This honours research project report summarizes an investigation of the tumour necrosis factor superfamily (TNFSF) genes in the small-spotted catshark (Scyliorhinus canicula). Bioinformatic analysis of the S. canicula transcriptome identified potential TNFSF orthologs. A phylogenetic tree including TNFSF sequences from various vertebrates provided insight into the evolutionary relationships between these genes. Several S. canicula TNFSF sequences were amplified and sequenced to confirm their presence. The analysis suggests S. canicula possesses orthologs of most mammalian TNFSF genes, though is missing a few, and also expresses a TNFSF gene only found previously in cart
Phage adhere more strongly to mucus layers than surrounding environments across diverse animal species. In vitro experiments show that phage adhere specifically to mucin glycoproteins in mucus via interactions between Ig-like domains on phage capsids and glycan residues on mucins. Pretreating mucus-producing cells with phage reduces subsequent bacterial attachment and infection, protecting the underlying epithelium. The presence of Ig-like protein domains in phages from many environments suggests a widespread symbiotic relationship between phages and metazoans, whereby phage adherence to mucus provides a non-host-derived antimicrobial defense of mucosal surfaces.
1) A Yersinia effector protein called YopJ is known to induce apoptosis in infected macrophages by inhibiting host immune signaling pathways. YopJ from Y. pestis KIM (YopJKIM) has enhanced ability to cause apoptosis and activate caspase-1 compared to other YopJ isoforms.
2) This study found that two amino acid substitutions (F177L and K206E) in YopJKIM are responsible for its increased activity. YopJKIM more strongly inhibits the NF-kB and MAPK pathways than other isoforms.
3) Infection of IKKb-deficient macrophages with Y. pestis activated caspase-1, indicating NF-kB normally suppresses
An Evolutionarily Conserved Long Noncoding RNA TUNA Controls Pluripotency and...Zach Rana
Here are 3 sentences summarizing the key points of the document:
1) An unbiased genome-scale RNAi screen in mouse embryonic stem cells identified 20 long noncoding RNAs (lincRNAs) required for maintenance of pluripotency, including linc86023 (also known as TUNA or megamind).
2) TUNA was found to form a complex with RNA-binding proteins at the promoters of pluripotency genes Nanog, Sox2, and Fgf4, and its depletion inhibited neural differentiation and impaired proliferation of mouse ESCs.
3) TUNA showed evolutionary conservation and central nervous system-restricted expression in vertebrates, and its knockdown
This document summarizes a study that investigated the role of the LESION SIMULATING DISEASE1 (LSD1) gene in the defense of soybeans (Glycine max) against the root parasite Heterodera glycines. The study found that overexpression of membrane fusion genes and defense genes in soybeans induced expression of the LSD1 gene. Overexpression of LSD1 led to reduced nematode parasitism, while silencing of LSD1 using RNA interference increased parasitism. This suggests LSD1 functions in the defense response of soybeans to the root parasite. The authors propose LSD1 may establish an environment where the plant cell can secrete materials to incapacitate the nematode
Montanari et al_Cellular_Microbiology_2011Giuseppe Bozza
The document reports on the discovery that human heat shock protein 90 (Hsp90) interacts with Neisseria meningitidis adhesin A (NadA) and interferes with NadA-mediated adhesion and invasion of human cells. Specifically, affinity chromatography revealed an interaction between recombinant soluble NadA and Hsp90. Further experiments using co-immunoprecipitation, dot blots, and far-Western blots confirmed the specific in vitro interaction between NadA and Hsp90, which required ADP but not ATP. Inhibition or modulation of Hsp90 in human cells through RNA interference, overexpression, addition of recombinant Hsp90, or use of the Hsp90 inhibitor 17-AAG
This document summarizes the challenges and progress of human gene therapy. It discusses three categories of gene therapy delivery (ex vivo, in situ, in vivo) and focuses on challenges of using retroviral vectors, including inefficient delivery, inability to transduce non-dividing cells, lack of long-term gene expression, and difficulties with large-scale manufacturing. While over 300 clinical trials have been approved, gene therapy efficiency remains low and no protocols have conclusively treated human disease. The document evaluates efforts to address these challenges through envelope protein engineering, hybrid vectors, and improved regulatory sequences.
This document analyzes the complete nucleotide sequence of the Staphylococcus aureus multiresistance plasmid pSK1. The analysis finds that the conserved 14 kb region of pSK1 encodes 12 putative gene products, including proteins involved in toxin-antitoxin systems, cell wall anchoring, and transport. Transcriptional profiling indicates that carriage of pSK1 has a minimal impact on the bacterial host, which may contribute to pSK1's ability to carry multiple resistance determinants.
This document discusses evidence of lateral transfer of a group IE intron between fungal and red algal small subunit rRNA genes. It finds that a group IE intron inserted at position 989 in the nuclear SSU rRNA gene of the red alga Hildenbrandia rubra is closely related to similar fungal IE introns, providing evidence the intron was laterally transferred rather than vertically inherited. Phylogenetic analysis of intron sequences and comparisons of intron secondary structures support a relationship between the red algal intron and fungal introns, making lateral transfer the most likely explanation for the intron's presence in H. rubra.
Phage adhere more strongly to mucus layers than surrounding environments across diverse animal species. In vitro experiments show that phage adhere specifically to mucin glycoproteins in mucus via interactions between Ig-like domains on phage capsids and glycan residues on mucins. Pretreating mucus-producing cells with phage reduces subsequent bacterial attachment and infection, protecting the underlying epithelium. The presence of Ig-like protein domains in phages from many environments suggests a widespread symbiotic relationship between phages and metazoans, whereby phage adherence to mucus provides a non-host-derived antimicrobial defense of mucosal surfaces.
1) A Yersinia effector protein called YopJ is known to induce apoptosis in infected macrophages by inhibiting host immune signaling pathways. YopJ from Y. pestis KIM (YopJKIM) has enhanced ability to cause apoptosis and activate caspase-1 compared to other YopJ isoforms.
2) This study found that two amino acid substitutions (F177L and K206E) in YopJKIM are responsible for its increased activity. YopJKIM more strongly inhibits the NF-kB and MAPK pathways than other isoforms.
3) Infection of IKKb-deficient macrophages with Y. pestis activated caspase-1, indicating NF-kB normally suppresses
An Evolutionarily Conserved Long Noncoding RNA TUNA Controls Pluripotency and...Zach Rana
Here are 3 sentences summarizing the key points of the document:
1) An unbiased genome-scale RNAi screen in mouse embryonic stem cells identified 20 long noncoding RNAs (lincRNAs) required for maintenance of pluripotency, including linc86023 (also known as TUNA or megamind).
2) TUNA was found to form a complex with RNA-binding proteins at the promoters of pluripotency genes Nanog, Sox2, and Fgf4, and its depletion inhibited neural differentiation and impaired proliferation of mouse ESCs.
3) TUNA showed evolutionary conservation and central nervous system-restricted expression in vertebrates, and its knockdown
This document summarizes a study that investigated the role of the LESION SIMULATING DISEASE1 (LSD1) gene in the defense of soybeans (Glycine max) against the root parasite Heterodera glycines. The study found that overexpression of membrane fusion genes and defense genes in soybeans induced expression of the LSD1 gene. Overexpression of LSD1 led to reduced nematode parasitism, while silencing of LSD1 using RNA interference increased parasitism. This suggests LSD1 functions in the defense response of soybeans to the root parasite. The authors propose LSD1 may establish an environment where the plant cell can secrete materials to incapacitate the nematode
Montanari et al_Cellular_Microbiology_2011Giuseppe Bozza
The document reports on the discovery that human heat shock protein 90 (Hsp90) interacts with Neisseria meningitidis adhesin A (NadA) and interferes with NadA-mediated adhesion and invasion of human cells. Specifically, affinity chromatography revealed an interaction between recombinant soluble NadA and Hsp90. Further experiments using co-immunoprecipitation, dot blots, and far-Western blots confirmed the specific in vitro interaction between NadA and Hsp90, which required ADP but not ATP. Inhibition or modulation of Hsp90 in human cells through RNA interference, overexpression, addition of recombinant Hsp90, or use of the Hsp90 inhibitor 17-AAG
This document summarizes the challenges and progress of human gene therapy. It discusses three categories of gene therapy delivery (ex vivo, in situ, in vivo) and focuses on challenges of using retroviral vectors, including inefficient delivery, inability to transduce non-dividing cells, lack of long-term gene expression, and difficulties with large-scale manufacturing. While over 300 clinical trials have been approved, gene therapy efficiency remains low and no protocols have conclusively treated human disease. The document evaluates efforts to address these challenges through envelope protein engineering, hybrid vectors, and improved regulatory sequences.
This document analyzes the complete nucleotide sequence of the Staphylococcus aureus multiresistance plasmid pSK1. The analysis finds that the conserved 14 kb region of pSK1 encodes 12 putative gene products, including proteins involved in toxin-antitoxin systems, cell wall anchoring, and transport. Transcriptional profiling indicates that carriage of pSK1 has a minimal impact on the bacterial host, which may contribute to pSK1's ability to carry multiple resistance determinants.
This document discusses evidence of lateral transfer of a group IE intron between fungal and red algal small subunit rRNA genes. It finds that a group IE intron inserted at position 989 in the nuclear SSU rRNA gene of the red alga Hildenbrandia rubra is closely related to similar fungal IE introns, providing evidence the intron was laterally transferred rather than vertically inherited. Phylogenetic analysis of intron sequences and comparisons of intron secondary structures support a relationship between the red algal intron and fungal introns, making lateral transfer the most likely explanation for the intron's presence in H. rubra.
31 октября самый цитируемый ученый русского происхождения, известный эволюционный биолог Евгений Кунин рассказал в Digital October о постмодернистском взгляде на эволюционные процессы.
http://digitaloctober.ru/ru/events/knowledge_stream_evolyutsiya_po_sluchayu
Pugacheva et al. COMPLETE GB_16.1_p.161_publ.online_08_14_2015 2Victor Lobanenkov
CTCF and BORIS are paralogous proteins that bind to DNA through their nearly identical zinc finger domains. The authors performed ChIP-seq experiments in three cancer cell lines to compare genomic binding patterns of CTCF and BORIS. They found that BORIS selectively occupies a subset (~29-38%) of CTCF binding sites that contain clustered CTCF motifs, termed 2xCTSes. In contrast, the majority of CTCF binding sites contain a single CTCF motif (1xCTSes) and are not occupied by BORIS. 2xCTSes are preferentially located at active promoters and enhancers in cancer cells, and are also enriched in regions retaining histones in sperm. The results suggest there are two
This thesis aims to test the performance of site- and time-heterogeneous evolutionary models in reconstructing the phylogeny of Echinodermata using complete mitochondrial genomes. The author characterized 29 echinoderm mitogenomes in terms of gene order, putative replication origins, and compositional heterogeneity. Gene orders support monophyly of each class. A phylogeny based on gene rearrangements supports the Cryptosyringid hypothesis. Putative replication origins were identified in some species. Compositional heterogeneity was observed within and between genes. When inferring phylogenies using homogeneous and heterogeneous models, only the CAT model corrected the long-branch attraction of Ophiuroidea sequences. Results support relationships not recovered by morphology
This study analyzed the occurrence and diversity of integrons in bacteria isolated from an urban wastewater treatment plant. A total of 697 isolates of Enterobacteriaceae and Aeromonas were screened for integrons. Three new gene cassettes were identified, including a novel aadA variant and genes involved in cell signaling and unknown functions. Thirteen different gene cassette arrays were detected, with four representing novel integrons. Approximately 80% of isolates were resistant to at least 3 antibiotic classes. The presence of novel integron structures in treated effluent suggests wastewater treatment plants may facilitate the formation and spread of antibiotic resistance genes.
This document discusses a study that found molecular and morphological evidence suggesting that the flagellate Ancyromonas is closely related to the common ancestor of metazoans, fungi, and choanoflagellates. Analyses of 18S rRNA gene sequences from major eukaryotic lineages using maximum likelihood, minimum evolution, and maximum parsimony supported Ancyromonas forming its own lineage, called Ancyromonadida, that is more closely related to opisthokonts than its nearest protist relatives. However, low bootstrap support for deep nodes limits the ability of 18S rDNA to fully resolve this aspect of eukaryotic phylogeny.
Salmonella typhimurium bacteria were grown aboard a Space Shuttle mission and compared to identical ground controls; microarray and proteomic analysis revealed that space flight altered the expression of 167 transcripts and 73 proteins in S. typhimurium, with the Hfq protein identified as a likely global regulator involved in the response; space flight samples also exhibited enhanced virulence in mice and extracellular matrix accumulation consistent with biofilm formation.
This study sequenced the genomes of 11 clinical Mycobacterium abscessus isolates from 8 US patients with pulmonary infections. Core genome analysis compared these isolates to 30 globally diverse strains to investigate population structure. Longitudinally sampled isolates showed very few genetic differences, suggesting homogenous infection populations. Genome content variation between isolates was 0.3-8.3% compared to the reference strain, indicating plasticity.
This document describes the development of an interspecies tiling array to analyze the transgenic genome of mice that were engineered to express the human protamine domain. Key points:
1) A single copy of the human protamine domain was randomly inserted into the genome of mice. Expression of the transgene recapitulated normal human levels without disrupting endogenous gene expression.
2) An interspecies tiling array was designed to simultaneously analyze the orthologous protamine domains in mouse and human. Probe design accounted for repetitive elements to allow comparison of highly similar sequences.
