the promoter.
This is followed by melting of the helix and synthesis of the
first nucleotide of the RNA.
2. Elongation: the RNA chain is extended.
3. Termination: RNA pol detaches from the DNA, after the
transcript is made.
‹#›
7
Transcription Initiation
RNA polymerase holoenzyme forms a loosely bound, closed
complex with DNA.
Closed complex must become an open complex through the
unwinding of one helical turn.

6. RNA polymerase in the open complex becomes tightly bound to
DNA, and so begins transcription.
The first ribonucleoside triphosphate (r N T P) of the new RNA
chain is usually a purine (A or G).
‹#›
8
Initiation of Transcription
‹#›
9
FIGURE 8.6 ■ The initiation of transcription. Sigma factor
helps RNA polymerase find promoters but is discarded after the
first few RNA bases are polymerized. (Omega is not shown.)
Transcription Elongation
Elongation is the sequential addition of ribonucleotides from
nucleoside triphosphates.
The original RNA polymerase continues to move along the
template, synthesizing RNA at ~ 45 bases/sec.
The unwinding of DNA ahead of the moving complex forms a
17-bp transcription bubble.
Positive supercoils ahead are removed by DNA topoisomerases.
‹#›
10

7. Transcription Termination
All bacterial genes use one of two known transcription
termination signals:
1. Rho-dependent
Relies on a protein called Rho and a strong pause site at the 3′
end of the gen
2. Rho-independent
Requires a GC-rich region of RNA, as well as 4–8 consecutive
U residues
‹#›
11
The Termination of Transcription
‹#›
12
FIGURE 8.7 ■ The termination of transcription. A. Rho-
dependent termination requires Rho factor but not NusA. B.
Rho-independent termination requires NusA but not Rho.
Antibiotics That Affect Transcription
Antibiotics must meet two fundamental criteria:
They must kill or retard the growth of a pathogen, and they
must not harm the host.
Rifamycin B
Selectively binds to the bacterial RNA pol
Inhibits transcription initiation
Actinomycin D

8. Nonselectively binds to DNA
Inhibits transcription elongation
‹#›
13
Structure and Mode of Action of Rifamycin
‹#›
14
FIGURE 8.8 ■ Structure and mode of action of rifamycin. A.
Structure of rifamycin. The R groups indicated are added to
alter the structure and pharmacology of the basic structure. B.
Electron micrograph of Amycolatopsis. C. Contact points
between rifamycin and residues in the beta subunit of RNA
polymerase.
Structure and Mode of Action of Actinomycin D
‹#›
15
FIGURE 8.9 ■ Structure and mode of action of actinomycin D.
This antibiotic inserts its ring structure (A) between parallel
DNA bases and wraps its side chains along the minor groove
(B). (PDB code for B: 1DSC)
Different Classes of RNA

9. There are several classes of RNA, each designed for a different
purpose:
Messenger RNA (mRNA): encodes proteins
Ribosomal RNA (rRNA): forms ribosomes
Transfer RNA (tRNA): shuttles amino acids
Small RNA (sRNA): regulates transcription or translation
tmRNA: frees ribosomes stuck on damaged mRNA
Catalytic RNA: carries out enzymatic reactions
‹#›
16
RNA Stability
RNA stability is measured in terms of half-life.
The average half-life for mRNA is 1–3 minutes.
The stabilities of the different kinds of RNAs differ drastically.
The RNA degradosome is made up of an RNase, an RNA
helicase, and two metabolic enzymes.
Recent findings suggest that it is compartmentalized within the
cell.
‹#›
17
8.3 Translation of RNA to Protein
Once a gene has been copied into mRNA, the next stage is
translation, the decoding of the RNA message to synthesize
protein.
An mRNA molecule can be thought of as a sentence in which
triplets of nucleotides, called codons, represent individual

10. words, or amino acids.
Ribosomes are the machines that read the language of mRNA
and convert, or translate, it into protein.
They do so via the genetic code.
‹#›
18
The Genetic Code – 1
Consists of nucleotide triplets called codons
There are 64 possible codons:
61 specify amino acids
Include the start codons
3 are stop codons
The code is degenerate or redundant.
Multiple codons can encode the same amino acid.
The code operates universally across species.
Remarkably, with very few exceptions
‹#›
19
The Genetic Code – 2 First baseSecond Base U- RNA
codonSecond Base U- Amino acidSecond Base C-RNA codon
Second Base C-Amino acidSecond Base A-RNA codonSecond
Base A- Amino acidSecond Base G-RNA codonSecond Base g-
Amino acidThird baseUUUUP h eU CUS e rU A UT y rU G UC
y sUUUUCP h eUCCS e rU ACT y rUGCC y sCUU U AL e uU
C AS e rU A AStopU G AStopAUU U GL e uU CGS e rU A
GStopU GGT r pGCCU UL e uCCUP r oC A UH i sCG UA r

