Social support plays a critical role in successful aging. Is this tr.pdf
•
0 likes•2 views
Social support plays a critical role in successful aging. Is this true or false? Why? Solution Social support plays a critical role in successful aging. The statement is true. Aging refers to the process of becoming older over a period of time.This includes the changes in physical , psychological and social changes.At any stage of life social support play a crucial role in the success of a person this is even more true in case of older adults.with the advancement of age there are several changes that occur in the life which include changes in the job status, a person may retire and yet may have family financial commitments to be fulfilled,the children would have grown up and for their future they might have left the parents for their life settlements , deterioration of physical health, financial status ,empty nest syndrome, felling isolated and left out all these may also lead to psychological depression. A positive approach to life is a very important factor in the process of aging. in older adults the body immune system becomes fragile , resources for support become depleted and such other causes will have an effect in the process of aging.Psychological well being is an indication of successful adaptation to old age . Acceptance to change as a part of life provides strength in overcoming several psychological problems and studies have indicated that adults who are active are more likely to be successful in their old age than those who expect a leisurely and lazy dependent life as this tend to negative interactions with the family mainly. As people age remaining socially active provides a positive health benefits to the aged people. Successful connectedness,isolation, mobility, spirituality all have a say in dealing with the geriatric problems.one can adapt themselves to the age by being socially active .Voulenteering is a notable factor in relation to social support for adults.It helps in building companionship and interact with more people of the community.They can engage themselves in spiritual activities , develop more realistic goals ,opportunities for self discovery. Physical health plays a very important role in successful aging,with the advancement of age .social support in terms of maintaining day to day affairs also plays a crucial role and studies have suggested that it also helps in enhanced well being , less depression and often provides a senses of meaning to life. To conclude aging is a general process and acceptance with grace provides the main solution for successful aging and the social support either monetary, physical or psychological all play a very important role in helping the elderly people in the late years of their life..
Report
Share
Report
Share
Download to read offline
Recommended
5 Good reasons why seniors must consider social engagement
At Connect55+, we believe that social engagement plays a vital role in enhancing the lives of seniors and promoting overall well-being. Our platform is dedicated to encouraging seniors to embrace social interactions, foster meaningful connections, and lead fulfilling lives in their golden years. Here are five compelling reasons why seniors must consider social engagement.
Litrature review
Dear Father ,
Here I am sending literature review for correction
With regards
Sr. Shalet
Common Factors Affecting Change In Interest in Old Age
This was my report and im done with it, so before it gets eaten by the recycle bin, im sharing it with you guys.
Introduction to Health
good health - the state of being vigorous and free from bodily or mental disease. healthiness. physical condition, physiological condition, physiological state - the condition or state of the body or bodily functions. haleness, wholeness - a state of robust good health.
Recommended
5 Good reasons why seniors must consider social engagement
At Connect55+, we believe that social engagement plays a vital role in enhancing the lives of seniors and promoting overall well-being. Our platform is dedicated to encouraging seniors to embrace social interactions, foster meaningful connections, and lead fulfilling lives in their golden years. Here are five compelling reasons why seniors must consider social engagement.
Litrature review
Dear Father ,
Here I am sending literature review for correction
With regards
Sr. Shalet
Common Factors Affecting Change In Interest in Old Age
This was my report and im done with it, so before it gets eaten by the recycle bin, im sharing it with you guys.
Introduction to Health
good health - the state of being vigorous and free from bodily or mental disease. healthiness. physical condition, physiological condition, physiological state - the condition or state of the body or bodily functions. haleness, wholeness - a state of robust good health.
STEPS OF Psychological PROCESS OF AGING.pptx
Aging
What is aging
Causes of ageing
Stages of aging
Independence
Interdependence,dependence,crisis management,end of life/final stage
Impact of Mental Health Disorders and Treatment Support
Explore the profound effects of mental health disorders on individuals and society. Learn about the available treatment options for various mental health conditions. Find valuable insights and support for mental well-being.
1Initial Reflection Essay on AgingUnisha Jadhari
1
Initial Reflection Essay on Aging
Unisha Jadhari
HS 3443.50
Health Aspect of Aging
Dr. T Douglas Coyle
June 6th, 2021
Initial Reflection Essay on Aging
Aging is a step-by-step, constant process of natural development that kicks off in early adulthood. During this period, many bodily functions start to decline gradually. An individual does not become elderly or old at a particular age. Traditionally, people believe age 65 to be the beginning of old age. It is not precisely clear what constitutes aging. As I reflect through my personal experience, I can clearly understand what aging includes. Through the course, I have gained enough knowledge about the human cycle and how to prepare for old age. This reflection explains some of the beliefs associated with aging, the relationship between aging and health, and the challenges older adults face in their daily activities.
Many people have various beliefs about old age. The elderly are believed to experience depression and loneliness. As this group grows old, some may feel isolated and lonely, resulting in depression, sadness, and anxiety. Another belief is that, as people age, their sleep needs decline. These people experience hard times falling and staying asleep, affecting their mental well-being and overall health.
Moreover, people continue to believe that older adults can't learn new ideas. This misconception is not true as more senior people still can create new memories, learn new ideas and improve their performance on various activities. It is a common belief that older adults are forgetful. In most cases, older people tend to forget some of the things with ease and cannot account for some of the items in their lifetime (Bryant, 2010). I have come to understand some of these beliefs through my grandparents, who experience some of these problems. Some of the health challenges associated with aging include hearing loss, back and neck pain, depression, diabetes, and dementia, to name a few. These health conditions are prevalent at old age.
It is essential to take care of the elderly in the community. Understanding the elderly needs is of utmost importance to better establish initiatives geared towards taking care of their welfare. The elderly is vulnerable in society, thus developing health promotion to ensure they continue and enjoy life in the community. Aging comes with various challenges. Some of these challenges include loss of independence, diminished physical ability, age discrimination, disease prevalence, mistreatment and abuse, and poverty (Liddle et al., 2016). My biggest concerns about aging include declining health, old age, financial difficulties, and having to depend on others for daily upkeep. Moreover, I am worried about losing my mental capacity and decline in physical activity. These concerns cut across all ages, including older adults in my community.
In this course, I expect to learn more about the biological causes of aging and how one can avoid some of the chall ...
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human Development:
Approaches and Theories
29
markferguson2/Alamy
Learning Objectives
1.1 Outline five principles of the lifespan developmental perspective.
1.2 Discuss three theoretical controversies about human development.
1.3 Summarize five theoretical perspectives on human development.
1.4 Describe the methods used in studying human development,
including types of data and designs.