3) Initial results demonstrate the array can provide parallel analysis of orthologous sequences from different species, serving as a valuable tool for interrogating transgenic
ABCG2pos lung mesenchymal stem cells are a novel pericyte subpopulation that ...Rubin Baskir, Ph.D.
This document reports on a study investigating a novel pericyte subpopulation in the lung called ABCG2pos mesenchymal stem cells (MSC). The study found:
1) ABCG2pos lung MSC numbers were decreased in human pulmonary fibrosis (PF) and interstitial lung disease samples compared to controls.
2) In a mouse model of bleomycin-induced lung injury, GFP-labeled lung MSC-derived cells increased in number and localized to fibrotic and microvessel remodeling areas after 14 days.
3) Lung MSC responded to in vivo bleomycin injury with a profibrotic gene expression profile that was not replicated with in vitro bleomycin treatment, but
Austin Andrology is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Andrology.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all the areas of Andrology. Austin Andrology accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of andrology.
Austin Andrology strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group also brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
1. The authors performed a comparative phosphoproteomic analysis of host cells infected with wild-type Francisella novicida or a delta-lpcC mutant strain.
2. They found that actin and intermediate filaments/microtubules are important for F. novicida entry into host cells.
3. Infection with the delta-lpcC mutant induced hyper-phosphorylation and inhibition of the protein tristetraprolin, leading to increased production of cytokines like IL-1beta and TNF-alpha that can kill host cells.
This document summarizes key points from a class on microbial phylogenomics taught by Jonathan Eisen. It discusses reading scientific papers, specifically beginning with the introduction rather than the abstract. It also provides guidance on identifying the big question a field is trying to answer, summarizing the background and limitations of prior work, stating the specific questions authors are addressing, and identifying their experimental approach. The document does not summarize any specific paper.
This document summarizes a study that reconstructed 7,903 bacterial and archaeal genomes from over 1,500 public metagenomes. Key findings include:
- The genomes increase phylogenetic diversity of bacterial and archaeal trees by over 30% and provide first representatives for 17 bacterial and 3 archaeal candidate phyla.
- 245 genomes were recovered from the Patescibacteria superphylum.
- The genomes vary substantially in quality, with 43.5% considered near-complete, 43.8% medium quality, and 12.7% partial.
- The genomes expand representation of underrepresented phyla like Aminicenantes, Gemmatimonadetes, and Lentisphaera
This document describes the development of a multiplex PCR assay targeting the cgcA gene, which encodes a diguanylate cyclase, to differentiate between species within the genus Cronobacter. Analysis of 12 Cronobacter genomes identified 7 conserved diguanylate cyclase-encoding genes, one of which, cgcA, showed species-specific divergence that matched known phylogenetic relationships between Cronobacter species. Primers were designed for this gene and tested in a multiplex PCR assay on 305 Cronobacter isolates representing 6 species. The assay correctly identified the species of all isolates tested and did not identify any of 20 non-Cronobacter species, demonstrating high specificity and sensitivity for rapid identification of Cronobacter.
This study found that rat tissues from farms in the Netherlands tested positive for the pla gene, which is a marker for Yersinia pestis. The pla gene sequences from rats were nearly identical to Y. pestis pla but further analysis identified adjacent sequences similar to bacterial replication genes. Attempts to culture or detect other Y. pestis markers from rat tissues were unsuccessful. The findings suggest there are unknown bacteria in rats that contain a pla homolog, which could produce false positive results in Y. pestis detection assays that only target the pla gene. Methods to confirm the presence of Y. pestis should include additional gene targets.
1. Wnt-4 stimulation of human bone marrow stromal stem cells and mesenchymal stem cells of the maxilla is being studied to assess its effects on proliferation and differentiation.
2. Wnt-4 has been shown to stimulate osteogenesis in human mesenchymal stem cells through the non-canonical p38 signaling pathway. PTH stimulates bone lining cells to produce Wnt-4 in vivo.
3. The study aims to assess the effects of Wnt-4 on proliferation and differentiation of human bone marrow stromal stem cells and dental pulp stem cells to better understand its role in stem cell biology.
This document describes a study that identified 1445 putative transcription factor genes in the mouse genome and mapped the expression patterns of over 1000 of these genes and associated co-regulators in developing mouse brains. The study found that 349 genes showed restricted expression patterns that adequately described the anatomical organization of the brain. A searchable brain atlas database was created containing a comprehensive inventory of murine transcription factors and their expression patterns.
Whats Beyond The Finished Human Genome SequenceJohn Morgan
The document summarizes the progress and findings of the Human Genome Project from its inception in 1990 through its completion in 2003. It discusses how the project established the foundations for genetic mapping and sequencing chromosomes. After the working draft was announced in 2000 and the project was completed in 2003, subsequent research focused on fully sequencing and analyzing the remaining chromosomes. This led to insights into genetic diseases and variation in gene and chromatin distribution across chromosomes. The document also discusses subsequent projects like ENCODE and HapMap that built upon the human genome sequence to map functional elements and genetic variations respectively.
1. The evolutionary relationships between malaria parasite species have been controversial due to past studies relying on visible traits rather than molecular data and issues like taxon bias.
2. Different genes are suitable for phylogenetic analysis, with some like rRNA being problematic due to paralogs. Studies using multiple genes from different genomic compartments provide better resolution.
3. The origin of P. falciparum, which causes the most virulent human malaria, has been debated, with evidence it may have recently switched hosts from gorillas rather than co-diverging with humans. Further sampling of ape malarias is needed to resolve this.
The document discusses H2A.Z, a histone variant. A recent study showed that the H2A.Z nucleosome structure was altered without changes to the H2A structure, avoiding clashes. As a result, the heterotypic H2A.Z/H2A nucleosome is more stable than the homotypic H2A.Z nucleosome. The presence of H2A versus H2A.Z in the histone octamer affects nucleosome stability. H2A.Z accumulation around transcriptional start sites promotes transcriptional initiation, and it is required for activation of the Flowering Locus C gene in Arabidopsis.
The document discusses molecular markers of innate immunity and inflammation and their role in therapeutic intervention. It covers topics such as pattern recognition receptors (PRRs) that detect pathogens and damage signals; classes of PRRs including Toll-like receptors; the signaling pathways of TLRs and their role in cancer and neurodegeneration. It also discusses the transcription factor NF-kB and proinflammatory cytokines such as TNF, IL-1, IL-6 that are involved in the inflammatory response. Specific conditions like meningococcal meningitis and gout are mentioned where blocking these cytokines has shown therapeutic potential.
31 октября самый цитируемый ученый русского происхождения, известный эволюционный биолог Евгений Кунин рассказал в Digital October о постмодернистском взгляде на эволюционные процессы.
http://digitaloctober.ru/ru/events/knowledge_stream_evolyutsiya_po_sluchayu
Pugacheva et al. COMPLETE GB_16.1_p.161_publ.online_08_14_2015 2Victor Lobanenkov
CTCF and BORIS are paralogous proteins that bind to DNA through their nearly identical zinc finger domains. The authors performed ChIP-seq experiments in three cancer cell lines to compare genomic binding patterns of CTCF and BORIS. They found that BORIS selectively occupies a subset (~29-38%) of CTCF binding sites that contain clustered CTCF motifs, termed 2xCTSes. In contrast, the majority of CTCF binding sites contain a single CTCF motif (1xCTSes) and are not occupied by BORIS. 2xCTSes are preferentially located at active promoters and enhancers in cancer cells, and are also enriched in regions retaining histones in sperm. The results suggest there are two
This thesis aims to test the performance of site- and time-heterogeneous evolutionary models in reconstructing the phylogeny of Echinodermata using complete mitochondrial genomes. The author characterized 29 echinoderm mitogenomes in terms of gene order, putative replication origins, and compositional heterogeneity. Gene orders support monophyly of each class. A phylogeny based on gene rearrangements supports the Cryptosyringid hypothesis. Putative replication origins were identified in some species. Compositional heterogeneity was observed within and between genes. When inferring phylogenies using homogeneous and heterogeneous models, only the CAT model corrected the long-branch attraction of Ophiuroidea sequences. Results support relationships not recovered by morphology
This study analyzed the occurrence and diversity of integrons in bacteria isolated from an urban wastewater treatment plant. A total of 697 isolates of Enterobacteriaceae and Aeromonas were screened for integrons. Three new gene cassettes were identified, including a novel aadA variant and genes involved in cell signaling and unknown functions. Thirteen different gene cassette arrays were detected, with four representing novel integrons. Approximately 80% of isolates were resistant to at least 3 antibiotic classes. The presence of novel integron structures in treated effluent suggests wastewater treatment plants may facilitate the formation and spread of antibiotic resistance genes.
This document discusses a study that found molecular and morphological evidence suggesting that the flagellate Ancyromonas is closely related to the common ancestor of metazoans, fungi, and choanoflagellates. Analyses of 18S rRNA gene sequences from major eukaryotic lineages using maximum likelihood, minimum evolution, and maximum parsimony supported Ancyromonas forming its own lineage, called Ancyromonadida, that is more closely related to opisthokonts than its nearest protist relatives. However, low bootstrap support for deep nodes limits the ability of 18S rDNA to fully resolve this aspect of eukaryotic phylogeny.
Salmonella typhimurium bacteria were grown aboard a Space Shuttle mission and compared to identical ground controls; microarray and proteomic analysis revealed that space flight altered the expression of 167 transcripts and 73 proteins in S. typhimurium, with the Hfq protein identified as a likely global regulator involved in the response; space flight samples also exhibited enhanced virulence in mice and extracellular matrix accumulation consistent with biofilm formation.
This study sequenced the genomes of 11 clinical Mycobacterium abscessus isolates from 8 US patients with pulmonary infections. Core genome analysis compared these isolates to 30 globally diverse strains to investigate population structure. Longitudinally sampled isolates showed very few genetic differences, suggesting homogenous infection populations. Genome content variation between isolates was 0.3-8.3% compared to the reference strain, indicating plasticity.
This document describes the development of an interspecies tiling array to analyze the transgenic genome of mice that were engineered to express the human protamine domain. Key points:
1) A single copy of the human protamine domain was randomly inserted into the genome of mice. Expression of the transgene recapitulated normal human levels without disrupting endogenous gene expression.
2) An interspecies tiling array was designed to simultaneously analyze the orthologous protamine domains in mouse and human. Probe design accounted for repetitive elements to allow comparison of highly similar sequences.
3) Initial results demonstrate the array can provide parallel analysis of orthologous sequences from different species, serving as a valuable tool for interrogating transgenic
ABCG2pos lung mesenchymal stem cells are a novel pericyte subpopulation that ...Rubin Baskir, Ph.D.
This document reports on a study investigating a novel pericyte subpopulation in the lung called ABCG2pos mesenchymal stem cells (MSC). The study found:
1) ABCG2pos lung MSC numbers were decreased in human pulmonary fibrosis (PF) and interstitial lung disease samples compared to controls.
2) In a mouse model of bleomycin-induced lung injury, GFP-labeled lung MSC-derived cells increased in number and localized to fibrotic and microvessel remodeling areas after 14 days.
3) Lung MSC responded to in vivo bleomycin injury with a profibrotic gene expression profile that was not replicated with in vitro bleomycin treatment, but
Austin Andrology is an open access, peer reviewed, scholarly journal dedicated to publish articles covering all areas of Andrology.
The journal aims to promote research communications and provide a forum for doctors, researchers, physicians and healthcare professionals to find most recent advances in all the areas of Andrology. Austin Andrology accepts original research articles, reviews, mini reviews, case reports and rapid communication covering all aspects of andrology.
Austin Andrology strongly supports the scientific up gradation and fortification in related scientific research community by enhancing access to peer reviewed scientific literary works. Austin Publishing Group also brings universally peer reviewed journals under one roof thereby promoting knowledge sharing, mutual promotion of multidisciplinary science.
1. The authors performed a comparative phosphoproteomic analysis of host cells infected with wild-type Francisella novicida or a delta-lpcC mutant strain.
2. They found that actin and intermediate filaments/microtubules are important for F. novicida entry into host cells.
3. Infection with the delta-lpcC mutant induced hyper-phosphorylation and inhibition of the protein tristetraprolin, leading to increased production of cytokines like IL-1beta and TNF-alpha that can kill host cells.
This document summarizes key points from a class on microbial phylogenomics taught by Jonathan Eisen. It discusses reading scientific papers, specifically beginning with the introduction rather than the abstract. It also provides guidance on identifying the big question a field is trying to answer, summarizing the background and limitations of prior work, stating the specific questions authors are addressing, and identifying their experimental approach. The document does not summarize any specific paper.
This document summarizes a study that reconstructed 7,903 bacterial and archaeal genomes from over 1,500 public metagenomes. Key findings include:
- The genomes increase phylogenetic diversity of bacterial and archaeal trees by over 30% and provide first representatives for 17 bacterial and 3 archaeal candidate phyla.
- 245 genomes were recovered from the Patescibacteria superphylum.
- The genomes vary substantially in quality, with 43.5% considered near-complete, 43.8% medium quality, and 12.7% partial.
- The genomes expand representation of underrepresented phyla like Aminicenantes, Gemmatimonadetes, and Lentisphaera
This document describes the development of a multiplex PCR assay targeting the cgcA gene, which encodes a diguanylate cyclase, to differentiate between species within the genus Cronobacter. Analysis of 12 Cronobacter genomes identified 7 conserved diguanylate cyclase-encoding genes, one of which, cgcA, showed species-specific divergence that matched known phylogenetic relationships between Cronobacter species. Primers were designed for this gene and tested in a multiplex PCR assay on 305 Cronobacter isolates representing 6 species. The assay correctly identified the species of all isolates tested and did not identify any of 20 non-Cronobacter species, demonstrating high specificity and sensitivity for rapid identification of Cronobacter.