11. gUCCUCL e uCCCP r oC A CH i sCG CA r gCCCU AL e
uCCAP r oC A AG l nCG AA r gACC U GL e uCCGP r oC A
GG l nCGGA r gGAA U UI l eA C UT h rA A UA s nAG US e
rUAAUGI l eA CCT h rA A CA s nAGCS e rCAA U AI l eA C
AT h rAAAL y sAG AA r gAAAUGM e tA CGT h rA A GL y
sAGGA r gGGG U UV a lGCUA l aG A UA s pG G UG l yUGG
U CV a lGCCA l aG ACA s pGGCG l yCGG U AV a lG C AA l
aG A AG l uG G AG l yAGG U GV a lG CGA l aGAGG l
uGGGG l yG
‹#›
20
FIGURE 8.10 ■ The genetic code. Codons within a single box
encode the same amino acid. Color-highlighted amino acids are
encoded by codons in two boxes. Stop codons are highlighted
red. Often, single-letter abbreviations for amino acids are used
to convey protein sequences (see legend above).
tRNA Molecules
tRNAs are decoder molecules that convert the language of RNA
into that of proteins.
tRNAs are shaped like a clover leaf (in 2D) and a boomerang (in
3D).
A tRNA molecule has two functional regions:
Anticodon: hydrogen bonds with the mRNA codon specifying an
amino acid
3′ (acceptor) end: binds the amino acid
tRNAs contain a large number of unusual, modified bases.
‹#›

12. 21
Transfer RNA
‹#›
22
FIGURE 8.11 ■ Transfer RNA. A. Primary sequence. The letters
D, M, Y, T, and Ψ stand for modified bases found in tRNA. B.
Cloverleaf structure. DHU (or D) is dihydrouracil, which occurs
only in this loop; TΨC consists of thymine, pseudouracil, and
cytosine bases that occur as a triplet in this loop. The DHU and
TΨC loops are named for the modified nucleotides that are
characteristically found there. C. Three-dimensional structures.
The anticodon loop binds to the codon, while the acceptor end
binds to the amino acid. (PDB code: 1GIX)
Codon-Anticodon Pairing
‹#›
23
FIGURE 8.12 ■ Codon-anticodon pairing. The tRNA anticodon
consists of three nucleotides at the base of the anticodon loop.
The anticodon hydrogen bonds with the mRNA codon in an
antiparallel fashion. This tRNA is “charged” with an amino acid
covalently attached to the 3′ end.
Attaching Amino Acids to tRNA
Each tRNA must be charged with the proper amino acid before
it encounters the ribosome.

13. The charging of tRNAs is carried out by a set of enzymes called
aminoacyl-tRNA synthetases.
Each cell has generally 20 of these “match and attach” proteins,
one for each amino acid.
Each aminoacyl-tRNA synthetase must recognize its own tRNA
but not bind to any other tRNA.
So each tRNA has its own set of interaction sites that match
only the proper synthetase.
‹#›
24
Charging of tRNA Molecules by Aminoacyl-tRNA Synthetases
‹#›
25
FIGURE 8.14 ■ Charging of tRNA molecules by aminoacyl-
tRNA synthetases. At the end of this process, each amino acid is
attached to the 3′ end of CCA on a specific tRNA molecule.
Curved arrows indicate nucleophilic attack by electrons.
The Ribosome, a Translation Machine – 1
The ribosome translates the language of the mRNA code into
the amino acid sequences of proteins that conduct the activities
of the cell.
Ribosomes are composed of two subunits, each of which
includes rRNA and proteins.
In prokaryotes, the subunits are 30S and 50S and combine to
form the 70S ribosome.