1.5 Discuss the responsibility of researchers to their participants and
how they may protect them.
Digital Resources
Resilience: It Takes a Village
Poverty and Brain Development
Second Couplehood in Late Adulthood
Nature and Nurture
Educational Aspirations
Sociocultural Influences on Development: Desegregation
Children of Katrina: Longitudinal Research
Childhood Exposure to Lead
Voluntary Participation in HIV Research
Master these learning objectives with multimedia resources available at
edge.sagepub.com/kuthertopical and Lives in Context video cases
available in the interactive eBook.
30
Think back over your lifetime. How have you grown and changed through
the years? Do your parents describe you as a happy baby? Were you
fussy? Do you remember your first day of kindergarten? What are some of
your most vivid childhood memories? Did you begin puberty early, late, or
was your development similar to others your age? Were your adolescent
years a stressful time? What types of changes do you expect to undergo in
your adult years? Where will you live? Will you have a spouse? Will you
have children? What career will you choose? How might these life choices
and circumstances influence how you age and your perspective in older
adulthood? Will your personality remain the same or change over time? In
short, how will you change over the course of your lifespan?
What is Lifespan Human Development?
This is a book about lifespan human development—the ways in which
people grow, change, and stay the same throughout their lives, from
conception to death. When people use the term development, they often
mean the transformation from infant to adult. However, development does
not end with adulthood. We continue to change in predictable ways
throughout our lifetime, even into old age. Developmental scientists study
human development. They seek to understand lifetime patterns of change.
lifespan human development An approach to studying human
development that examines ways in which individuals grow,
change, and stay the same throughout their lives, from conception
to death.
Table 1.1 illustrates the many phases of life that we progress through from
conception to death. Each phase of life may have a different label and set
of developmental tasks, but all have value. The changes that we undergo
during infancy influence how we experience later changes, such as those
during adolescence and beyond. This is true for all ages in life. Each phase
of life is important and accompanied by its own demands and
opportunities.
Change is the most obv ...
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human Development:
Approaches and Theories
29
markferguson2/Alamy
Learning Objectives
1.1 Outline five principles of the lifespan developmental perspective.
1.2 Discuss three theoretical controversies about human development.
1.3 Summarize five theoretical perspectives on human development.
1.4 Describe the methods used in studying human development,
including types of data and designs.
1.5 Discuss the responsibility of researchers to their participants and
how they may protect them.
Digital Resources
Resilience: It Takes a Village
Poverty and Brain Development
Second Couplehood in Late Adulthood
Nature and Nurture
Educational Aspirations
Sociocultural Influences on Development: Desegregation
Children of Katrina: Longitudinal Research
Childhood Exposure to Lead
Voluntary Participation in HIV Research
Master these learning objectives with multimedia resources available at
edge.sagepub.com/kuthertopical and Lives in Context video cases
available in the interactive eBook.
30
Think back over your lifetime. How have you grown and changed through
the years? Do your parents describe you as a happy baby? Were you
fussy? Do you remember your first day of kindergarten? What are some of
your most vivid childhood memories? Did you begin puberty early, late, or
was your development similar to others your age? Were your adolescent
years a stressful time? What types of changes do you expect to undergo in
your adult years? Where will you live? Will you have a spouse? Will you
have children? What career will you choose? How might these life choices
and circumstances influence how you age and your perspective in older
adulthood? Will your personality remain the same or change over time? In
short, how will you change over the course of your lifespan?
What is Lifespan Human Development?
This is a book about lifespan human development—the ways in which
people grow, change, and stay the same throughout their lives, from
conception to death. When people use the term development, they often
mean the transformation from infant to adult. However, development does
not end with adulthood. We continue to change in predictable ways
throughout our lifetime, even into old age. Developmental scientists study
human development. They seek to understand lifetime patterns of change.
lifespan human development An approach to studying human
development that examines ways in which individuals grow,
change, and stay the same throughout their lives, from conception
to death.
Table 1.1 illustrates the many phases of life that we progress through from
conception to death. Each phase of life may have a different label and set
of developmental tasks, but all have value. The changes that we undergo
during infancy influence how we experience later changes, such as those
during adolescence and beyond. This is true for all ages in life. Each phase
of life is important and accompanied by its own demands and
opportunities.
Change is the most obv ...
Increased and decreased mental health in adulthood
As you grow up your brain and mental health changes. Life gives us all some kind of trauma, stress, and anxiety, and all individuals are affected in a different way. Being educated on increased and decreased mental health in adulthood can teach you some great coping skills.
Later Life Transitions - Ken Laidlaw
Some more optimistic findings from research about ageing across the world. Talk given by Ken Laidlaw, Consultant Clinical Psychologist, NHS Lothian. Edinburgh City Chambers, 29th January 2009.
From Struggle to Strength: Nurturing Freedom Through the Journey of Seeking H...
Empower your journey with 'From Struggle to Strength' by Solh Wellness, exploring growth and freedom through seeking help.
I need help writing the methods for the song and playList class in J.pdf
I need help writing the methods for the song and playList class in Java. I already have the
interface and the getters and setter. Can someone help with the methods?
Song Class
public class Song
private String artist // the artist performing the song
private String title // the title of the song
private int minutes // number of min in length
private int seconds // number of seconds of length of the song (always less than 60)
// Add Getters / Setters for all fields
// Three constructors (remember to initialize ALL fields in each of the constructors - regardless
of the number of parameters!)
public Song(String artist, String title)
public Song(String artist, String title, int minutes, int seconds)
public Song(Song s)
public boolean equals(Object o) // a song is equal if all four fields are equal
public String toString() { // Use this code for toString EXACTLY
return \"{Song: title = \" + title + \" artist = \" + artist + \"}\";
}
public void play() { // Use this code for play EXACTLY
System.out.printf(\"Playing Song: artist = %-20s title = %s\ \", artist, title);
}
Make the Song class implement the interface Comparable, and make the ordering criteria as
follows: Songs will be ordered by artist in ascending order. If the artists are the same, then by
title in ascending order. If both artist and title are the same, then any order is acceptable.
Don’t forget to include any methods needed to implement the Playable interface.
PlayList Class
public class PlayList
Methods that modify the list should return a boolean return true if they successfully change the
list, otherwise they return false. Note that a PlayList can contain other PlayLists!