This study found that rat tissues from farms in the Netherlands tested positive for the pla gene, which is a marker for Yersinia pestis. The pla gene sequences from rats were nearly identical to Y. pestis pla but further analysis identified adjacent sequences similar to bacterial replication genes. Attempts to culture or detect other Y. pestis markers from rat tissues were unsuccessful. The findings suggest there are unknown bacteria in rats that contain a pla homolog, which could produce false positive results in Y. pestis detection assays that only target the pla gene. Methods to confirm the presence of Y. pestis should include additional gene targets.
1. Wnt-4 stimulation of human bone marrow stromal stem cells and mesenchymal stem cells of the maxilla is being studied to assess its effects on proliferation and differentiation.
2. Wnt-4 has been shown to stimulate osteogenesis in human mesenchymal stem cells through the non-canonical p38 signaling pathway. PTH stimulates bone lining cells to produce Wnt-4 in vivo.
3. The study aims to assess the effects of Wnt-4 on proliferation and differentiation of human bone marrow stromal stem cells and dental pulp stem cells to better understand its role in stem cell biology.
This document describes a study that identified 1445 putative transcription factor genes in the mouse genome and mapped the expression patterns of over 1000 of these genes and associated co-regulators in developing mouse brains. The study found that 349 genes showed restricted expression patterns that adequately described the anatomical organization of the brain. A searchable brain atlas database was created containing a comprehensive inventory of murine transcription factors and their expression patterns.
Whats Beyond The Finished Human Genome SequenceJohn Morgan
The document summarizes the progress and findings of the Human Genome Project from its inception in 1990 through its completion in 2003. It discusses how the project established the foundations for genetic mapping and sequencing chromosomes. After the working draft was announced in 2000 and the project was completed in 2003, subsequent research focused on fully sequencing and analyzing the remaining chromosomes. This led to insights into genetic diseases and variation in gene and chromatin distribution across chromosomes. The document also discusses subsequent projects like ENCODE and HapMap that built upon the human genome sequence to map functional elements and genetic variations respectively.
1. The evolutionary relationships between malaria parasite species have been controversial due to past studies relying on visible traits rather than molecular data and issues like taxon bias.
2. Different genes are suitable for phylogenetic analysis, with some like rRNA being problematic due to paralogs. Studies using multiple genes from different genomic compartments provide better resolution.
3. The origin of P. falciparum, which causes the most virulent human malaria, has been debated, with evidence it may have recently switched hosts from gorillas rather than co-diverging with humans. Further sampling of ape malarias is needed to resolve this.
The document discusses H2A.Z, a histone variant. A recent study showed that the H2A.Z nucleosome structure was altered without changes to the H2A structure, avoiding clashes. As a result, the heterotypic H2A.Z/H2A nucleosome is more stable than the homotypic H2A.Z nucleosome. The presence of H2A versus H2A.Z in the histone octamer affects nucleosome stability. H2A.Z accumulation around transcriptional start sites promotes transcriptional initiation, and it is required for activation of the Flowering Locus C gene in Arabidopsis.
The document discusses molecular markers of innate immunity and inflammation and their role in therapeutic intervention. It covers topics such as pattern recognition receptors (PRRs) that detect pathogens and damage signals; classes of PRRs including Toll-like receptors; the signaling pathways of TLRs and their role in cancer and neurodegeneration. It also discusses the transcription factor NF-kB and proinflammatory cytokines such as TNF, IL-1, IL-6 that are involved in the inflammatory response. Specific conditions like meningococcal meningitis and gout are mentioned where blocking these cytokines has shown therapeutic potential.
Tumor necrosis factor (TNF) is a cytokine that regulates immune responses. TNF exists in both transmembrane and soluble forms. It is produced by immune cells like macrophages and signals through receptors to perform functions such as inducing inflammation, apoptosis, and lipid metabolism. TNF is conserved in fish and regulates processes like immune cell activation, tissue regeneration, and lipid homeostasis.
Alpha-1 Antitrypsin (α-1 AT) deficiency is a common genetic disorder that affects 1 in 2,000 individuals in the USA. Additionally, over 20 million people have been identified as carriers for this genetic disorder. In severe cases, α-1 AT deficiency can cause substantial lung and liver damage, which if left untreated could result in death and there are no current available treatments. Alpha-1 protein is produced in the liver, travels in the bloodstream and utilized in the lungs to protect healthy lung tissue from harmful destruction by elastase. A common single amino acid substitution, located at E342K (ATZ) was identified in α-1 AT deficient humans. When this specific mutation occurs two phenotypes can result: 1) ATZ can polymerize in the liver causing cellular toxicity 2) inhibits alpha-1 antitrypsin from inhibiting elastase which can result in lung disease. Currently; little is known about the cellular mechanisms that clear the accumulated proteins in the liver. Therefore, an investigative study utilizing C. elegans model of ATZ was performed in order to help determine the cellular mechanisms that dispose of accumulated proteins. Specifically RNA interference was utilized to knockdown expression of specific genes. This investigation examined genes involved in the heat-shock pathway (HSP), unfolded protein response (UPR), and insulin signaling pathway (IS). Phenotypic analysis including: embryonic lethality, protein aggregation expression, and longevity, was completed after knockdown of genes to determine effect on ATZ accumulation. Currently with our preliminary data suggests that the heat-shack pathway may play a role in ATZ accumulation. Determining the mechanism of protein accumulation in the investigation of C. elegans may lead to possible drug targets and therefore the development of a treatment which may alleviate those diagnosed with this disorder.
The document discusses the topic of phylogenetics. It begins with definitions of key terms like phylogeny, phylogenetic tree, clade, and orthologous genes. It then provides examples of how phylogenetic methods are used in fields like epidemiology, conservation biology, and pharmaceutical research. The document also discusses choosing appropriate genetic sequences to use in phylogenetic analysis and introduces molecular clock models.
Fernando de la Cruz presented a document on plasmid conjugation systems and controlling the dissemination of antibiotic resistance. The document contained the following key points:
1. The only element common among all conjugatively transmissible plasmids is the relaxase protein. Conjugative plasmids also contain VirB4 proteins.
2. Different types of plasmids - conjugative, mobilizable, and non-transmissible - were analyzed based on size. IncF and IncI plasmids frequently transfer antibiotic resistance.
3. COINs (conjugation inhibitory compounds) show potential to control the dissemination of multidrug resistance by inhibiting bacterial conjugation without affecting growth.
Proinflammatory Consequences of FasL Expression in the HeartElizabeth Berry
This document summarizes research on the effects of transgenic expression of Fas ligand (FasL) specifically in heart muscle cells. The researchers generated several lines of transgenic mice with different copy numbers of a FasL transgene driven by a heart-specific promoter. They found that FasL expression in the heart caused mild leukocyte infiltration and interstitial fibrosis but, surprisingly, no cardiomyocyte apoptosis or necrosis. Instead, the hearts developed cardiac hypertrophy accompanied by upregulation of proinflammatory cytokines. The degree of proinflammatory changes correlated with transgene copy number, indicating a dose-dependent response to FasL expression level. This suggests that tissue-specific factors can modulate the proinflammatory effects of FasL.
This document discusses the role of the Wnt signaling pathway in cancer. It begins by describing how the Wnt pathway is normally regulated and how dysregulation can lead to cancer. It then summarizes key points about how the Wnt pathway is altered in cancer at the membrane, cytoplasmic, and nuclear levels. Mutations in genes that encode proteins in the Wnt pathway, such as APC, Axin, and β-catenin, have been implicated in various cancers like colorectal cancer. Understanding how the Wnt pathway is involved in cancer is important for developing new cancer therapeutics.
The genomes of four tapeworm species reveal adaptations to parasitismJoão Soares
The genomes of four tapeworm species reveal adaptations to parasitism. The genomes range from 115 to 141 megabases and show maintenance of synteny with blood flukes but extreme losses of genes and pathways found in other animals, including 34 homeobox families and stem cell fate determinants. Tapeworms have specialized detoxification pathways, metabolism finely tuned to rely on host nutrients, and expansions of heat shock proteins and known antigen families. The genomes provide insights into tapeworm evolution and identify potential new drug targets, furthering development of urgently needed treatments.
This document summarizes a study examining the role of tropomyosin-related kinase B (TrkB) in metastatic pancreatic cancer. The study found that TrkB was overexpressed in highly metastatic pancreatic cancer cells compared to parental cells. TrkB overexpression correlated with perineural invasion, positive retroperitoneal margins, and shorter time to liver metastasis in patient samples. The metastatic cells also showed increased activation of ERK1/2 and increased expression of IL-8 and VEGF, which are involved in invasion and metastasis. This suggests TrkB overexpression may promote the aggressive growth and metastasis of pancreatic cancer by activating signaling pathways and increasing expression of genes involved in these processes. TrkB may therefore be a novel therapeutic target for pancreatic cancer.
TIF1-gamma Controls Erythroid Cell Fate by Regulating Transcription ElongationJoe Lee
1) A genetic suppressor screen in zebrafish identified a mutation in the cdc73 gene that rescued the erythroid defect in tif1g (moonshine) mutants.
2) cdc73 encodes a subunit of the PAF elongation complex. Knockdown of other PAF subunits also rescued tif1g mutants, indicating TIF1g antagonizes the PAF complex.
3) Biochemical studies showed TIF1g interacts with erythroid transcription factors and elongation factors, coupling them to promote transcription elongation of erythroid genes by counteracting polymerase II pausing.
Symptoms And Treatment Of Trypanosoma BruceiJennifer Baker
Trypanosoma brucei is a protozoan parasite that causes African trypanosomiasis or sleeping sickness in humans and animals through the transmission via tsetse fly bites. It has 3 subspecies that cause different forms of the disease with varying symptoms and onset. Current treatments for the disease include pentamidine, melarsoprol, eflornithine and suramin which target the bloodstream or procyclic forms of the parasite.
This document summarizes a study that characterized the ecdysone receptor (EcR) gene in the salmon louse (Lepeophtheirus salmonis), an economically important parasite in salmon farming. The researchers isolated and sequenced cDNA of the predicted L. salmonis EcR gene, which encoded a protein highly similar to other arthropod EcRs. In situ analysis showed the EcR transcript is expressed in ovaries, sub-cuticle, and oocytes of adult female lice. Knockdown of EcR using RNA interference terminated egg production, indicating it plays an important role in reproduction and oocyte maturation. This suggests disrupting EcR signaling may provide a way to control louse reproduction and infestation.
This document describes the generation and characterization of two transgenic zebrafish reporter lines, Tg(7xTCF-Xla.Siam:GFP)ia4 and Tg(7xTCF-Xla.Siam:nlsmCherry)ia5, that can be used to detect Wnt/β-catenin signaling activity in vivo. The reporters contain seven copies of TCF/LEF binding sites upstream of a minimal promoter from the Wnt target gene siamois driving expression of GFP or nuclear mCherry. Analysis showed the reporters are expressed in domains consistent with Wnt activity, including the central nervous system, sensory organs, and endothelial cells. Live imaging demonstrated Wnt activity
1) The study demonstrates that phosphorylation of huntingtin protein at serine 421 (S421) protects against toxicity caused by polyglutamine expansion in huntingtin, the cause of Huntington's disease.
2) Calcineurin (CaN), a calcium-activated phosphatase, was found to dephosphorylate S421 both in vitro and in cells. Inhibition of CaN using FK506 increased S421 phosphorylation and prevented polyQ-huntingtin toxicity in neuronal cells.
3) Administration of FK506 to mice also increased phosphorylation of endogenous huntingtin at S421 in the brain. Therefore, inhibition of CaN's dephosphorylation of S421 may have therapeutic potential for treating Huntington's
This document discusses the FOXP3 gene as a promising candidate gene in susceptibility to generalized vitiligo. It summarizes that FOXP3 is the master transcription factor that regulates regulatory T cells, which play an important role in preventing autoimmunity. Studies have found associations between polymorphisms in the FOXP3 gene and an increased risk of vitiligo. The document argues that further investigation of FOXP3 genetic variants and their effects on regulatory T cell development and function could provide insights into vitiligo pathogenesis and potential new therapeutic approaches targeting the FOXP3 gene/regulatory T cell network.
This document provides a summary of research on Brucellosis, a bacterial infection. It discusses the epidemiology and transmission of Brucellosis, highlighting that it is one of the most common zoonotic diseases worldwide, with 500,000 cases annually. It then examines the pathogenic strategies that allow Brucella bacteria to evade the immune system, including modifications to its lipopolysaccharide that inhibit immune responses. Finally, it reviews the immunological response to Brucella, noting the importance of innate immune cells and Th1-type cytokines in both the initial response and long-term control of infection.
This document is a thesis by Jonas Danielson from Lund University in 2010 on the topic of plant Major Intrinsic Proteins (MIPs), also known as aquaporins. It provides an introduction to MIPs and their structure and function. It then focuses on plant MIPs, discussing the large family of MIP isoforms in plants, their evolution and diversity across plant species. It aims to expand knowledge of plant MIP diversity and the roles of different subfamilies and isoforms using both traditional molecular biology approaches and comparative genetics methods.
This study investigated the mechanisms controlling the diurnal expression and trafficking of the astrocytic protein Fabp7. The key findings were:
1) Fabp7 mRNA and protein are enriched in the astrocytic perisynaptic compartment and exhibit a daily oscillation in their intracellular distribution in the hippocampus.
2) Northern blotting revealed a coordinated daily oscillation in the polyadenylation of Fabp7 mRNA throughout the mouse brain.