14. ‹#›
26
FIGURE 8.15 ■ Bacterial ribosome structure. As this schematic
illustrates, note that a section of the 30S subunit (A) fits into
the valley of the 50S subunit (B) when forming the 70S
ribosome (C).
The Ribosome, a Translation Machine – 2
The 70S ribosome harbors three binding sites for tRNA:
A (acceptor) site: binds incoming aminoacyl-tRNA
P (peptidyl-tRNA) site: harbors the tRNA with the growing
polypeptide chain
E (exit) site: binds a tRNA recently stripped of its polypeptide
‹#›
27
Binding of tRNA
‹#›
28
FIGURE 8.17 ■ Binding of tRNA. X-ray-crystallographic model
of Thermus thermophilus ribosome with associated tRNAs. 50S
is red, 30S is magenta, and tRNAs in the A, P, and E sites are
blue, green, and yellow, respectively.) Inset: The formation of a
peptide bond between the peptidyl-tRNA in the P site and
aminoacyl-tRNA in the A site. The mRNA (light blue) travels

15. along the 30S subunit, and the growing peptide (yellow) exits
from a channel formed in the 50S subunit. (PDB codes: 1GIX
and 1GIY)
The Ribosome Is a “Ribozyme”
The ribosome makes the peptide bonds that stitch amino acids
together using a remarkable enzymatic activity called
peptidyltransferase.
Peptidyltransferase is actually a ribozyme (an RNA molecule
that carries out catalytic activity).
Part of 23S r R N A of the large ribosomal subunit
While highly conserved, there are differences in r R N A
sequences that increase in relation to the evolutionary distance
among species.
So r R N A serves as a molecular clock.
‹#›
29
How Do Ribosomes Find the Right Reading Frame?
Every m RNA DNA rRNA has three potential reading frames, so
how does the ribosome find the right one?
The upstream, untranslated leader RNA contains
a purine-rich sequence with the consensus
5′-AGGAGGU-3′.
Located 4–8 bases upstream of the start codon in Escherichia
coli
This Shine-Dalgarno sequence is complementary to a sequence
at the 3′ end of 16S rRNA of the 30S subunit.
‹#›

16. 30
Polysomes
Once a ribosome begins translating mRNA and moves off of the
ribosome-binding site, another ribosome can immediately jump
onto that site.
The result is an RNA molecule with many ribosomes moving
along its length at the same time.
The multiribosome structure is known as a polysome.
Ribosomes in a polysome are closely packed and arranged
helically along the mRNA.
Polysomes help protect the message from degrading RNases and
enable the speedy production of protein from just a single
mRNA molecule.
‹#›
31
Bacterial Transcription and Translation Are Coupled
Different ribosomes can bind simultaneously to the start of each
cistron within a polycistronic mRNA.
Before RNA polymerase has even finished making an mRNA
molecule, ribosomes will bind to the 5′ end of the mRNA and
begin translating protein.
This is called coupled transcription and translation.
Eukaryotic microbes, on the other hand, use separate cellular
compartments to carry out most of their transcription and
translation.
‹#›

17. 32
Coupled Transcription and Translation in Bacteria
‹#›
33
FIGURE 8.18 ■ Coupled transcription and translation in
bacteria. A. During coupled transcription and translation in
prokaryotes, ribosomes attach at mRNA ribosome-binding sites
and start synthesizing protein before transcription of the gene is
complete. B. Model of E. coli polysome showing the nascent
polypeptides (numbered) exiting from each ribosome. A
representative ribosome is shown in the dashed circle. Note the
helical arrangement of ribosomes along the chain, which are
held together by mRNA (blue tracing). The closer the ribosome
is to the 3′ end of the mRNA, the longer the synthesized protein
molecules grow.
Defining a Gene
Before we discuss translation, it helps to illustrate the
alignments between the DNA sequence of a structural gene, and
the mRNA transcript containing translation signals and protein-
coding sequences.
‹#›
34
FIGURE 8.20 ■ Alignment of structural genes in a bacterial
operon, the mRNA transcript, and protein products. In this
figure, the term “gene” refers to the region of DNA

18. corresponding to the entire mRNA transcript, including
upstream and downstream untranslated areas.
The Three Stages of Protein Synthesis
Polypeptide synthesis occurs in three stages:
Initiation: brings the two ribosomal subunits together, placing
the first amino acid in position
Elongation: sequentially adds amino acids as directed by mRNA
transcript
Termination: releases the completed protein and recycles
ribosomal subunits
Each phase requires a number of protein factors and energy in
the form of GTP.
‹#›
35
Prof. Olave will show video in class
Must know every detail of prokaryotic translation. I will only
summarize once.
‹#›
36
FIGURE 8.23 ■ Termination of translation. The completed
protein is released, and the ribosome subunits are recycled.
Antibiotics That Affect Translation
Streptomycin: inhibits 70S ribosome formation
Tetracycline: inhibits aminoacyl-tRNA binding to the A site
Chloramphenicol: inhibits peptidyltransferase