Methods that return a Playable element return null if they fail to find the song in question.
private String name // contains the name of the playlist
private ArrayList playableList // ArrayList of Playable elements that make up the play list
// Add Getters / Setters for name and songList
// Add a toString() method that returns the name of the playlist followed by its contents (by
calling toString() on each item it contains). You should only have one name/title per line
// Two constructors (remember to initialize ALL fields in each of the constructors - regardless of
the number of parameters!)
public PlayList() // empty play list named \"Untitled\"
public PlayList(String newName) // empty play list
public boolean loadSongs(String fileName) // loads songs from file, more on this below
public boolean clear() // removes all playable elements in the play list
public boolean addSong(Song s) // adds Song s to the end of the play list
public Playable removePlayable(int index) // removes Playable element at index from the list and
returns it
public Playable removePlayable(Playable p) // removes every occurrence of Playable p from the
list and returns p
public Playable getPlayable(int index) // returns the Playable element at the appropriate index
public boolean addPlayList(PlayList pl) //adds the PlayList that is being pa.
How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdf
How do autopolyploidy and allopolyploidy differ? Only autopolyploidy involves an increase in
chromosome sets. The chromosomes of an autopolyploid individual come from the same
species, while an allopolyploid has sets of chromosomes from different species. Autopolyploidy
is a mechanism of speciation in plants, while allopolyploid is a mechanism of speciation animals.
Autopolyploidy is sympatric, while allopolyploidy is allopatric.
Solution
Answer:
b). The chromosomes of an autopolyploid individual come from the same species, while an
allopolyploid has sets of chromsomes from different species
Autopolyploidy arises from fusion of gametes of the same species (cell division errors, etc.). In
this process, polyploid individuals develop as a result of cell division errors that double the DNA
content of gametes in individuals from the same species or a self-fertilizing individual. When
these double-dose gametes fuse, the result is an organism with double the chromosome number
of its parent species.
Allopolyploidy occurs when the gametes from two species fuse to form a polyploid generation
and hybrid offspring..
How do you find the order of growth for the following recurrenceT.pdf
How do you find the order of growth for the following recurrence?
T(n) = 9T(n/3) + n2
Solution
The Master Theorem applies to recurrences of the following form:
T (n) = aT (n/b) + f (n)
where a 1 and b > 1 are constants and f (n) is an asymptotically positive function.
There are 3 cases:
Case First:-- f(n) is O(nlogba ). Since the leaves grow faster than f, all work is done at the
leaves, so T(n) is (nlogb a).
Case Second:-- f(n) is (nlogba). The leaves grow at same rate as f, so the same order of work is
done at every level of tree. Therfore tree has O(log n) levels times the work done on one level,
yielding T(n) is (nlogb a log n).
Case Third:-- f(n) is (nlogba + ). Here f grows faster than the number of leaves, which means that
asymptotically the total amount of work is dominated by the work done at the root node. For the
upper bound, we also need an extra smoothness condition on f in this case i.e af(n/b) cf(n) for
some constant c < 1 and large n. In this case T(n) is (f(n)).
Therefore, using Master Method on your above Question
a=9, b=3, =log39 = 2, f(n) = n2, so Case 2, i.e. T(n) = (nlogn) = (n2logn)..
More Related Content
Similar to Social support plays a critical role in successful aging. Is this tr.pdf
STEPS OF Psychological PROCESS OF AGING.pptx
Aging
What is aging
Causes of ageing
Stages of aging
Independence
Interdependence,dependence,crisis management,end of life/final stage
Impact of Mental Health Disorders and Treatment Support
Explore the profound effects of mental health disorders on individuals and society. Learn about the available treatment options for various mental health conditions. Find valuable insights and support for mental well-being.
1Initial Reflection Essay on AgingUnisha Jadhari
1
Initial Reflection Essay on Aging
Unisha Jadhari
HS 3443.50
Health Aspect of Aging
Dr. T Douglas Coyle
June 6th, 2021
Initial Reflection Essay on Aging
Aging is a step-by-step, constant process of natural development that kicks off in early adulthood. During this period, many bodily functions start to decline gradually. An individual does not become elderly or old at a particular age. Traditionally, people believe age 65 to be the beginning of old age. It is not precisely clear what constitutes aging. As I reflect through my personal experience, I can clearly understand what aging includes. Through the course, I have gained enough knowledge about the human cycle and how to prepare for old age. This reflection explains some of the beliefs associated with aging, the relationship between aging and health, and the challenges older adults face in their daily activities.
Many people have various beliefs about old age. The elderly are believed to experience depression and loneliness. As this group grows old, some may feel isolated and lonely, resulting in depression, sadness, and anxiety. Another belief is that, as people age, their sleep needs decline. These people experience hard times falling and staying asleep, affecting their mental well-being and overall health.
Moreover, people continue to believe that older adults can't learn new ideas. This misconception is not true as more senior people still can create new memories, learn new ideas and improve their performance on various activities. It is a common belief that older adults are forgetful. In most cases, older people tend to forget some of the things with ease and cannot account for some of the items in their lifetime (Bryant, 2010). I have come to understand some of these beliefs through my grandparents, who experience some of these problems. Some of the health challenges associated with aging include hearing loss, back and neck pain, depression, diabetes, and dementia, to name a few. These health conditions are prevalent at old age.
It is essential to take care of the elderly in the community. Understanding the elderly needs is of utmost importance to better establish initiatives geared towards taking care of their welfare. The elderly is vulnerable in society, thus developing health promotion to ensure they continue and enjoy life in the community. Aging comes with various challenges. Some of these challenges include loss of independence, diminished physical ability, age discrimination, disease prevalence, mistreatment and abuse, and poverty (Liddle et al., 2016). My biggest concerns about aging include declining health, old age, financial difficulties, and having to depend on others for daily upkeep. Moreover, I am worried about losing my mental capacity and decline in physical activity. These concerns cut across all ages, including older adults in my community.
In this course, I expect to learn more about the biological causes of aging and how one can avoid some of the chall ...
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human Development:
Approaches and Theories
29
markferguson2/Alamy
Learning Objectives
1.1 Outline five principles of the lifespan developmental perspective.
1.2 Discuss three theoretical controversies about human development.
1.3 Summarize five theoretical perspectives on human development.
1.4 Describe the methods used in studying human development,
including types of data and designs.
1.5 Discuss the responsibility of researchers to their participants and
how they may protect them.
Digital Resources
Resilience: It Takes a Village
Poverty and Brain Development
Second Couplehood in Late Adulthood
Nature and Nurture
Educational Aspirations
Sociocultural Influences on Development: Desegregation
Children of Katrina: Longitudinal Research
Childhood Exposure to Lead
Voluntary Participation in HIV Research
Master these learning objectives with multimedia resources available at
edge.sagepub.com/kuthertopical and Lives in Context video cases
available in the interactive eBook.