3) Fabp7 mRNA was found to coimmunoprecipitate with CPEB1, a protein that regulates subcellular trafficking and translation of synaptic plasticity mRNAs, in mouse astrocytes.
4) The 3'UTR of Fabp7
Similar to Surveying the small-spotted catshark (Scyliorhinus canicula) tumour necrosis factor superfamily (TNFSF) (20)
1. Honours Research Project Report
BI4016
2015/2016
School of Biological Sciences
Surveying the small-spotted catshark (Scyliorhinus canicula)
tumour necrosis factor superfamily (TNFSF)
Fiona Bakke
Supervisor: Dr Helen Dooley
Work completed in partial fulfilment of the requirements for
a degree in MSci Biological Sciences
Word count: 8548
2. 1
Abstract
The S. canicula transcriptome has recently become available and was used to identify TNFSF
ligand genes and compare these to TNFSF ligand genes in other vertebrates. As a cytokine
subgroup, the TNFSF enables immunomodulatory signalling between cells, being primarily
associated with cell survival, inflammation and apoptosis. Genetic polymorphisms in the
TNFSF have been implicated in the development of tumours and inflammatory and
autoimmune diseases in humans, and the molecular biology of the human TNFSF has been
investigated in order to develop therapeutics. These therapeutics are often associated with
undesirable side effects, creating a need for alternate methods of their development. One
such method is the investigation of the evolutionary history of the TNFSF, so that TNFSF
characteristics present in other vertebrates may be identified and exploited. As part of this
investigation, a phylogenetic tree of vertebrate TNFSF ligand genes was generated, to produce
the most complete representation currently available of the evolutionary history of these
genes. S. canicula did not appear to express 6 of the 18 human TNFSF genes (TNF-α, TNF-β,
CD27L, 4-1BBL, TWEAK and EDA) but, with the exception of the pyrogenic TNFSF genes TNF-α
and TNF-β, did appear to possess TNFSF genes fulfilling similar functions. Only one S. canicula
LT-β sequence appeared to be present, with its position on the phylogenetic tree suggesting
that it may have been an ancient precursor of TNF-α and TNF-β. The evolutionary
development of CD30L, CD40L and TRAIL require further investigation since S. canicula
sequences did not appear to share conserved regions with similar sequences from other
vertebrates. S. canicula APRIL BAFF, OX40L, GITRL, FasL, TL1A, RANKL and LIGHT did appear
to be present, with S. canicula also appearing to express BALM, a TNFSF gene currently
identified only in cartilaginous fish and teleosts. Target S. canicula TNFSF genes were then
amplified, cloned and sequenced, and the presence of the 3’ end of RANKL confirmed.
3. 2
Keywords.
Scyliorhinus canicula; tumour necrosis factor superfamily; comparative immunology;
phylogenetic analysis.
1. Introduction
The tumour necrosis factor superfamily (TNFSF) is a subgroup of the larger cytokine family
(Dinarello, 2000; Opal and DePalo, 2000). Cytokines are small (up to 40 kDa) proteins and
glycoproteins, associated with both the humoral and innate immune systems, which regulate
and direct immune responses following their secretion (Astrakhantseva et al., 2014). Immune
cells which secrete cytokines include dendritic cells (DCs), macrophages, and B and T
lymphocytes, although other cells, such as epithelial and stromal cells, also possess this
capability (Dinarello, 2000; Opal and DePalo, 2000). Cytokine secretion enables
immunomodulatory signalling between cells through autocrine, paracrine and endocrine
means and, depending on the cytokines secreted and the nature of their signals, causes
targeted cells to respond to an immune insult through their activation, differentiation, growth
or apoptosis (Borish and Steinke, 2003; Commins et al., 2010; Testar, 2015). A cascade of
further cytokine secretion may also be generated until the immune response is complete
(Testar, 2015).
Within the larger cytokine family, the role of the TNFSF typically involves initiating
inflammation and apoptosis, but also the development of lymphocytes, and epithelial and
other tissues (Hehlgans and Pfeffer, 2005; Croft et al., 2013; Wiens and Glenney, 2011). The
TNFSF consists of structurally-related ligands which are capable of binding to one or more
4. 3
transmembrane protein receptors; some receptors may also be able to bind to more than one
ligand (Bossen et al., 2006; Vince & Silke, 2006; Roosnek et al., 2009), resulting in a complex
network of interactions between ligands and receptors. Ligands may be either membrane
bound or secreted in soluble form following proteolytic processing, whereas receptors are
principally membrane bound (Glenney and Wiens, 2007; Vujanovic, 2011). In addition to the
complexity of ligand-receptor interaction and the ability of a wide variety of cells to express
both, the effects of binding can also vary, since the form in which a ligand is expressed
determines whether its stimulus is antagonistic or inhibitory (Aggarwal, 2003; Robert, 2015).
All these factors, together with TNFSF involvement in inflammation and apoptosis, can lead to
unwanted harmful effects such as tumour growth and allergic or autoimmune responses
(Figure 1) (Adipogen, 2013).
Figure 1. TNFSF members associated with human inflammatory and autoimmune diseases.
Abbreviations: GVHD: Graft-versus-host disease; MS: multiple sclerosis; IBD: irritable bowel disease.
Adapted from Croft et al., 2012.
5. 4
In recent years, much work has been done to investigate the role of the TNFSF human disease
conditions in order to develop mitigatory and preventative therapeutic agents (Wang and
Yang-Xin, 2005; Roosnek et al., 2009; Croft et al., 2012; Siakavellas et al., 2015; Walczak, 2015;
Collette et al., 2003). This work has largely focused on the molecular pathways of the TNFSF
in humans, and some effective therapeutic agents have emerged (Adipogen, 2013; Grewal,
2009; Astrakhantseva et al., 2014; Sedger and McDermott, 2014). However, due to the
complexity of the TNFSF mechanisms, undesirable side effects to these agents frequently
occur (Tansey and Szymkowski, 2009). Alternate methods of developing therapeutic agents
are therefore necessary, and investigating the evolutionary history of the TNFSF provides one
such means, since it may identify TNFSF characteristics present in mammals which are not yet
known.
Human TNFSF genes (Table 1) are organised in clusters on major histocompatibility complex
(MHC) paralogous chromosomes 1, 6, 9 and 19, suggesting that the mammalian TNFSF may
have evolved from an earlier, more rudimentary form during the two rounds of whole genome
duplication (WGD) that occurred around 500-800 million years ago (mya) (Biswas et al, 2015;
Wiens and Glenney, 2011; Collette et al, 2003). Additional human TNFSF genes are located
on chromosomes X, 3, 13 and 17, possibly as a result of cis and/or trans duplications during
their further evolution (Glenney and Wiens, 2007). Teleosts underwent a further WGD
approximately 350-320 mya, with salmonids and cyprinids undergoing a fourth WGD
approximately 70-80mya (Macqueen and Johnston, 2014). The resultant genomic complexity
of teleosts, due to these further WGD events, makes direct comparison of the evolution of
their TNFSF with that of humans problematic. Exploration of the evolutionary relationships
between the TNFSF in humans and other vertebrates which did not undergo these further
6. 5
WGDs may therefore provide a clearer representation of the ways in which the vertebrate
TNFSF evolved over time.
Table 1. Human TNFSF ligand gene names. Adapted from Gray et al., 2015.
Name Synonyms TNFSF Number
TNF-α TNF, tumour necrosis factor, DIF 1
TNF-β Lymphotoxin-α, LT 2
LT-β Lymphotoxin-β, p33 3
OX40L CD252, gp34, TXGP1 4
CD40L HIGM1, IMD3, TRAP, gp39, Hcd40l, CD154 5
FasL APT1LGI, CD178 6
CD27L CD70 7
CD30L CD153 8
4-1BBL 9
TRAIL Apo-2L, TL2, CD253 10
RANKL TRANCE, OPGL, ODF, CD254 11
TWEAK DR3LG, APO3L 12
APRIL CD256 13
BAFF THANK, BLYS, TALL-1, CD257 13b
LIGHT LTg, HVEM-L, CD258 14
TL1A TL1, VEGI, VEGI192A, MGC129934, MGC129935 15
GITRL AITRL, TL6, hGITRL 18
EDA Ectodysplasin A, EDA1, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2 Not allocated
Research into the TNFSF of other vertebrates however, remains limited (De Zoysa, Jung and
Lee, 2009; Biswas et al., 2015). Until now, no characterisation of the TNFSF in cartilaginous
fish has been performed, and similar information is only available for a small number of
amphibians, reptiles, birds and non-human mammals. In 2007, Glenney and Wiens identified
and characterised 71 TNFSF members in different teleosts, using the structure of membrane
bound TNFSF ligands in mammals as a basis. These ligands possess a relatively well conserved
(20-30%) TNF homology domain within their extracellular C terminus, which facilitates their
comparison with ligands of other species. In this project we used the information obtained
by Glenney and Wiens (2007) to detect possible TNFSF orthologs in two species of
chondrichthyes, Scyliorhinus canicula (small-spotted catshark, subclass Elasmobranchii) for
which in-house transcriptomic data are now available (Dooley et al, unpublished data), and
7. 6
Callorhinchus milii (elephant shark, subclass Holocephali), the only cartilaginous fish for which
the genome has been sequenced. Bioinformatic searches of these protein sequences were
performed to identify orthologs in other species. This information was then used to generate
a phylogenetic tree, which provided an indication of possible evolutionary relationships
between TNFSF members in mammals, birds, reptiles, amphibians, teleosts and cartilaginous
fish. Alignment of TNFSF sequences allowed the identification of conserved domains among
individual TNFSF sequences for different species, enhancing the information provided by the
phylogenetic tree. Amplification, cloning and sequencing of S. canicula TNFSF sequences
which demonstrated both phylogenetic clustering and the sharing of conserved domains with
similar sequences for other species were performed to confirm the presence of these
sequences.
We hypothesised that, since cartilaginous fish were the first vertebrates to possess a canonical
adaptive immune system, S. canicula TNFSF gene orthologs would be found for TNFSF genes
in other vertebrates and that more recently evolved vertebrates would also possess TNFSF
genes not present in S. canicula that arose from gene duplication and rearrangement following
their divergence from their common ancestors. Given the chromosomal clustering of human
TNFSF genes, and the fact that the genes in these clusters often share some functional
similarities (Collette et al., 2003), we further hypothesised that S. canicula would possess an
ortholog for at least one human TNFSF gene from each chromosomal cluster.
2. Materials and methods
2.1 Bioinformatics
8. 7
Accession numbers of TNFSF members previously identified in teleosts (Glenney and Wiens,
2007) were used to obtain protein sequences from the genomic databases of NCBI (http://w
ww.ncbi.nlm.nih.gov/protein/) and Ensembl version 82, September 2015 (http://www.ense
mbl.org/index.html). Nucleotide sequences were translated to amino acid sequences using
the Expasy Translate tool (http://web.expasy.org/translate/). The teleost TNFSF sequences
were used to BLAST search (Altschul et al., 1997) S. canicula transcriptomes available via the
catshark in-house transcriptome database, the Chondrichthyes Transcriptome Resource
(Jones and Blaxter, 2013) http://afterparty.bio.ed.ac.uk/study/show/6232601), SkateBase
(http://skatebase.org/skateBLAST) (Wyffels et al., 2014; Wang et al., 2012), and the SwissProt
(http://www.ebi.ac.uk/uniprot) database. All S. canicula sequences identified were then
BLASTed against the NCBI protein database to confirm the identity of the S. canicula hits as
TNFSF members.
2.2 Sequence alignment and phylogenetic analysis
Evolutionary relationships among these sequences were then investigated. S. canicula
sequences were combined with previously obtained TNFSF sequence information from S. milii
(Venkatesh et al., 2014), and with similar data for representative members of other vertebrate
classes (Homo sapiens [human], Bos taurus [domestic cow], Mus musculus [house mouse],
Gallus gallus domesticus [chicken], Python sebae sebae [African rock python], Anolis
carolinensis [Carolina anole lizard], Chrysemys picta [painted turtle], Xenopus tropicalis
[Western clawed frog], Danio rerio [zebrafish], Onchorhynchus mykiss [rainbow trout],
Latimeria chalumnae [African coelacanth]). All sequences were aligned using MAFFT (Katoh
et al., 2002). Highly variable regions were removed using BioEdit software (Hall, 1999). The
resulting data were then used to construct a phylogenetic tree in IQ-TREE (Nguyen et al.,
9. 8
2015; Minh, Nguyen and von Haeseler, 2013) and FigTree (Morariu et al., 2009) phylogenetic
software. A maximum likelihood tree, using 164 TNFSF sequences containing 493 amino acid
sites, was produced, using 1000 bootstrap replications to obtain branch support values. The
S. canicula TNFSF member sequences which formed clades with similar sequences from other
vertebrate classes, suggesting that they emerged early in the development of the adaptive
immune system and also that they were maintained during the divergence of more recently
evolved vertebrates, were then considered individually. The TNFSF nucleotide sequences for
all vertebrates in such clusters were aligned once more, again using MAFFT and BioEdit
software, to identify regions of similarity and the presence of conserved TNFSF domains.
2.3 Primer design
TNFSF sequences which contained conserved TNFSF domains were used to design primers for
PCR amplification of the S. canicula sequences. RACE-PCR was performed for those sequences
which appeared similar to those for H. sapiens and M. musculus, but which were incomplete
at the 3’ and/or 5’ ends (Sambrook and Russel, 2001). Primers were designed to try to fulfil
the following conditions: to anneal within the evolutionarily most conserved region; to contain
conserved cysteine (C) and/or tryptophan (W) amino acids; to have an A or T at the 3’ end and
a G or C at the 5’ end; to be 16-24 base pairs (bp) long; to have an optimal melting temperature
of ~60oC; to have a difference in melting temperature for forward and reverse primers
of ≤ 4oC, and to have a GC content of 40-60%.