19. Puromycin: triggers peptidyltransferase prematurely
Erythromycin: causes abortive translocation
Fusidic acid: prevents translocation
‹#›
37
Antibiotics That Inhibit Protein Synthesis in Bacteria
‹#›
38
FIGURE 8.24 ■ Antibiotics that inhibit protein synthesis in
bacteria. Streptomycin (A) and tetracycline (B) bind to the A
site. Streptomycin causes mistranslation, tetracycline inhibits
tRNA binding. Chloramphenicol (C) and erythromycin (D) bind
to the peptidyltransferase site, thus inhibiting peptide bond
formation.
Unsticking Stuck Ribosomes
The molecule tmRNA has properties of both tRNA and mRNA.
It rescues ribosomes stuck on damaged mRNA that lacks a stop
codon.
‹#›
39
FIGURE 8.25 ■ tmRNA and protein tagging. B. Mechanism of
tmRNA tagging in E. coli.

20. 8.4 Protein Modification, Folding, and Degradation
For many proteins, translation is not the last step in producing a
functional molecule.
Often a protein must be modified after translation either to
achieve an appropriate 3D structure or to regulate its activity.
Primary, secondary, and tertiary structures of proteins can be
modified after the primary protein sequence has been assembled
by the ribosomes.
A healthy cell “cleans house” by degrading damaged or
unneeded proteins.
‹#›
40
Protein Processing after Translation
Protein structure may be modified after translation:
N-formyl group may be removed by methionine deformylase.
The entire methionine may be removed by methionyl
aminopeptidase.
Acetyl groups or AMP can be attached.
Proteolytic cleavages may activate or inactivate a protein.
‹#›
41
Protein Folding
Folding of many proteins requires assistance from other
proteins called chaperones.
GroEL and GroES chaperones

21. Form stacked ring with a hollow center
The protein fits inside the open hole.
DnaK chaperones
Do not form rings
Clamp down on a polypeptide to assist folding
‹#›
42
E. coli GroEL-GroES and DnaK Structures
‹#›
43
FIGURE 8.26 ■ E. coli GroEL-GroES and DnaK (HSP70)
structures. A. Three-dimensional reconstructions of GroEL-
ATP, GroEL GroES-ATP, and GroEL-GroES from cryo-EM.
The first two panels are side views; the third panel is a top
view. GroES is red. (PDB codes: 2C7E, 1PCQ) B. DnaK
clamping down on a peptide (yellow). (PDB code: 1DKX)
Protein Degradation: Cleaning House
Many normal proteins contain degradation signals called
degrons.
The N-terminal rule suggests that the N-terminal amino acid of
a protein directly correlates with its stability.
Proteasomes are protein-degrading machines found in
eukaryotes and archaea.
Bacteria contain ATP-dependent proteases, such as L o n and C
l p P.

22. ‹#›
44
Protein Degradation Machines
‹#›
45
FIGURE 8.27 ■ Protein degradation machines. A. Bacterial
ClpY ATPase and ClpQ protease (Haemophilus influenzae).
(PDB cod 1G3I) Two of the six subunits from each ring were
removed to reveal the interior cavity. The active sites involved
in peptide bond cleavage are indicated in pink. B. The 20S
proteasome from the methanoarchaeon Methanosarcina
thermophila. (PDB code: 1G0U)
E. coli Protein Folding versus Degradation Triage Pathways
Damaged proteins randomly enter chaperone-based refolding
pathways or degradation pathways until the protein is repaired
or destroyed.
‹#›
46
FIGURE 8.28 ■ E. coli protein folding versus degradation triage
pathways. The diagram depicts what can happen to a newly
synthesized protein. However, a protein that unfolds in response
to environmental stress (for example, heat) will undergo the
same triage process.

23. 8.5 Secretion: Protein Traffic Control
Proteins destined for the bacterial cell membrane or envelope
regions require special export systems.
Proteins meant for the cell membrane are tagged with
hydrophobic N-terminal signal sequences of 15–30 amino acids.
These sequences are bound by the signal recognition particle (S
R P).
Proteins then undergo cotranslational export.
‹#›
47
SRP and Cotranslational Export in E. coli
‹#›
48
FIGURE 8.29 ■ SRP and cotranslational export in E. coli. A
ribosome “paralyzed” by an SRP does not resume translating
protein until encountering FtsY in the membrane. Translation
can then recommence. Some proteins designated for integral
membrane location are inserted directly (top). Other integral
membrane proteins and proteins destined for the periplasm are
inserted or secreted via the Sec system (bottom).
Protein Export to the Periplasm
Many periplasmic proteins, such as S O D and maltose-binding
protein, are delivered to the periplasm by a common pathway
called the S e c A-dependent general secretion pathway.
The general secretion pathway has several steps, which can be