30
Think back over your lifetime. How have you grown and changed through
the years? Do your parents describe you as a happy baby? Were you
fussy? Do you remember your first day of kindergarten? What are some of
your most vivid childhood memories? Did you begin puberty early, late, or
was your development similar to others your age? Were your adolescent
years a stressful time? What types of changes do you expect to undergo in
your adult years? Where will you live? Will you have a spouse? Will you
have children? What career will you choose? How might these life choices
and circumstances influence how you age and your perspective in older
adulthood? Will your personality remain the same or change over time? In
short, how will you change over the course of your lifespan?
What is Lifespan Human Development?
This is a book about lifespan human development—the ways in which
people grow, change, and stay the same throughout their lives, from
conception to death. When people use the term development, they often
mean the transformation from infant to adult. However, development does
not end with adulthood. We continue to change in predictable ways
throughout our lifetime, even into old age. Developmental scientists study
human development. They seek to understand lifetime patterns of change.
lifespan human development An approach to studying human
development that examines ways in which individuals grow,
change, and stay the same throughout their lives, from conception
to death.
Table 1.1 illustrates the many phases of life that we progress through from
conception to death. Each phase of life may have a different label and set
of developmental tasks, but all have value. The changes that we undergo
during infancy influence how we experience later changes, such as those
during adolescence and beyond. This is true for all ages in life. Each phase
of life is important and accompanied by its own demands and
opportunities.
Change is the most obv ...
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human Development:
Approaches and Theories
29
markferguson2/Alamy
Learning Objectives
1.1 Outline five principles of the lifespan developmental perspective.
1.2 Discuss three theoretical controversies about human development.
1.3 Summarize five theoretical perspectives on human development.
1.4 Describe the methods used in studying human development,
including types of data and designs.
1.5 Discuss the responsibility of researchers to their participants and
how they may protect them.
Digital Resources
Resilience: It Takes a Village
Poverty and Brain Development
Second Couplehood in Late Adulthood
Nature and Nurture
Educational Aspirations
Sociocultural Influences on Development: Desegregation
Children of Katrina: Longitudinal Research
Childhood Exposure to Lead
Voluntary Participation in HIV Research
Master these learning objectives with multimedia resources available at
edge.sagepub.com/kuthertopical and Lives in Context video cases
available in the interactive eBook.
30
Think back over your lifetime. How have you grown and changed through
the years? Do your parents describe you as a happy baby? Were you
fussy? Do you remember your first day of kindergarten? What are some of
your most vivid childhood memories? Did you begin puberty early, late, or
was your development similar to others your age? Were your adolescent
years a stressful time? What types of changes do you expect to undergo in
your adult years? Where will you live? Will you have a spouse? Will you
have children? What career will you choose? How might these life choices
and circumstances influence how you age and your perspective in older
adulthood? Will your personality remain the same or change over time? In
short, how will you change over the course of your lifespan?
What is Lifespan Human Development?
This is a book about lifespan human development—the ways in which
people grow, change, and stay the same throughout their lives, from
conception to death. When people use the term development, they often
mean the transformation from infant to adult. However, development does
not end with adulthood. We continue to change in predictable ways
throughout our lifetime, even into old age. Developmental scientists study
human development. They seek to understand lifetime patterns of change.
lifespan human development An approach to studying human
development that examines ways in which individuals grow,
change, and stay the same throughout their lives, from conception
to death.
Table 1.1 illustrates the many phases of life that we progress through from
conception to death. Each phase of life may have a different label and set
of developmental tasks, but all have value. The changes that we undergo
during infancy influence how we experience later changes, such as those
during adolescence and beyond. This is true for all ages in life. Each phase
of life is important and accompanied by its own demands and
opportunities.
Change is the most obv ...
Increased and decreased mental health in adulthood
As you grow up your brain and mental health changes. Life gives us all some kind of trauma, stress, and anxiety, and all individuals are affected in a different way. Being educated on increased and decreased mental health in adulthood can teach you some great coping skills.
Later Life Transitions - Ken Laidlaw
Some more optimistic findings from research about ageing across the world. Talk given by Ken Laidlaw, Consultant Clinical Psychologist, NHS Lothian. Edinburgh City Chambers, 29th January 2009.
From Struggle to Strength: Nurturing Freedom Through the Journey of Seeking H...
Empower your journey with 'From Struggle to Strength' by Solh Wellness, exploring growth and freedom through seeking help.
Similar to Social support plays a critical role in successful aging. Is this tr.pdf (19)
Impact of Mental Health Disorders and Treatment Support
Impact of Mental Health Disorders and Treatment Support
module1growinghealthy-120702172656-phpapp0211234.ppt
module1growinghealthy-120702172656-phpapp0211234.ppt
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human DevelopmentApproaches and Theories
1 Understanding Human DevelopmentApproaches and Theories
Increased and decreased mental health in adulthood
Increased and decreased mental health in adulthood
From Struggle to Strength: Nurturing Freedom Through the Journey of Seeking H...
From Struggle to Strength: Nurturing Freedom Through the Journey of Seeking H...
More from arihanthtextiles
I need help writing the methods for the song and playList class in J.pdf
I need help writing the methods for the song and playList class in Java. I already have the
interface and the getters and setter. Can someone help with the methods?
Song Class
public class Song
private String artist // the artist performing the song
private String title // the title of the song
private int minutes // number of min in length
private int seconds // number of seconds of length of the song (always less than 60)
// Add Getters / Setters for all fields
// Three constructors (remember to initialize ALL fields in each of the constructors - regardless
of the number of parameters!)
public Song(String artist, String title)
public Song(String artist, String title, int minutes, int seconds)
public Song(Song s)
public boolean equals(Object o) // a song is equal if all four fields are equal
public String toString() { // Use this code for toString EXACTLY
return \"{Song: title = \" + title + \" artist = \" + artist + \"}\";
}
public void play() { // Use this code for play EXACTLY
System.out.printf(\"Playing Song: artist = %-20s title = %s\ \", artist, title);
}
Make the Song class implement the interface Comparable, and make the ordering criteria as
follows: Songs will be ordered by artist in ascending order. If the artists are the same, then by
title in ascending order. If both artist and title are the same, then any order is acceptable.
Don’t forget to include any methods needed to implement the Playable interface.
PlayList Class
public class PlayList
Methods that modify the list should return a boolean return true if they successfully change the
list, otherwise they return false. Note that a PlayList can contain other PlayLists!