Oligonucleotide Properties Calculator (www.basic.northeastern.edu/biotools/oligocalc.html)
was used to confirm that these conditions had been fulfilled, and also that there were no self-
annealing sites or areas of potential hairpin formation, self-dimerization or complementarity
10. 9
(Kibbe, 2007). Primers were purchased from Sigma Aldrich Co. LLC. One forward and one
reverse primer was designed for each target sequence to be amplified using PCR, with two
forward and two reverse primers being designed for those sequences being amplified using
RACE-PCR (Table 2).
Table 2. Primers used for amplification of FasL, TL1A, RANKL and LIGHT TNFSF ligands
Name Nucleotide Sequence (5’-3’)
ScFasL-F1 ACAAGTGTTTATGGTGGATGGC
ScFasL-R1 GTCAATGTGTCAGATTCAAGGCTA
ScTL1A-F1 ATGGCGTATGGCTATCTATTTGG
ScTL1A-R1 TTCGCCCTTCGTAAACGCAAG
ScTL1A-F2 AGTGTAAAGCAGGTGGATTTTACC
ScTL1A-R2 AAGTCCGTTCTTGTGTTCCCAC
ScRANKL-F1 TTGGTGCTCGGGCAATCATAAC
ScRANKL-R1 TAGGGTGTCAGCCATGAATTC
ScRANKL-F2 TCTGCTCAATGGCGACAAAATC
ScRANKL-R2 TGAATTCTTCCTCATGCGATTGG
ScLIGHT-F1 AATTCTTCTGCACTGGGGAGAG
ScLIGHT-R1 TCTACATACAGCACACATCACAC
ScLIGHT-F2 AATAGCTACCTGGGGGCAATC
ScLIGHT-R2 ATGTCTTCAGCAGGAACTCTAC
ScEF1a-F1 CGTCTTCCTTTATTGCACAGGTTATTATC
ScEF1a-R1 GGACAGCGAAACGACCAAGAG
UPM Long (0.4µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
UPM Short (2µM) CTAATACGACTCACTATAGGGC
NUP (10µM) AAGCAGTGGTATCAACGCAGAGT
Redesigned Primers
ScFasL-F1a ATCCATATGTGCCTCCACCTGCC
ScFasL-R1a GGCTAGTTGACTTTGCTGAGTCCA
ScTL1A-F1a TCGGAAATTCTTCTGCACTGGGG
ScTL1A-R1a ACACATCACACATCAGGCAGCGC
ScTL1A-F2a AGTTTTGAGAATCTCCAACGGTGC
ScTL1A-R2a ACCCAGTTACATGAGCTGCAGGC
ScRANKL-F1a TTGGTGCTCGGGCAATCATAAC
ScRANKL-R1a TAGGGTGTCAGCCATGAATTC
ScRANKL-F2a TCTGCTCAATGGCGACAAAATC
ScRANKL-R2a TGAATTCTTCCTCATGCGATTGG
ScLIGHT-F1a TCGGAAATTCTTCTGCACTGGGG
ScLIGHT-R1a ACACATCACACATCAGGCAGCGC
ScLIGHT-F2a AGTTTTGAGAATCTCCAACGGTGC
ScLIGHT-R2a ACCCAGTTACATGAGCTGCAGGC
T7 Universal Sequencing Primer TAATACGACTCACTATAG
11. 10
2.4 Amplification of target sequences from S. canicula spleen cDNA
PCR was used to amplify target sequences which appeared complete, using a PCR reaction of
10µl MyTaq Red Reaction Buffer (Bioline), 2.5µl of cDNA template, 1µl of both forward and
reverse primers, and 1µl MyTaq (Bioline), and 34.5µl PCR grade water, to achieve a final
volume of 50µl. S. canicula spleen oligo-dT primed cDNA was used for the template, since this
tissue is a secondary immune organ in sharks and therefore would be expected to highly
express TNFSF genes (Biswas et al., 2015; Schneider, Potter and Ware, 2004). To confirm
template integrity, and that the PCR reagents and PCR cycler were functioning correctly,
elongation factor 1 alpha (EF-1-alpha-1) was used as a positive control, as this gene is
expressed ubiquitously and has previously been assessed as suitable for this purpose (Infante
et al, 2008; Olsvik et al., 2005). The negative control, to confirm absence of contamination of
experimental samples, was PCR grade water in place of cDNA.
A standard PCR procedure was applied, using an initial cycle of 2 min at 95oC to denature the
template (subsequent denaturation cycles lasted 30 sec), 30 sec at a temperature determined
by primer requirements to allow annealing, and 1.5 min at 72oC for primer extension along
the cDNA template. PCR cycles were repeated 30 times to generate maximum DNA yield
(approximately 1 million copies of the target sequences) (Sambrook and Russel, 2001).
Touchdown PCR was also performed, across an annealing temperature range of 63OC-45oC, in
decreasing increments of 0.4OC, in order to ensure that optimal annealing temperature had
been applied. RACE PCR was used to obtain a complete open reading frame from target
sequences which appeared to lack 3’ and/or 5’ ends. RACE cDNA was prepared using the
SMARTer RACE cDNA kit according to the manufacturer’s protocol (Clontech). First round
RACE reactions used 5µl MyTaq Red Reaction Buffer (Bioline), 2.5µl cDNA template, 0.5µl
12. 11
forward primer 1 or reverse primer 1, 0.5µl Universal Primer Mix (UPM, Clonetech), 0.5µl
MyTaq (Bioline), and 17.25µl PCR grade water to attain a final volume of 25µl. EF-1-alpha-1
was again used for the positive control, and PCR grade water as the negative control, with S.
canicula spleen RACE cDNA being used as the template. Second round RACE reactions used
10µl MyTaq Red Reaction Buffer (Bioline), 5µl round 1 RACE PCR product, 1µl nested universal
primer (NUP), 1µl MyTaq (Bioline) and 32µl PCR grade water, to make a final volume of 50µl.
2.5 Visualisation of PCR and RACE PCR amplified sequences
Agarose gel electrophoresis was performed following PCR/RACE PCR to enable separation and
visualisation of amplified products (Sambrook and Russel, 2001). Agarose gels were prepared
using 0.5g molecular grade powdered agarose (Bioline) and 50ml TAE (Tris-Acetate-EDTA 50x,
Severn Biotech, at a dilution of 200ml in 10L water). 1-4µL SYBR Safe DNA Gel Stain (Bioline)
was also added, which intercalates into any DNA present and fluoresces in the presence of
ultraviolet (UV) light, enabling visualisation of the DNA. The solidified gel was loaded into a
horizontal gel rig (Bio-Rad) and was submerged in TAE buffer. Samples were loaded into wells
with a molecular weight size marker (3µl 100bp hyperLadder, Bioline) being loaded into a
neighbouring well to provide a visual guide to DNA molecule size (base pairs [bp]). Gels were
run at 100v for 60 min then visualised on a UV transillumination system (BioDoc-It).
2.6 DNA cloning of amplified sequences
2.6.1 Extraction and purification of DNA from agarose gel
Products which had been amplified during PCR were prepared for cloning using the
manufacturer’s instructions for the QIAquick Gel Extraction Kit (Qiagen). Visualised bands
were removed from the gel with a clean scalpel and placed in 1.5ml Eppendorf tubes. Three
13. 12
times the gel volume of QG buffer (Qiagen) was added to the gel and the tubes incubated in
a 50oC water bath for 10 minutes to re-solubilise the agarose gel. The gel and an equal volume
of isopropanol were pipetted into spin columns inserted into 2ml collection tubes and
inverted. The sample was then transferred to a Qiaspin column (Qiagen) and centrifuged at
13000rpm for 1 minute, after which the flow-through was discarded. A further 500µl of QG
buffer was added and the tubes centrifuged again at 13000rpm for 1 minute. After discarding
the flow-through, 750µl PE buffer (Qiagen) was added and the tubes were left to rest for 5
minutes. They were then centrifuged again at 13000rpm for 1 minute. After discarding the
flow-through, 30µl purified water was added and the flow-through collected for cloning.
2.6.2 DNA cloning using E. coli plasmids
X-Gal/IPTG/LB plates were prepared by mixing 10g tryptone, 5g yeast extract, 10g NaCl and
20g agar per litre deionised water and autoclaving. After cooling, X-Gal (25ug/ml), 0.1mM
IPTG (25µg/ml,) and ampicillin (100µg/ml) were added, before being poured into sterile petri
dishes and allowed to set. Ligation reactions were prepared by mixing 5µl 2X Rapid Ligation
Buffer, 1µl pGEM-T Easy Vector, 5µl PCR product and 1µl T4 DNA Ligase (all Promega) in 0.5ml
Eppendorf tubes. Reactions were incubated at 4oC overnight. 2µl of each ligation mix was
pipetted into separate 1.5ml Eppendorf tubes and 50 µl E. coli NEB 5-α heat shock-competent
bacteria added, before incubating on ice for 20 mins. The bacteria were then heat shocked at
42oC for 30 secs in a water bath. Cells were then returned to ice for a further 2 mins. 950µl
SOC medium (Sigma Aldrich) was added to each tube before incubating at 37oC for 1.5
hours. 100 µl of each culture was then plated onto the X-Gal/IPTG/LB plates and incubated
for 12 hours at 37oC. White colonies were then selected from the plates and put
14. 13
into LB broth (as above but without agar) containing 100 µg/ml ampicillin & grown overnight
at 37oC with rotation.
2.6.3 Isolation of cloned DNA
Plasmid DNA was isolated from the overnight bacterial cultures by applying the
manufacturer’s instructions for the QIAprep Spin Miniprep Kit (Qiagen). Bacterial cells were
pelleted by centrifuging at 13000rpm for 3 min before being resuspended in 250µl Buffer P1
and pipetted into sterile microcentrifuge Eppendorf tubes. 250µl Buffer P2 was added and
the solution mixed by inverting until the mixture became blue. 350µl Buffer N3 was then
added and immediately mixed to produce a colourless solution. The tubes were then
centrifuged at 13000rpm for 10 minutes, after which the supernatant was pipetted into
QIAprep spin columns. These were centrifuged at 13000rpm for 60s and the flow-through
discarded. 500µl Buffer PB was added to each spin column, before centrifuging once more
and again discarding the flow-through. 750µl Buffer PE wash buffer was then added to each
spin column before again centrifuging and discarding flow-through. QIAprep spin columns
were then placed into 1.5ml Eppendorf collection tubes and centrifuged for a further 1 minute
to remove remaining wash buffer. Each QIAprep column was then placed in a new sterile
1.5ml microcentrifuge tube to which 50µl Buffer EB was added to the centre of the column
and allowed to stand for 1 minute to elute the DNA. The tubes were then centrifuged for 1
minute and the flow-through collected and pipetted into new sterile 1.5ml Eppendorf tubes.
2.6.4 Nucleic acid preparation for sequencing
A NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific) was used to calculate the
nucleic acid concentration (ng/µl) in each sample by measuring the absorbance of UV-visible
15. 14
light by 1µl of each sample. 15µl of sample at 75ng/µl was prepared and 2µl T7 Universal
Sequencing primer at 10ng/µl added before sending for sequencing to Eurofins Genomics,
Ebersberg, Germany.
3. Results
3.1 Bioinformatics
Accession numbers published by Glenney & Wiens (2007) provided protein sequences for 53
of the 71 teleost TNFSF members identified in that study. Three sequences could not be
acquired from the discontinued TIGR Gene Indices database (www.tigr.org/tdb/tgi/), and a
further 15 had been retired from the Ensembl database without further successors being
provided. The supplementary data provided 12 of these outstanding sequences, leading to a
total of 65 sequences being identified. The 6 unavailable sequences included TNFSF members
TWEAK, TL1A, lymphotoxin α and β, and EDA, but similar sequences for these TNFSF members
had already been identified in other teleosts in that study.
BLASTing these 65 sequences with transcriptomic data for S. canicula resulted in the
identification of 30 potentially orthologous sequences (Appendix 1), representing 14 TNFSF
members (Table 3). Further BLASTing of these sequences in the NCBI protein database
resulted in the putative confirmation of 9 S. canicula TNFSF members (Table 3).
Table 3. S. canicula potential TNFSF sequences obtained through bioinformatics searches.
“+” indicates sequences which were obtained and “-“ indicates sequences which were not obtained.
TNFSF
member
BLAST 1
AfterParty/SkateBase
BLAST 2
(NCBI)
TNFSF
member
BLAST 1
AfterParty/SkateBase
BLAST 2
(NCBI)
TNF-α + - RANKL + +
TNF-β + - TWEAK - -
LT-β - - APRIL + +
OX40L + - BAFF + +
16. 15
CD40L + - LIGHT + +
FasL + + TL1A + +
CD27L - - GITRL - +
CD30L - - EDA + -
4-1BBL - - BALM + +
TRAIL + +
3.2 Sequence alignment and phylogenetic analysis
MAFFT Clustal alignment of these 30 sequences with similar sequences from representative
members of other vertebrate classes (H. sapiens, B. taurus, M. musculus, G. gallus, P. sebae,
A. carolinensis, C. picta, X. tropicalis, D. rerio, O. mykiss, L. chalumnae), and subsequent
removal of highly variable regions, enabled production of an unrooted maximum likelihood
phylogenetic tree, consisting of 164 TNFSF sequences containing 493 amino acid sites, and
using 1000 replications to obtain bootstrap support values (Figure 2). This indicated that 10
TNFSF members were expressed by S. canicula.