24. summarized as:
The peptide is completely translated in the cytoplasm.
The completed pre-secretion protein is then captured by a
piloting protein called S e c B.
S e c B unfolds and delivers the protein to S e c A, which is
associated with the S e c Y E G translocon.
‹#›
49
The SecA-Dependent General Secretion Pathway
‹#›
50
FIGURE 8.30 ■ The SecA-dependent general secretion pathway.
This pathway exports many proteins across the cell membranes
of Gram-negative and Gram-positive bacteria.
Protein Export in Gram-Positive Bacteria
Gram-positive bacteria must also export proteins across the cell
membrane and then fold and process them once they are
secreted.
Many streptococci cluster their secretion systems at the cell
membrane in an anionic phospholipid microdomain called the
ExPortal.
The ExPortal is located near the cell septum and appears linked
to peptidoglycan synthesis.

25. ‹#›
51
FIGURE 8.31 ■ Location of the ExPortal of Streptococcus
pyogenes. HtrA was identified using immunofluorescence. Note
that HtrA is located at the septum.
Export of Prefolded Proteins to Periplasm
The twin arginine translocase (T A T) can move a subset of
already folded proteins across the inner membrane and into the
periplasm.
Powered by the proton motive force
‹#›
52
FIGURE 8.32 ■ The twin arginine translocase (TAT). Model for
the Tat protein translocase, which includes proteins TatA, TatB,
and TatC.
Journeys to the Outer Membrane
Gram-negative bacteria need to export proteins completely out
of the cell.
For example, digestive enzymes and toxins
Seven elegant secretion systems have evolved:
Labeled Type I–VII
Some deliver the exported proteins to other dedicated transport
proteins in the periplasm.
Others provide nonstop service.
‹#›
53

26. Type I Protein Secretion
ABC transporters are the simplest of the protein secretion
systems and make up what is called the type I protein secretion.
Type I protein secretion moves certain proteins directly from
the cytoplasm to the environment.
Type I systems all have three protein components:
An outer membrane channel
An ABC protein at the inner membrane
A periplasmic protein lashed to the inner membrane
‹#›
54
Type I Secretion: The HlyABC Transporter
‹#›
55
FIGURE 8.33 ■ Type I secretion: the HlyABC transporter. A.
Hemolysin (HlyA) is transported directly from the cytoplasm
into the extracellular medium through a multicomponent ABC
transport system. The HlyB and D proteins are dedicated to
HlyA transport. TolC is shared with other transport systems.
Not drawn to scale. B. Molecular model of TolC. The beta
barrel channel spans the outer membrane, and the alpha helix
tunnel extends into the periplasm. Three monomers (red,
yellow, and blue) make up the channel. Source: Part A modified
from Moat et al. 2002. Microbial Physiology, 4th ed. Wiley-
Liss.

27. Name: _________________________
Biology 351- Homework Assignment #5 (10 points)
This assignment is due on Tuesday February 20th in lab by
11:21AM. Give yourself enough time to print out your
assignment in case you have printer problems. I will not accept
electronic copies. Hardcopies only, and late assignments are not
accepted in the biology department.
1. During transcriptional initiation RNA polymerase
holoenzyme recognizes the consensus sequences within the
promoter of E. coli. What part of the RNA polymerase
holoenzyme recognizes the consensus sequence?
2. Does RNA polymerase holoenzyme recognize the sense, or
antisense strand? The antisense strand is used for what purpose
during transcription?
3. A single strand of bacterial DNA contains the base sequence
-35 -10
+1
5’
CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTA
AGTGAGTATTGG 3’
a. What is the complementary sequence? Draw or type this
sequence just below and indicate its polarity (directionality) in
order to create a double-stranded DNA sequence.
b. Under the double-stranded DNA sequence, draw or type the
mRNA sequence that will be translated, and indicate its

28. polarity.
c. Which strand of the DNA serves as the coding strand, and
which serves as the template strand, for the synthesis of the
RNA transcript for this hypothetical gene fragment.
4. If a stop codon is not included in the mRNA molecule, how
would this affect the following:
a. translocation on the mRNA by polyribosomes
b. concentration of this specific polypeptide in the cell
5. How many different types of tRNA molecules exist in the
cell? For what purpose (hint: why are there 20 different tRNA
molecules)?