Methods that return a Playable element return null if they fail to find the song in question.
private String name // contains the name of the playlist
private ArrayList playableList // ArrayList of Playable elements that make up the play list
// Add Getters / Setters for name and songList
// Add a toString() method that returns the name of the playlist followed by its contents (by
calling toString() on each item it contains). You should only have one name/title per line
// Two constructors (remember to initialize ALL fields in each of the constructors - regardless of
the number of parameters!)
public PlayList() // empty play list named \"Untitled\"
public PlayList(String newName) // empty play list
public boolean loadSongs(String fileName) // loads songs from file, more on this below
public boolean clear() // removes all playable elements in the play list
public boolean addSong(Song s) // adds Song s to the end of the play list
public Playable removePlayable(int index) // removes Playable element at index from the list and
returns it
public Playable removePlayable(Playable p) // removes every occurrence of Playable p from the
list and returns p
public Playable getPlayable(int index) // returns the Playable element at the appropriate index
public boolean addPlayList(PlayList pl) //adds the PlayList that is being pa.
How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdf
How do autopolyploidy and allopolyploidy differ? Only autopolyploidy involves an increase in
chromosome sets. The chromosomes of an autopolyploid individual come from the same
species, while an allopolyploid has sets of chromosomes from different species. Autopolyploidy
is a mechanism of speciation in plants, while allopolyploid is a mechanism of speciation animals.
Autopolyploidy is sympatric, while allopolyploidy is allopatric.
Solution
Answer:
b). The chromosomes of an autopolyploid individual come from the same species, while an
allopolyploid has sets of chromsomes from different species
Autopolyploidy arises from fusion of gametes of the same species (cell division errors, etc.). In
this process, polyploid individuals develop as a result of cell division errors that double the DNA
content of gametes in individuals from the same species or a self-fertilizing individual. When
these double-dose gametes fuse, the result is an organism with double the chromosome number
of its parent species.
Allopolyploidy occurs when the gametes from two species fuse to form a polyploid generation
and hybrid offspring..
How do you find the order of growth for the following recurrenceT.pdf
How do you find the order of growth for the following recurrence?
T(n) = 9T(n/3) + n2
Solution
The Master Theorem applies to recurrences of the following form:
T (n) = aT (n/b) + f (n)
where a 1 and b > 1 are constants and f (n) is an asymptotically positive function.
There are 3 cases:
Case First:-- f(n) is O(nlogba ). Since the leaves grow faster than f, all work is done at the
leaves, so T(n) is (nlogb a).
Case Second:-- f(n) is (nlogba). The leaves grow at same rate as f, so the same order of work is
done at every level of tree. Therfore tree has O(log n) levels times the work done on one level,
yielding T(n) is (nlogb a log n).
Case Third:-- f(n) is (nlogba + ). Here f grows faster than the number of leaves, which means that
asymptotically the total amount of work is dominated by the work done at the root node. For the
upper bound, we also need an extra smoothness condition on f in this case i.e af(n/b) cf(n) for
some constant c < 1 and large n. In this case T(n) is (f(n)).
Therefore, using Master Method on your above Question
a=9, b=3, =log39 = 2, f(n) = n2, so Case 2, i.e. T(n) = (nlogn) = (n2logn)..
Explain SEAD, SAR and SPAAR routing protocols in more details.So.pdf
Explain SEAD, SAR and SPAAR routing protocols in more details.
Solution
SEAD Protocols: SEAD is a proactive secure routing protocol based on DSDV-SQ-protocol. It
does not rely on asymmetric encryption primitive but instead it relies on one-way hash chain for
security. The algorithm expects that there is some authenticated and secure way to deliver the
initial key KN. This could be done by key delivery in advance or by using public key encryption
and signatures for key delivery. The basic idea of SEAD is, to authenticate the sequence number
and metric of a routing table update message using hash chains elements. In addition, the
receiver also authenticates the sender ensuring that the routing information originates from the
correct node. The source of each routing update message in SEAD must also be authenticated
since an attacker may be able to create routing loops through the impersonation attack. There are
two different approaches proposed such as broadcast authentication mechanism, TESLA and
Message Authentication Codes
SAR routing protocols: SAR takes an approach to routing that incorporates security level of
nodes into traditional routing metrics. In most protocols the length of the route is the only metric
used. It does not target any protocol, but it rather provides security at a more generalized level of
security. The goal is exposing security to the application and to the routing protocol. SAR uses
AODV or DSR as a base protocol; it embeds the security metric into RREQ packet itself and
changes the forwarding behavior of the protocol. When intermediate nodes receive an RREQ
packet with a particular security metric or trust level, the node can only process the packet or
forward it if it can provide the required security or trust level.
SPAAR routing protocols: The SPAAR protocol was developed with the classical managed-
hostile environment in mind, thus meant to provide a very high level of security, and sometimes
at the cost of performance. Among other things, SPAAR also requires that each device to use a
GPS locator to determine its position, although some leeway is given to nodes using a so-called
“locator-proxy” if absolute security is not required. In SPAAR packets are only accepted
between neighboring nodes one hop away from each other, this is to avoid the “invisible node-
attack”. The basic transmission procedure is quite similar to ARAN, although the group
neighborhood key is used for encryption in order to ensure one-hop communication only. Since
all nodes also have information on their location they only forward RREQs if their position is
closer to the destination position.
Dynamic routing protocols are used toa) establish paths real ti.pdf
Dynamic routing protocols are used to:
a) establish path\'s real time between routers
b) define overhead bits within the packet
c) encapsulate the IP packet into a Layer 2 frame
d) reroute traffic during circuit failures and network congestion
e) a and b
f) a, c, and d
g) all of the above
Solution
a,c,d.
Evaluate expression without a calculator. Write answer in radians..pdf
Evaluate expression without a calculator. Write answer in radians.
Please show step by step so I can check my work. My answer -pi/6
Solution
sin^-1(-1/2) =y
range of sin^-1(x) : -pi/2<=y<=pi/2
So, value of y would be less than pi/2and its is -ve so it should be between -pi/2 and 0
y = sin^-1(-1/2)
siny = -1/2
y = -pi/6 radians.
Epithelial tissues that are only one cell thick are called _____ Epi.pdf
Epithelial tissues that are only one cell thick are called _____ Epithelial tissues that are more
than one cell thick are called _____ Of these two basic types of epithelial tissues, which is most
likely better at transport of substances? What structural aspect of this tissue makes it good at
doing this? What is the major function of the other basic type of epithelial tissue? What
structural aspect of this tissue makes It good at doing this? If the cells in an epithelial tissue are
wider than they are tall, they are called _____ cells. If the cells in an epithelial tissue are taller
than they are wide, they are called _____ cells. If the cells In an epithelial tissue are as wide as
they are tall, they are called _____ cells. Of these three types of cell shapes found In epithelial
tissues, which one is best at allowing for simple diffusion? What structural aspect of this tissue
makes it good at doing this? Of these three types of cell shapes found in epithelial tissues, which
ate best at allowing for active transport processes? What structural aspect of this tissue makes it
good at doing this? What type of cell-surface characteristic helps an epithelial tissue reduce
friction? What type of cell-surface characteristic helps an epithelial tissue in absorption and/or
secretion? What type of cell-surface characteristic helps an epithelial tissue allows it to move
particles across its surface?