18. 17
Figure 2. Unrooted maximum likelihood phylogenetic tree of vertebrate TNFSF members. Coloured
boxes denote TNFSF members where S. canicula forms a clade with similar sequences to vertebrates
from other classes. Dotted boxes denote TNFSF members where S. canicula forms a clade only with
teleosts and other cartilaginous fish. Bootstrap values >70% are considered indicative of a clade.
Sequences include both cloned full-length amino acid sequences and predicted sequences obtained
during bioinformatics searches. Denotes a BALM sequence misannotated as a BAFF sequence in
genomic and protein databases. Abbreviations: Almi: Alligator mississippiensis; Anca: Anolis
carolinensis; Bota: Bos Taurus; Cami: Callorhynchus milii; Chpi: Chrysemys picta; Chpl: Chiloscyllium
plagiosum: Dare: Danio rerio; Gaac: Gasterosteus aculeatus; Gaga: Gallus gallus; Hosa: Homo sapiens;
Lach: Latimeria chalumnae; Mumu: Mus musculus; Onmy: Onchorhynchus mykiss; Opha: Ophiophagus
hannah; Pyse: Python sebae; Sasa: Salmo salar; Sqac: Squalus acanthias; Taru: Takifugu rubripes; Xela:
Xenopus laevis; Xetr: Xenopus tropicalis.
TNFSF members which did not appear to be present in S. canicula included TNF-α, TNF-β,
CD27L, 4-1BBL, TWEAK and EDA. The 2 putative S. canicula CD30L sequences did not group
with the other CD30L sequences from H. sapiens, G. gallus, C. picta, A. carolinensis and X.
tropicalis, nor with any other TNFSF sequences, raising questions about the identity of these
2 sequences, which will require further investigation. Similarly, the one suggested S. canicula
sequence for LT-β appeared to be grouped together with a variety of different TNF sequences
from other vertebrates, including those for TNF (which is a commonly used designator of TNF-
α [Albarbar et al., in press]) and TNF-β, again rendering the identify of this S. canicula sequence
unclear and in need of further investigation. The S. canicula CD40L sequence appeared more
similar to the TRAIL and RANKL sequences for other vertebrates (TRAIL: H. sapiens, M.
musculus, A. carolinensis, C. milii and L. chalumnae; RANKL: L. chalumnae, G. gallus, C. picta,
M. musculus, H. sapiens, C. milii), than it did to CD40L sequences for other vertebrates (C. milii,
L. chalumnae, M. musculus, H. sapiens, A. carolinensis, G. gallus, X. tropicalis). TNFSF
sequences for APRIL appeared in two discrete clusters, with APRIL sequences for a
cartilaginous fish, a lobe-finned fish, 2 teleosts and an amphibian (L. chalumnae, O. mykiss, S.
salar, X. laevis and S. canicula) forming one group, and sequences for 2 mammals and a reptile
(M. musculus, H. sapiens and A. carolinensis) forming a different group. Bootstrap value
19. 18
between these two groups was 47%, therefore they could not be considered a clade. TWEAK
sequences for 2 mammals, 2 reptiles and a lobe-finned fish (H. sapiens, M. musculus, C. picta,
A. mississippiensis and L. chalumnae) also appeared to share some similarities with both
groups of APRIL sequences. S. canicula TRAIL sequences did appear to group together with
TRAIL sequences for H. sapiens, M. musculus, A. carolinensis, C. mykiss and L. chalumnae, but
the S. canicula sequences did not cluster as closely together with the sequences for these 5
species as the sequences from these 5 species did with each other.
S. canicula TNFSF sequences which did appear to cluster with similar sequences for other
vertebrates in the phylogenetic tree included those for BALM, BAFF, OX40L, GITRL, FasL, TL1A,
RANKL and LIGHT. Three S. canicula BALM sequences clustered with BALM sequences for O.
mykiss, L. chalumnae, C. milii and a BAFF sequence for C. plagiosum, although the bootstrap
value of 56% for this grouping precludes these sequences being described as a clade (Figure
3). The C. plagiosum sequence had previously been mis-annotated and had recently been
identified as a BALM sequence (Li et al., 2015), although the genomic and protein databases
had not been amended, leading to this sequence being shown as BAFF in Figure 2. BALM is a
recently identified TNFSF member which has not yet been described in vertebrates other than
cartilaginous and bony fish, and this study also identified BALM sequences only in these 2
vertebrate classes. BAFF sequences for representatives from all vertebrate classes did form a
clade (bootstrap values > 70%) (Figure 3).
20. 19
Figure 3. Phylogenetic grouping for TNFSF members BALM and BAFF.
OX40L sequences from S. canicula, M. musculus, H. sapiens, C. picta and G. gallus formed a
clade, with bootstrap values of 77% and above (Figure 4). However, examination of MAFFT
sequence alignment did not support this (Appendix 2), since it revealed no conserved domains
shared by S. canicula and other vertebrates. The 2 S. canicula GITRL sequences also formed a
clade with similar sequences for H. sapiens, M. musculus and C. picta, with bootstrap values
of 94% and above (Figure 4) but, again, MAFFT alignment did not reveal the presence of shared
conserved regions (Appendix 2).
21. 20
Figure 4. Phylogenetic grouping of TNFSF members OX40L and GITRL
The S. canicula FasL sequence clustered with FasL sequences for another cartilaginous fish, C.
milii (bootstrap value 85%), and two mammals (H. sapiens and M. musculus; bootstrap value
66%), but no amphibian, reptile or avian FasL sequences were identified as being similar
(Figure 5). However, alignment did appear to indicate the presence of a number of conserved
domains among the species for which this sequence was identified (Appendix 2). Alignment
of S. canicula TL1A sequences with TL1A sequences for H. sapiens, M. musculus, C. picta, A.
carolinensis and O. hannah suggested that these species shared conserved domains (Appendix
2) and would therefore be expected to form a clade with similar sequences from these
sequences. However, although there was evidence of some grouping, the S. canicula
sequences did not form such a clade (Figure 5).
23. 22
RANKL sequences for H. sapiens, M. musculus, C. picta, G. gallus, L. chalumnae and C. milii
formed a clade, with high bootstrap values (Figure 6), and alignment reinforced this through
the apparent presence of a number of conserved domains (Appendix 2). Alignment of 2 S.
canicula LIGHT sequences with that for 2 mammals (H. sapiens and M. musculus) and 2 reptiles
(C. picta and A. carolinensis) indicated much similarity across the sequences (Appendix 2), and
this was reflected in the subsequent clustering in the phylogenetic tree (Figure 6). Bootstrap
values of 100% were also suggestive of close evolutionary relationship.
Figure 6. Phylogenetic grouping of TNFSF members RANKL and LIGHT
3.3 Sequence completion and amplification
Time constraints precluded further investigation of all putative S. canicula TNFSF members.
Those that had not appeared to be present (TNF-α, TNF-β, CD27L, 4-1BBL, TWEAK, EDA) and
those whose identity was unclear (CD30L, LT-β, CD40L, TRAIL) were therefore not selected for
sequence completion, amplification and cloning, since further bioinformatic examination of
these TNFSF members was required prior to commencement of these procedures. OX40L and
GITRL also required further bioinformatic investigation due to alignment dissimilarities with
24. 23
other vertebrate OX40L and GITRL sequences respectively. Since this project forms part of a
larger study of the TNFSF of cartilaginous fish, 3 TNFSF members (BAFF, BALM and APRIL) were
already being examined by colleagues in Dr Dooley’s team, and duplication of these efforts
was considered undesirable. The remaining 4 TNFSF members, FasL, TL1A, RANKL and LIGHT
were chosen for further investigation.
Examination of amino acid and nucleotide sequences for each of these 5 sequences provided
an indication of whether each sequence appeared to represent a complete or partial protein
sequence. Only one TNFSF sequence, FasL, appeared to contain a complete open reading
frame (Appendix 2). The remaining 4 sequences all appeared to lack both 5’ and 3’ ends
(Appendix 2). PCR was therefore chosen for amplification of FasL, and RACE-PCR for
completion and amplification of TL1A, RANKL and LIGHT sequences.
Initial FasL amplification using PCR did not reveal a predicted ~600bp band following
transillumination. PCR was repeated following changes to buffer and PCR grade water, but
the same result was obtained. Primer redesign to include at least 3 G/C nucleotides at the 5’
end was carried out and the new primers used for FasL PCR, but no amplification was
obtained. Annealing temperatures were adjusted through the use of Touchdown PCR, which
used annealing temperatures between 63oC-49oC, decreasing in increments of 0.4oC after
each cycle, to ensure that optimal annealing temperatures had been used, but no sequence
amplification was achieved.
RACE-PCR of TL1A was then attempted, after adopting the changes described above, but this
also did not result in completion or amplification of this TNFSF sequence (expected band
25. 24
~700p). Since it was possible that the S. canicula spleen mRNA from which the template cDNA
was generated may have degraded, this was replaced with spleen cDNA from a different
mRNA sample and TL1A RACE-PCR repeated. No sequence amplification was obtained.
Annealing temperature was lowered from 58oC to 53oC, and cycle number increased from 30
to 34, and TL1A RACE-PCR again repeated, but no sequence amplification was achieved.
RACE-PCR of LIGHT and RANKL was then carried out, again incorporating previous procedural
amendments. No sequence completion or amplification of either of these TNFSF members
was achieved (Figure 7: 1 & 2 show results for 3’ ends for both RANKL and LIGHT). Different
S. canicula tissues were then substituted as cDNA templates. The use of S. canicula liver cDNA
template resulted in amplification of the 3’ end for both RANKL and LIGHT (Figure 7: 5 & 6),
with the RANKL product appearing to be separated into 2 distinct bands. No amplification of
the 5’ ends for either RANKL or LIGHT was achieved (Figure 7: 9 & 10). Similarly, the use of S.
canicula epigonal cDNA template also resulted in amplification of the 3’ end for both RANKL
and LIGHT (Figure 7: 12 & 13). The bands obtained for the 5’ ends of both RANKL and LIGHT
were unclear (Figure 7: 16 & 17) and it was therefore not possible to estimate band size nor
to be certain that these indicated amplification.
26. 25
Figure 7. Scanned photo of electrophoresed gel under UV light showing amplification of 3’
ends of S. canicula TNFSF ligands LIGHT and RANKL, after RACE-PCR using S. canicula spleen,
liver and epigonal oligo dT-primed cDNA as template. 1-4: S. canicula spleen cDNA template:
1: RANKL 3’ product; 2: LIGHT 3’ product; 3: positive control using EF1a F1 primer; 4: negative
control using EF1A primer and H2O as template. 5-11: S. canicula liver cDNA template: 5: 3’
RANKL amplification; 6: 3’ LIGHT amplification; 7: positive control; 8: negative control; 9: 5’
RANKL product; 10: 5’ LIGHT product; 11: positive control. 12-18: S. canicula epigonal cDNA
template: 12: 3’ RANKL amplification; 13: 3’ LIGHT amplification; 14: positive control; 15:
negative control; 16: 5’ RANKL amplification; 17: 5’ LIGHT amplification; 18: positive control.
3.4 RACE-PCR product cloning and sequencing
Cloning and sequencing of the amplified 3’ RANKL and LIGHT RACE-PCR products enabled
comparison of these sequences with the previously obtained S. canicula nucleotide sequences
used for primer design (Table 2 and Appendix 2). The LIGHT 3’ and RANKL 3’ cloned and
sequenced RACE-PCR products obtained using S. canicula liver cDNA as a template shared no
regions of similarity with the nucleotide sequences used to design their primers, indicating
non-specific amplification, as was also the case for the LIGHT 3’ sequence with epigonal cDNA
as the template. However, comparison of the RANKL 3’ sequence, with epigonal cDNA as the
template, indicated completion of the 3’ end of the S. canicula RANKL transcript (Figure 8).
27. 26
Figure 8. Comparison of RANKL primer design and sequenced 3’ end. Red text indicates nucleotide
sequence used for ScRANKL-RACE-F2 primer; yellow highlighted area indicates completed 3’ end,
including stop codon.
4. Discussion
This study provides the first evidence of the existence of a number of TNFSF members in the
cartilaginous fish, S. canicula. Bioinformatic searches suggested that some mammalian TNFSF
members do not appear to be present in S. canicula (TNF-α, TNF-β, CD27L, 4-1BBL, TWEAK,
EDA). It is possible that, although present in the animal, these were not represented in the in-
house multi-tissue transcriptome database due to the types of tissue chosen for sequencing,
the immunisation status of the animal whose tissues were used, and the fact that the
sequence information derived from RNA samples from single tissues at single time points.
Since variations in tissues, cell types and environmental conditions influence gene expression,
the resulting vertebrate transcriptome information is almost certainly likely to be incomplete.
However, this database contains 623430 S. canicula sequences (from the spleen, gills, blood,
brain, epigonal, Leydig’s organ, spiral valve, stomach and liver), and has a Core Eukaryotic
Genes Mapping Approach (CEGMA) completeness score of 100% partial and 96% complete,
28. 27
suggesting a high degree of completeness and annotation reliability (Parra et al., 2007).