Solution
- epithelium cells that are only one cell thick are known as simple epithelial tissues
- epithelium cells that are more than one cell thickness are known as stratified epithelial tissue
- simple epithelial tissue is good at transport of substances
- epithelial tissue consists of basement membrane on which it rests. this membrane acts as a
scaffold. through this membrane ther is nerve supply as this membrane is permeable hence it
allows the transport of substances
-the major function of stratified epithelial tisue is protection of the cells
-epithelial tissues acts as a lining surface to the body organs
-.
Describe in five sentences how the TLR system is used to fight HSV-1 .pdf
Describe in five sentences how the TLR system is used to fight HSV-1 encephalitis.
Solution
Toll like receptors are one type of PRRs, which are associate in the recognition of pathogen,
associated molecular patterns. These receptors are initially identified in Drosophila, they are also
found in macrophages, mast cells, dendritic cells in mammals. Toll-like receptors trigger the
production and release of cytokines and also activate other host defense responses associated
with innate and adaptive immune response. In response to HSV -1 (herpes simplex virus 1), the
TLR-2 releases cytokines that cause severe inflammatory response (innate immune response),
which leads to encephalitis. Antagonism of these receptors is likely to provide protection against
encephalitis caused by HSV-1. The TLR-2 are mainly located on the surface of microglia and
astrocytes..
Daunte is frustrated about managements recent decision to merge hi.pdf
Daunte is frustrated about management\'s recent decision to merge his two teams into one. He
discusses this issue with Claire, a so-worker. Claire responds by saying, \"Its sounds like
management\'s decision really bothers you.\" In the context of listening skills, Clarire\'s
statement best exemplifies a (n) sarcastic tone that blocks responses. (b) active response that
mirrors feelings (c) active response that advises the speaker. (d) blocking response that criticies
the speaker (e) negative response that magnifies the problem.
Solution
(b) active response that mirrors feelings.
Concern over the weather associated with El Nino has increased intere.pdf
Concern over the weather associated with El Nino has increased interest in the possibility that
the climate on earth is getting warmer. The most common theory relates an increase in
atmospheric levels of carbon dioxide (CO_2), a greenhouse gas, to increases in temperature. A
regression analysis of the mean annual CO_2 concentration (in parts per million) in the
atmosphere at the top of Mauna Loa in Hawaii and the mean annual air temperature (in degrees
Celsius) over both land and sea across the globe for 37 years was performed. Assume all
conditions are met for simple linear regression inference. A hypothesis test is to be performed to
determine if CO_2 levels is a significant predictor of air temperature. What is the correct
conclusion based on the results of the hypothesis test? Choose the correct answer below.
Solution
Here, the t statistic is
t = B1 / sB1
here, B1 = 0.004, sB1 = 0.009.
Thus,
t = 4.444444444
For a 0.001 level, the critical t value is, as df = n - 1 = 36,
tcrit= 3.582149701
Thus, as t > 3.5821, then it is OPTION D. [ANSWER].
Clostridium difficile is a bacteria currently making headlines. It h.pdf
Clostridium difficile is a bacteria currently making headlines. It has long been the considered the
most common health-care associated infection, causing death to a large number of patients when
they contract it during hospital stays. The CDC is now reporting an increase in C. difficile cases
even outside of hospitals, which is raising concern. Below is an electron micrograph of C.
difficile. If you were able to do a Gram stain on a sample of the bacteria, you would find that the
cells stain a dark purple.
Given this information, how would you classify C. difficile?
A.
Gram negative, rod shaped
B.
Gram positive, coccus shaped
C.
Gram negative, coccus shaped
D.
Gram positive, rod shaped
Many protists have evolved complex life cycles that include sexual reproduction. This means
that:
A.
haploid cells must undergo meiotic divisions to form gametes.
B.
complex mating behavior likely evolved at the same time as sexual reproduction.
C.
genetic material from two haploid cells is combined at some point in the life cycle.
D.
diploid cells must undergo mitotic cell division in order to reproduce.
Protists:
A.
are all eukaryotes.
B.
are all heterotrophs.
C.
are all photosynthetic.
D.
are all single-celled.
E.
All of the above are correct.
All of the following are examples of the evidence that supports the endosymbiotic theory
EXCEPT:
A.
Mitochondria and chloroplasts have their own genomes.
B.
Mitochondria and chloroplasts divide in a process resembling binary fission.
C.
Mitochondria and chloroplasts are similar in size to bacteria.
D.
Mitochondria and chloroplasts have linear chromosomes.
Solution
Clostridium difficle is a Gram positive, rod shaped bacteria.(option-D) Many protists have
evolved complex sexual reproductive life cycles which includes haploid cells undergo meiotic
division to form gametes. Protists are all eukaryotes, not an animal, plant or fungus. The point
\"mitochondria and chloroplaats have linear chromosomes\" is not an evidence that supports for
endosymbiotic theory..
You cloned an EcoRI digested DNA fragment into a unique EcoRI site o.pdf
You cloned an EcoRI digested DNA fragment into a unique EcoRI site of a vector. You identify
a recombinant vector that you believe has the DNA of interest. To generate a restriction map of
the recombinant plasmid, you take three individual samples of the plasmid and digest them with
EcoRI, HindIII, and with both EcoRI and HindIII. You then run the digested DNA on an
agarose
gel to see the fragments. The gel is then subjected to a Southern hybridization using the EcoRI
insert as a probe. Assume that the insert fragment is smaller than the vector.
15. Which fragment (s) on the gel would hybridize to the probe which represents the inert?
16. Which fragment (s) on the gel would hybridize to a probe representing the 5.3 kb band
observed in the EcoRI lane?
17. Which fragment (s) in the EcoRI lane would hybridize to a probe representing the 4.1 kb
band observed in the HindIII lane?
18. The cloning strategy used being non-directional, the recombinant plasmid may represent one
of two possible orientations of the insert. You perform a hybridization with the 1.5 kb band
observed in the EcoRI lane. Which fragment (s) would not be observed in the opposite
orientation of that represented on the gel?
PLEASE EXPLAIN THOUGHT PROCESS 5.3 4.1 2.7 1.5 EcoRI HindIII EcoRI Hind 3.0 2.3
1.1 0.4
Solution
The band of HINDIII (2.7) and the band of EcoRI+HINDIII (2.3) represent the fragments that
will hybridize to 5.3kb band probe.
The band of EcoRI+HINDIII (3.0) and the band of EcoRI (1.5) represent the fragments that will
hybridize to 4.1kb band probe.
The fragments which will mot be observed in opposite direction are the ones which are dual
enzyme digested. The reason behind this is that when dual enzyme digestion occurs it causes an
incompatible recognition sequence in the opposite direction. Therefore such fragments are found
in the middle of two individual enzyme digestions..
You have constructed a new reporter gene to help you find novel zebr.pdf
You have constructed a new reporter gene to help you find novel zebrafish mutations. The
reporter gene consists of several LEG/TCF binding domains in the enhancer fused to the coding
region for green fluorescent protein (GFP). Wild-type embryos that contain this transgene
normally express it in the brain and eye primordia and have no developmental defects. You then
mutagenize this reporter strain to look for new mutants that affect GFP expression.
Which developmental pathway are these mutants likely to be in and why?
You find a mutant (which you call GLO-1) that ubiquitously expresses your reporter gene
throughout the entire embryo. Which molecule in the above pathway is most likely to be mutated
and why?
Solution
Ans.) Nacre, a zebrafish homolog of MITF is required for pigment cell differentiation. We
isolated a promoter region of shell that contains Tcf/Lef binding sites which will mediate Wnt
responsiveness. This promoter binds to zebrafish Lef1 protein in vitro, and a nacre
communicator construct is powerfully inhibited by dominant-negative Tcf in malignant
melanoma cells. Mutation of Tcf/Lef sites abolishes Lef1 binding and reporter operates in vivo.
Wnt signaling so directly activates shell, which in flip ends up in pigment cell differentiation.
It was determined that the human melanocyte-specific MITF promoter contains many purported
Tcf/Lef binding sites, hallmarks of Wnt/-catenin-mediated transcriptional control. To test the
hypothesis that nacre could be a target of the Wnt/-catenin pathway in zebrafish, a
promoter/enhancer region is isolated for this sequence from a genomic bacteriophage library.
This genomic fragment contains the translation initiation site for nacre which is associated with a
836-bp upstream region with a possible transcription begin site, a cAMP response element
(CRE) and several agreement Tcf/Lef binding sites. These CRE and Tcf/Lef locations are not
fully preserved between the human and zebrafish promoters in either their sequences or their
positions from the transcription begin site. To examine whether the purported putative nacre
promoter/enhancer will direct correct abstraction management of organic phenomenon, injected
one -cell zebrafish embryos with the 836-bp deoxyribonucleic acid fragment driving a green
fluorescent macromolecule (GFP) communicator sequence. Mosaic gene expression is typical for
transient transgenics in zebrafish and because the neural crest springs from only a few precursor
cells, reporter potency is minimized. Despite these, it was ready to analyze the fate of the few
reporter-expressing cells in injected animals..
Write a Java program that will incorporate either a sequential searc.pdf
Write a Java program that will incorporate either a sequential search method or a sort method
Solution
class Search
{
public static void main(String args[])
{ int array[],n;
System.out.println(\"Please enter the sixe of array\");
Scanner s = new Scanner(System.in);
int n = s.nextInt();
System.out.println(\"Please enter\"+ n +\"elements of array\");
for(int i= 0;i.
Answer only with excel instructions.Assume that 96 of ticket hold.pdf
Answer only with excel instructions.
Assume that 96% of ticket holders show up for an airline flight. If a plane seats 200 people, how
many tickets should be sold to make the chance of an overbooked flight (more ticket holders
show up for a flight than there are seats available) is at most 10%.
Solution
Say no. of tickets booked = x
Now only 0.96x will turn up
No. of seats = 200
Now these 0.96x people should get a seat with 90% probability
200 / (0.96x) >=0.9
200/0.864 >= x
x <=231.48
x = 231
Airline will make 231 reservations.
A new species of sea horse has been discovered and is being sequenced.pdf
A new species of sea horse has been discovered and is being sequenced The genome of the new
species is being aligned using the reference sequence from a already-known species of sea horse
Since the two species are evolutionary diverged, there may be some differences between their
sequences Reference sequence: ACCTACATTCACAGAATGAT Fragments a) Align the set
of mini-fragments above. b) How are the sequences of the two sea horse species different? c)
Would this alignment have been easier or more difficult if you didn\'t have any reference
sequence at all (alignment without a reference is called \"de novo\")? Explain d) If there had
been sequencing errors, would this alignment have been easier or more difficult? Explain.
Solution
A) TAGATT TGAATG TCACTGA
B) There is a form of polymorphism occurring in the new sequence of the genes for the new
species of sea horses. There is single nucleotide polymorphism in the new species as C is
replaced by T and A instead of G which may probably occurred due to some sort of mutation
during genetic sequencing.
C) The given alignment would be difficult without reference DNA sequence as reference
sequence gives basic DNA information and a reference database techniques is much easier than
performing a de novo technique though de novo methods are well established using mass spectra
nowadays but still having a reference database helps and gives the better coding information of
protein sequence.
D) if there had been a sequence error there would be difficulty in alignment and in that case we
have to perform de novo sequencing using mass spectra analysis. To know the sequence of the
species and other information regarding the DNA characters..
Which of the following is the mechanism of action for Herceptin Her.pdf
Which of the following is the mechanism of action for Herceptin? Herceptin binds to the HER2
promoter to prevent transcription, thus lowering amounts of receptor. Herceptin binds to
intracellular HER2 proteins to prevent cancer cells from dividing. Herceptin binds to HER3 and
HER4 cell surface receptors to activate the immune system. Herceptin binds to extracellular
domain of HER2 and prevents internalization and subsequent cancer cell division. Herceptin
targets TNF alpha.
Solution
B) herceptin binds to intracellular ER2 proteins to prevent cancer cells from dividing
Trastuzumab (herceptin) activates p27 factor by inhibiting PI3K/Akt, Mirk and hKIS pathways.
HER2 protein can be expressed up to 100 times more in cancer cells. PI3K/Akt, Mirk and hKIS
are intracellular proteins in HER2 pathways are activated which promote cell proliferation.
Signals present in these pathways promote growth of blood vessels in order to supplement for
tumour formation or angiogenesis and therefore resulting in cell proliferation. Thus, when
herceptin inhibits PI3K/Akt, Mirk and hKIS pathways, the cell proliferation is inhibited..