Possible limitations created by the use of transcriptomic data were also mitigated by pooling
the results of multiple different tissues and by normalising cDNA samples to maximise the
expression of genes expressed at lower levels, making it less likely that sequence information
for the above TNFSF members had been omitted from the databases. This is reinforced by the
fact that, with the exception of one apparent sequence for 4-1BBL, another cartilaginous fish,
C. milii, also does not appear to have the genes for TNF-α, TNF-β, CD27L, TWEAK or EDA in its
genome or transcriptome. Thus, while it is not possible to confirm the absence of these TNFSF
members in cartilaginous fish, and further work investigating their expression in other such
species, such as Leucoraja erinacea (little skate), for which some transcriptomic data is now
available, is required to corroborate this finding, the fact that two shark species demonstrate
similar results does provide a preliminary indication that these TNFSF members may not be
expressed by this group of animals. Other TNFSF sequences also require further investigation
to confirm their identities and possible relationships to TNFSF members in other vertebrates
(CD30L, LT-β, CD40L, APRIL, TRAIL, OX40L, GITRL). However, FasL, TL1A, LIGHT and RANKL
TNFSF sequences did appear to be present and to share some conserved domains with similar
sequences from other vertebrate classes.
It has been hypothesised that the evolution of the vertebrate TNFSF increased in complexity
during the development of the adaptive immune system, and involved WGD prior to the
emergence of vertebrates, followed by a series of localised duplications and reorganisations
of ancestral TNFSF genes (Glenney and Wiens, 2007). In humans, TNFSF genes tend to be
located in clusters on 8 different chromosomes (Table 4), with genes on the same
chromosome appearing to share some functional aspects (Collette et al., 2003). It is therefore
29. 28
striking that, even though homologues for all mammalian TNFSF members did not appear to
be present in S. canicula, at least one TNFSF member from each human “chromosomal cluster”
was either putatively identified or demonstrated sequence similarities sufficient to warrant
further investigation. This appears to support the hypothesis that the 19 mammalian TNFSF
members evolved from a smaller number of ancestral TNFSF members and, given the
chromosomal clustering of human TNFSF members, that this occurred on these chromosomes
through localised gene duplication and reorganisation.
Table 4. TNFSF human chromosomal organisation
1: S. canicula TNFSF sequences sharing conserved domains and forming a clade with similar sequences
in other vertebrates; 2: S. canicula TNFSF sequences whose identity requires further investigation and
confirmation. S. canicula sequences not identified included: TNF-α, LT-α, CD27L, 4-1BBL, EDA, TWEAK.
S. canicula BALM is not included since this has not been identified in the human TNFSF.
Human
chromosomal
location
Human TNF ligands Putatively identified S. canicula TNFSF ligands
1 2
1 FasL, GITRL, OX40L FasL GITRL, OX40L
6 LT-β, TNF-α, LT-α LT-β
9 CD30L, TL1A TL1A CD30L
19 LIGHT, CD27L, 4-1BBL LIGHT
X EDA, CD40L CD40L
3 TRAIL TRAIL
13 BAFF, RANKL BAFF, RANKL
17 APRIL, TWEAK APRIL
In mammals, TNF-α, LT-α and LT-β are all involved in cell apoptosis, with TNF-α being a
pyrogen, particularly during the acute phase of infection, and LT-α being an inflammation-
mediator (Croft et al., 2012). LT-β also interacts with LT-α, promoting the function of the
latter. Only one S. canicula LT-β sequence was putatively identified, and this appeared to
group with mammalian, reptile and teleost sequences for TNF-α and LT-α. This sequences
requires further evaluation to confirm its identity, but it is possible that a gene similar to this
may have been present in the common ancestor of all vertebrates, acting as a precursor to
the 3 human genes in this TNFSF subgroup and explaining why this S. canicula sequence
30. 29
cannot be assigned to any one of these groups. The apparent absence, apart from the one
possible LT-β sequence, of similar genes in S. canicula, and the fact that none of the other S.
canicula TNFSF members are pyrogens, also suggests that the adaptive immune system in
these animals may have a limited ability to mount an inflammatory response. It is possible
that the inflammatory response developed following the emergence of endothermic
vertebrates, and this is reinforced by the fact that teleosts, amphibians and reptiles appear
only to express TNF-α (Rollins-Smith & Woodhams, 2012; Roca et al., 2008). However, it is
also possible that such an inflammatory response is not beneficial to cartilaginous fish, since
it has not evolved in extant species. It may even lead to adverse energetic consequences and
fitness deficits, such as increased oxygen consumption and metabolic rate, dehydration or
damage to tissues (Rollins-Smith & Woodhams, 2012). Other ectothermic vertebrates often
respond to pathogen infection by raising overall body temperature behaviourally, for instance
by moving to warmer areas of water or land, and it is possible that cartilaginous fish respond
similarly (Rollins-Smith & Woodhams, 2012). However, other cytokines, such as interleukin-1
(IL-1) and interleukin-6 (IL-6), do act as pyrogens, and are expressed by cartilaginous fish,
teleosts, amphibians and reptiles, therefore it is possible that these cytokines, rather than
TNFSF members, perform inflammatory functions in these vertebrates (Zimmerman, Bowden
and Vogel, 2014). Lastly, the apparent deficiency of pyrogenic TNFSF members in S. canicula
may provide one explanation for the slow adaptive immune response of cartilaginous fish
relative to mammals (Dooley and Flajnik, 2005).
BALM sequences were only found in cartilaginous and bony fish, suggesting that this TNFSF
member may have been lost following the divergence of other vertebrate classes, or that it is
a cytokine specific to cartilaginous fish and teleosts. However, the fact that it has not yet been
31. 30
found in other vertebrates, particularly in other ectotherms, may also be due to a lack of
research into the TNFSF in non-mammalian species, with much work remaining to be done in
this area. BALM appeared to derive from a common ancestor from which BAFF, APRIL and
TWEAK also derive, but appeared most similar to BAFF and APRIL. Glenney and Wiens (2007)
hypothesised that BALM may either have been an ancestral gene of BAFF and APRIL, or that it
developed during gene duplication in teleosts; its presence in cartilaginous fish appears to
support the former hypothesis. In mammals, BAFF and APRIL are primarily involved in B cell
development, proliferation and survival, as well as in immunoglobulin production and class
switching; BAFF also promotes plasma cell differentiation and stimulates activated T cells,
while APRIL also regulates the growth of tumour cells (Roosnek et al., 2009; Mackay et al.,
2003). Although TWEAK appeared to share an ancient common ancestor with BAFF, BALM
and APRIL, its functions in mammals differ, since it appears to promote endothelial cell
migration and angiogenesis, as well as inducing apoptosis (Vince and Silk, 2006). The apparent
presence of BAFF, BALM and APRIL sequences in S. canicula suggest that B cell and
immunoglobulin regulation are important immunological requirements for these animals, and
also that B cell developmental requirements might be different in terms of TNFSF ligands. This
is reinforced by recent immunisation studies (Pettinello and Dooley, 2014; Crouch et al.,
2013). In mammals, RANKL genes are located on the same chromosome as BAFF, suggesting
that they may have evolved following gene duplication. The fact that these TNFSF members
perform very different functions (RANKL triggers dendritic cells to stimulate naïve T cells)
(Walsh and Choi, 2014), and the fact that few conserved domains are shared between similar
sequences for S. canicula and other vertebrates, would point to a duplication event during a
very early stage in vertebrate evolution.
32. 31
TL1A and CD30L are both found on human chromosome 9 (Table 2). Although S. canicula TL1A
did not appear to form a clade with TL1A sequences from other vertebrates, it did appear to
share some conserved domains with these. S. canicula CD30L did not appear to form a clade,
nor share conserved domains with CD30L sequences from other vertebrates, although this
remains to be confirmed. The apparent presence in S. canicula of TL1A, with less evidence of
the presence of CD30L, suggests that CD30L may have evolved in mammals from a duplication
and/or rearrangement of TL1A. This is supported by the fact that both are involved in
apoptosis, although TL1A is expressed by endothelial cells and CD30L by B and T cells. It is
also possible that endothelial cell expression of TL1A in cartilaginous fish also represents an
ancestral mode of expression, and that subsequent evolution of CD30L accompanied the
refinement of the adaptive immune system in mammals, leading to an alteration in cell
expression. In mammals, CD30L also triggers Ig class switching, and may have developed this
function subsequent to the emergence of this TNFSF member; this is reinforced by the fact
that Ig class switching does not occur in sharks due to the organisation of their IG genes in
clusters rather than in the translocon configuration found in mammals (Pettinello and Dooley,
2014).
In humans, LIGHT is located on chromosome 19, along with CD27L and 4-1BBL. S. canicula
LIGHT sequences demonstrated strong evidence of a close relationship with LIGHT sequences
in other vertebrates, suggesting that it may have emerged early in vertebrate development
and continued to play an important role in the vertebrate adaptive immune response. This
TNFSF member is generated by T cells, which it also stimulates, and may also induce cell
apoptosis, according to receptor expression. It is also responsible for promoting BAFF
production, which may be one reason why it has been maintained during vertebrate
33. 32
evolution. Neither CD27L nor 4-1BBL sequences were identified in S. canicula, suggesting
that these genes emerged more recently, possibly through duplication and rearrangement of
LIGHT. This is reinforced by the fact that both CD27L and 4-1BBL perform similar functions to
LIGHT through activating and causing proliferation of T cells (Kober et al., 2010).
S. canicula sequences for CD40L and TRAIL did appear to be present. CD40L was also
characterised in a recent study of S. canicula (Li et al., 2015), but TRAIL requires further
investigation, since this did not demonstrate phylogenetic clustering nor conserved domains
with similar sequences from other vertebrates. In humans, these TNFSF members are located
on chromosomes X and 3, respectively, and perform differing functions, with CD40L
modulating Ig class switching, memory B cell development and the formation of germinal
centres, and TRAIL inducing tumour cell apoptosis.
Recently identified teleost TNFSF member sequences formed a useful basis from which to
initiate a study of the TNFSF in cartilaginous fish. Teleosts are more closely related in terms
of evolutionary time to cartilaginous fish, and the TNFSF genes of these two vertebrate classes
might therefore be expected to exhibit close evolutionary relationships. However, this was
not the case, due to the fact that teleosts underwent an additional one (two, in the case of
salmonids and cyprinids) WGD events, during which they appear to have developed many
variations in their TNFSF genes (Macqueen and Johnston, 2014; Glenney and Wiens, 2007;
Volff, 2005). A more accurate impression of the evolutionary history and development of the
TNFSF was therefore gained from a comparison of the TNFSF genes in cartilaginous fish and
other, non-teleost, vertebrates, since these animals had undergone the same number of WGD
events. The evolutionary development of the TNFSF among these species would therefore be
34. 33
due solely to individual gene duplication and/or reorganisation as these classes diverged over
evolutionary time. Additional phylogenetic information was provided by a comparison of S.
canicula TNFSF genes with those of another cartilaginous fish, C. milii, since these 2 species
are both in the class Chondrichthyes and exhibit many physiological and genetic similarities
(Heinicke et al., 2009). However, C. milii is in the subclass Holocephali, and S. canicula in the
class Elasmobranchii, 2 classes that are believed to have diverged approximately 410mya
(Heinicke et al., 2009); both may therefore have had the potential to develop many genetic
variations. Any TNFSF gene similarities that have been maintained in these species would
therefore point towards these genes being of increased importance to these animals. The
presence of similar conserved genes in other vertebrates would also reinforce their
importance, and the development of novel TNFSF genes in other vertebrates would allow
further work to be carried out to gain a greater understanding of the potential fitness benefits
of these novel genes in more recently evolved vertebrate classes. Characterisation of the
TNFSF in cartilaginous fish may therefore clarify our understanding of the early nature and
function of the TNFSF, and comparisons to the TNFSF in non-teleost vertebrates may provide
insights into how these have been maintained, lost or changed over evolutionary time.
It is acknowledged that bioinformatic searches for TNFSF member sequences of all species
relied upon the quality of the data maintained in the various databases. Mis-annotation of
genes may have affected data accuracy; at least one sequence, Chiloscyllium plagiosum BAFF,
has recently been re-annotated as BALM (Li et al., 2015), as indicated on Figure 2. Similarly,
while BAFF sequences for representative mammals, birds, reptiles, amphibians and
cartilaginous fish (including S. canicula) clustered relatively closely on the phylogenetic tree,
two sequences in this grouping were annotated as APRIL, suggesting that they may be mis-
35. 34
annotated and require further investigation. Other sequences for APRIL appeared to form
two separate phylogenetic groups. Since one group contained mammalian and reptilian
representatives, while the other contained cartilaginous fish, coelacanth, teleost and
amphibian representatives, it is possible that this group separation was due to sequence
changes accumulated since evolutionary divergence, and this might suggest different
functional roles. However, sequence mis-annotation may also apply here. Lastly, since
relatively few studies have considered the TNFSF in vertebrates other than mammals, there
was a corresponding lack of sequence information available, which limited our ability to
produce a more comprehensive representation of the evolutionary history of the TNFSF
among different vertebrates.
The use of a secondary lymphoid tissue (spleen) cDNA as a template (Criscitiello, 2014;
Rumfelt et al., 2002) may have influenced these results, and different tissues were used as a
template during the later stages of the study as TNFSF expression may have been greater in
these tissues than in the spleen. The epigonal is a primary immune organ in cartilaginous fish
and may therefore express TNFSF genes at higher levels than the spleen. This appeared to be
the case following positive amplification of the 3’ ends of both LIGHT and RANKL following
RACE-PCR. These results suggest that any investigation of immune gene expression in S.
canicula and other animals should use a variety of different tissues as cDNA templates. Failure
to do this may provide an incomplete representation of immune gene expression in these
species. The immune status of the animals whose tissues are used is also important: this study
used tissue samples from an unimmunised animal which therefore may not have been
expressing TNFSF genes at sufficiently high levels to detect. Since TNFSF members are part of
the cytokine family and are involved in the immune system’s signalling process, it is possible
36. 35
that an immunological challenge would lead to increased cytokine signalling and hence to
higher levels of TNFSF gene expression in the S. canicula spleen. Further studies should
therefore be carried out on immunised animals, to determine whether this may be the case.
Time limitations precluded the amplification, cloning and sequencing of all putative TNFSF
members identified, and further work is required in order to synthesise a comprehensive
picture, not only of precisely which TNFSF members exist in cartilaginous fish, but also of their
development over evolutionary time in other vertebrates.
5. Conclusion
Recent advances in genome and transcriptome sequencing are now providing a wealth of
information that was previously unavailable, enabling investigation of the evolutionary
development of the TNFSF in all vertebrate classes. The results of this study support the
hypothesis that TNFSF genes in humans and other vertebrates evolved from a smaller number
of similar genes in cartilaginous fish and also that, with the exception of certain pyrogenic
capabilities, the TNFSF of cartilaginous fish fulfils similar functions to that of more “advanced”
vertebrates. Further investigation of the TNFSF in different vertebrate classes will increase
our understanding of the evolution of the TNFSF and may reveal novel roles for TNFSF genes
which may be utilised in the future development of therapeutics for both humans and other
vertebrates.
Acknowledgements
I would like to thank my supervisor, Dr Helen Dooley, for her unstinting advice and support
throughout this project, and for making the process both instructive and enjoyable. I would
37. 36
also like to thank her team for all their help, in particular Anthony Redmond for his patience
and help with all things bioinformatic, and Rita Pettinello and Dr Kimberley Mackenzie for their
valuable assistance in the lab.
38. 37
References
Adipogen, 2013. TNF Superfamily: linking autoimmune diseases, inflammation and cancer,
[online] Available at:
<http://www.adipogen.com/media/Catalogs/PDFs/AdipoGen_TNF%20Superfamily_Br
ochure_2013.pdf> [Accessed 10 October 2015].
Aggarwal, B.B. 2003. Signalling pathways of the TNF superfamily: a double-edged sword.
Nature Reviews Immunology, 3(9), 745-756.
Albarbar, B., Dunnill, C. & Georgopoulos, N.T. (in press) Regulation of cell fate by
lymphotoxin (LT) receptor signalling: functional differences and similarities of the LT
system to other TNF superfamily (TNFSF) members. Cytokine & Growth Factor
Reviews. (Accepted for publication May 2015).
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J. 1997.
Gapped BLAST and PSI-BLAST: A new generation of protein database search programs.
Nucleic Acids Research, 25(17), 3389-3402.
Astrakhantseva, I.V., Efimov, G.A., Drutskaya, M.S., Kruglov, A.A. & Nedospasov, S.A. 2014.
Modern anti-cytokine therapy of autoimmune diseases. Biochemistry (Moscow),
79(12), 1308-1321.
Biswas, G., Kinoshita, S., Kono, T., Hikima, J-I. & Sakai, M. 2015. Evolutionary evidence of
tumor necrosis factor super family members in the Japanese pufferfish (Takifugu
rubripes): comprehensive genomic identification and expression analysis. Marine
Genomics, 22, 25-36.
Borish, L.C & Steinke, J.W. 2003. Cytokines and chemokines. The Journal of Allergy and
Clinical Immunology, 111(suppl), S460-S475.
Bossen, C., Ingold, K., Tardivel, A., Bodmer, J-L., Gaide, O., Hertig, S., Ambrose, C., Tschopp, J.
& Schneider, P. 2006. Interactions of tumor necrosis factor (TNF) and TNF receptor
family members in the mouse and human. The Journal of Biological Chemistry,
281(20), 13964–13971.
Collette, Y., Gilles, A., Pontarotti, P. & Olive, D. 2003. A co-evolution perspective of the
TNFSF and TNFRSF families in the immune system. Trends in Immunology, 24(7), 387-
394.
Commins, S.P., Borish, L. & Steinke, J.W. 2010. Immunologic messenger molecules: cytokines,
interferons, and chemokines. Journal of Allergy and Clinical Immunology, 125(2), S53-
S72.
Croft, M., Duan, W., Choi, H., Eun, S-Y., Madireddi, S. & Mehta, A. 2012. TNF superfamily in
inflammatory disease: translating basic insights. Trends in Immunology, 33(3), 144-152.
39. 38
Croft, M., Benedict, C.A. & Ware, C.F. 2013. Clinical targeting of the TNF and TNFR
superfamilies. Nature Reviews Drug Discovery, 12, 147-168.
Crouch, K., Smith, L.E., Williams, R., Cao, W., Lee, M., Jensen, A. & Dooley, H. 2013. Humoral
immune response of the small-spotted catshark, Scyliorhinus canicula. Fish and
Shellfish Immunology, 34(5), pp. 1158-1169.
De Zoysa, M., Jung,S. & Lee, J. 2009. First molluscan TNF-α homologue of the TNF superfamily
in disk abalone: molecular characterization and expression analysis. Fish and Shellfish
Immunology, 26(4), 625-631.
Dinarello, C.A. 2000. Proinflammatory cytokines. Chest Journal, 118(2), 503-508.
Glenney, G.W. & Wiens, G.D. 2007. Early diversification of the TNF superfamily in teleosts:
genomic characterisation and expression analysis. The Journal of Immunology, 178(2),
7955-7973.
Gray, K.A., Yates, B., Seal, R.L. Wright, M.W. & Bruford, E.A. Genenames.org: the HGNC
resources in 2015. Nucleic Acids Research, 43(D1), D1079-D1085.
Grewal, I.S. 2009. Overview of TNF superfamily: a chest full of potential therapeutic targets.
In: I.S. Grewal, ed. 2009. Therapeutic Targets of the TNF Superfamily (Vol. 647). New
York: Springer Science & Business Media.
Hall, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98.
Hehlgans, T. & Pfeffer, K. 2005. The intriguing biology of the tumour necrosis factor/tumour
necrosis factor receptor superfamily: players, rules and the games. Immunology,
15(1), 1-20.
Heinicke, M.P., Naylor, G.J.P. & Hedges, S.B. 2009. Cartilaginous fishes (Chondrichthyes).
In: Eds S.B. Hedges & S. Kumar, eds, 2009. The Timetree of Life. Oxford: Oxford
University Press.
Infante, R.E. Wang, M.L., Radhakrishnan, A., Kwon, H.J., Brown, M.S. & Goldstein, J.L. 2008.
NPC2 facilitates bidirectional transfer of cholesterol between NPC1 and lipid bilayers, a
step in cholesterol egress from lysosomes. Proceedings of the National Academy of
Sciences, 105(40), 15287-15292.
Jones, M. & Blaxter, M. 2013. afterParty: turning raw transcriptomes into permanent
resources. BMC Bioinformatics, 14(1), 301.
Katoh, K., Misawa, K., Kuma, K. & Miyata, T. 2002. MAFFT: a novel method for rapid multiple
sequence alignment based on fast Fourier transform. Nucleic acids research, 30(14),
3059–3066.
40. 39
Kibbe, W.A. 2007. OligoCalc: an online oligonucleotide properties calculator, Nucleic Acids
Research, 35(Suppl 2), W43-W46.
Li, R., Redmond, A.K., Wang, T., Bird, S., Dooley, H. & Secombes, C.J. 2015. Characterisation
of the TNF superfamily members CD40L and BAFF in the small-spotted catshark
(Syliorhinus canicula). Fish and Shellfish Immunology, 47(1), 381-389.
Mackay, F., Schneider, P., Rennert, P. & Browning, J. 2003. BAFF and APRIL: a tutorial on B
cell survival. Annual Review of Immunology, 21(1), 231-264.
Macqueen, D.J. & Johnston, I.A. 2014. A well-constrained estimate for the timing of the
salmonid whole genome duplication reveals major decoupling from species
diversification. Proceedings of the Royal Society of London B: Biological Sciences,
281(1778), 20132881.
Minh, B.Q., Nguyen, M.A.T., & von Haeseler, A. 2013. Ultrafast approximation for
phylogenetic bootstrap. Molecular Biology and Evolution, 30(1), 1188-1195.
Morariu, V.I., Srinivasan, B.V., Raykar, V.C., Duraiswami, R. & Davis, L.S. 2009. Automatic
online tuning for fast Gaussian summation. Advances in Neural Information Processing
Systems, 1113-1120.
Nguyen, L.T., Schmidt, H.A., von Haeseler, A. & Minh, B.Q. 2015. IQ-tree: a fast and
effective stochastic algorithm for estimating maximum-likelihood
phylogenies. Molecular Biology and Evolution, 32(1), 268-274.
Olsvik, P.A., Lie, K.K., Jordal, A.E.O., Nilsen, T.O. & Hordvik, I. 2005. Evaluation of potential
reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Molecular
Biology, 6(1), 21.
Opal, S.M. & DePalo, V.A. 2000. Anti-inflammatory cytokines. Chest Journal, 117(4), 1162-
1172.
Parra, G., Bradnam, K. & Korf, I. 2007. CEGMA: a pipeline to accurately annotate core genes
in eukaryotic genomes. Bioinformatics, 23(9), 1061-1067.
Pettinello, R. & Dooley, H. 2014. The immunoglobulins of cold-blooded vertebrates.
Biomolecules, 4(4), pp. 1045-1069.
Robert, J. 2015. Textbook of Cell Signalling in Cancer: An Educational Approach. Paris:
Springer.
Roca, F.J., Mulero, I., López-Mũnoz, A. Sepulcre, M.P., Renshaw, S.A. Meseguer, J. & Mulero,
V. 2008. Evolution of the inflammatory response in vertebrates: fish TNF-α is a
powerful activator of endothelial cells but hardly activates phagocytes. The Journal of
Immunology, 181(7), 5071-5081.
41. 40
Roosnek, E., Burjanadze, M., Dietrich, P.Y., Matthes, T., Passweg, J. & Huard, B. 2009. Tumors
that look for their springtime in APRIL. Critical Reviews in Oncology/Hematology, 72(2),
91-97.
Sambrook, J.S. & Russel, D.W.R. 2001. Molecular cloning: a laboratory manual. New York:
Cold Spring Harbor Press.
Schneider, K., Potter, K.G. & Ware, C.F. 2004. Lymphotoxin and LIGHT signalling pathways
and target genes. Immunological Reviews, 202(1), 49-66.
Siakavellas, S.I., Sfikakis, P.P. & Bamias, G. 2015. The TL1A/DR3/DcR3 pathway in
autoimmune rheumatic diseases. Seminars in Arthritis and Rheumatism, 45(1), 1-8.
Sedger, L.M. & McDermott, M.F. 2014. TNF and TNF-receptors: from mediators of cell death
and inflammation to therapeutic giants – past, present and future. Cytokine and Growth
Factor Reviews, 25(4), 453-472.
Tansey, M.G. & Szymkowski, D.E. 2009. The TNF superfamily in 2009: new pathways, new
indications, and new drugs. Drug Discovery Today, 14(23), 1082-1088.
Testar, J., 2015. Cytokines: Introduction. [online] Available at:
<http://bitesized.immunology.org/receptors-and-molecules/cytokines> [Accessed 27
September 2015].
Venkatesh, B., Lee, A.P., Ravi, V., Maurya, A.K., Lian, M.M., Swann, J.B., Ohta, Y., Flajnik, M.F.,
Sutoh, Y., Kasahara, M., Hoon, S., Gangu, V., Roy, S.W., Irimia, M., Korzh, V., Kondrychyn,
I., Lim, Z.W., Tay, B-H., Tohari, S., Kong, K.W., Ho, S., Lorente-Galdos, B., Quilez, J.,
Marques-Bonet, T., Raney, B.J., Ingham, P.W., Tay, A., Hillier, L.W., Minx, P., Boehm, T.,
Wilson, R.K., Brenner, S. & Warren, W.C. 2014. Elephant shark genome provides unique
insights into gnathostome evolution. Nature, 505(7482), 174-179.
Vince, J.E. & Silke, J. 2006. TWEAK shall inherit the earth. Cell Death and Differentiation,
13(11), 1842.
Vujanovic, N.L. 2011. Role of TNF superfamily ligands in innate immunity. Immunologic
Research, 50(2-3), 159-174.
Walczak, H. 2015. Death receptor-ligand systems in cancer, cell death, and inflammation.
Cold Spring Harbor Perspectives in Biology, 5(5), a008698.
Walsh, M.C. & Choi, Y. 2014. Biology of the RANKL-RANK-OPG system in immunity, bone, and
beyond. Frontiers in Immunology, 5, 1-11.
Wang, J. & Yang-Xin, F. 2005. Tumor necrosis factor family members and inflammatory
bowel disease. Immunological Reviews, 204(1), 144-155.
42. 41
Wang, Q., Arighi, C.N., King, B.L., Polson, S.W., Vincent, J., Chen, C., Huang, H., Kingham, B.F.,
Page, S.T., Rendino, M.F., Thomas, W.K., Udwary, D.W., Wu, C.H. & The North East
Bioinformatics Collaborative Curation Team. 2012. Community annotation and
bioinformatics workforce development in concert – Little Skate Genome Annotation
Workshops and Jamborees. Database, 2012: bar064.
Wiens, G.D. & Glenney, G.W. 2011. Origin and evolution of TNF and TNF receptor
superfamilies. Developmental and Comparative Immunology, 35(12), 1324-1335.
Wyffels, J., King, B.L., Vincent, J., Chen, C.., Wu, C.H., & Polson, S.W. 2014. SkateBase, an
elasmobranch genome project and collection of molecular resources for
chondrichthyan fishes. F1000Research, 3.