Which of these statements best describes an element An element is c.pdf
Which of these statements best describes an element? An element is composed of three
subatomic particles. An element is formed when two atoms of the same kind are bonded
together. An element is formed when two or more different atoms combine chemically. An
element is composed of identical atoms.
Solution
An element is composed of identical atoms.
Molecules can be made of elements, but elements arent made from molecules. 2 or more atoms
of the same kind make up an element.For example H is hydrogen which is an element formed
from H atoms only whereas H2O is a compount formed from 2 different atoms H and O..
What is the general goal for descriptive statistics How is the goal.pdf
What is the general goal for descriptive statistics? How is the goal served by putting scores in a
frequency distribution? How is the goal served by computing a measure of central tendency?
How is the goal served by computing a measure of variability?
Solution
What is the general goal of descriptive statistics ?
Answer : To simplify , organize, and summarize data so that it is easier for researchers to see
patterns.
How is the goal served by putting scores in a frequency distribution?
A frequncy distribution provides an organized summary of the complete set of scores.
How is the goal served by computing a measure of central tendency?
Summarizes an entires set of scores with a single value that is representative of the whole set.
How is the goal served by computing a measure of variability?
Provides a single number that describes the differences that exist from complete score to another..
What effects are shown on this graph (assume that all effects where.pdf
What effects are shown on this graph? (assume that all effects where the marginal means differ
are significant)
Choose as many as applicable.
A. Main effect of A where scores are higher at A1 than A2
B. Main effect of A where scores are higher at A2 than A1
C, Main effect of B where scores are higher at B1 than B2
D, Main effect of B where scores are higher at B2 than B1
E. Interaction where the effect of A is larger at B1 than B2
F. Interaction where the effect of A is larger at B2 than B1
Solution.
More from arihanthtextiles (20)
I need help writing the methods for the song and playList class in J.pdf
I need help writing the methods for the song and playList class in J.pdf
How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdf
How do autopolyploidy and allopolyploidy differ Only autopolyploidy.pdf
How do you find the order of growth for the following recurrenceT.pdf
How do you find the order of growth for the following recurrenceT.pdf
Explain SEAD, SAR and SPAAR routing protocols in more details.So.pdf
Explain SEAD, SAR and SPAAR routing protocols in more details.So.pdf
Dynamic routing protocols are used toa) establish paths real ti.pdf
Dynamic routing protocols are used toa) establish paths real ti.pdf
Evaluate expression without a calculator. Write answer in radians..pdf
Evaluate expression without a calculator. Write answer in radians..pdf
Epithelial tissues that are only one cell thick are called _____ Epi.pdf
Epithelial tissues that are only one cell thick are called _____ Epi.pdf
Describe in five sentences how the TLR system is used to fight HSV-1 .pdf
Describe in five sentences how the TLR system is used to fight HSV-1 .pdf
Daunte is frustrated about managements recent decision to merge hi.pdf
Daunte is frustrated about managements recent decision to merge hi.pdf
Concern over the weather associated with El Nino has increased intere.pdf
Concern over the weather associated with El Nino has increased intere.pdf
Clostridium difficile is a bacteria currently making headlines. It h.pdf
Clostridium difficile is a bacteria currently making headlines. It h.pdf
You cloned an EcoRI digested DNA fragment into a unique EcoRI site o.pdf
You cloned an EcoRI digested DNA fragment into a unique EcoRI site o.pdf
You have constructed a new reporter gene to help you find novel zebr.pdf
You have constructed a new reporter gene to help you find novel zebr.pdf
Write a Java program that will incorporate either a sequential searc.pdf
Write a Java program that will incorporate either a sequential searc.pdf
Answer only with excel instructions.Assume that 96 of ticket hold.pdf
Answer only with excel instructions.Assume that 96 of ticket hold.pdf
A new species of sea horse has been discovered and is being sequenced.pdf
A new species of sea horse has been discovered and is being sequenced.pdf
Which of the following is the mechanism of action for Herceptin Her.pdf
Which of the following is the mechanism of action for Herceptin Her.pdf
Which of these statements best describes an element An element is c.pdf
Which of these statements best describes an element An element is c.pdf
What is the general goal for descriptive statistics How is the goal.pdf
What is the general goal for descriptive statistics How is the goal.pdf
What effects are shown on this graph (assume that all effects where.pdf
What effects are shown on this graph (assume that all effects where.pdf
Recently uploaded
Overview on Edible Vaccine: Pros & Cons with Mechanism
This ppt include the description of the edible vaccine i.e. a new concept over the traditional vaccine administered by injection.
2024.06.01 Introducing a competency framework for languag learning materials ...
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
Unit 8 - Information and Communication Technology (Paper I).pdf
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
Biological Screening of Herbal Drugs in detailed.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar KanvariaBest Digital Marketing Institute In NOIDA
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...Nguyen Thanh Tu Collection
https://app.box.com/s/hqnndn05v4q5a4k4jd597rkdbda0fniiThesis Statement for students diagnonsed withADHD.ppt
Presentation required for the master in Education.
Synthetic Fiber Construction in lab .pptx
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Digital Artifact 1 - 10VCD Environments Unit
Digital Artifact 1 - 10VCD Environments Unit - NGV Pavilion Concept Design
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptxMohd Adib Abd Muin, Senior Lecturer at Universiti Utara Malaysia
This slide is prepared for master's students (MIFB & MIBS) UUM. May it be useful to all.The Challenger.pdf DNHS Official Publication
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Recently uploaded (20)
Overview on Edible Vaccine: Pros & Cons with Mechanism
Overview on Edible Vaccine: Pros & Cons with Mechanism
2024.06.01 Introducing a competency framework for languag learning materials ...
2024.06.01 Introducing a competency framework for languag learning materials ...
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Executive Directors Chat Leveraging AI for Diversity, Equity, and Inclusion
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...
Thesis Statement for students diagnonsed withADHD.ppt
Thesis Statement for students diagnonsed withADHD.ppt
Multithreading_in_C++ - std::thread, race condition
Multithreading_in_C++ - std::thread, race condition
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptx
Pride Month Slides 2024 David Douglas School District
Pride Month Slides 2024 David Douglas School District
Social support plays a critical role in successful aging. Is this tr.pdf
- 1. Social support plays a critical role in successful aging. Is this true or false? Why? Solution Social support plays a critical role in successful aging. The statement is true. Aging refers to the process of becoming older over a period of time.This includes the changes in physical , psychological and social changes.At any stage of life social support play a crucial role in the success of a person this is even more true in case of older adults.with the advancement of age there are several changes that occur in the life which include changes in the job status, a person may retire and yet may have family financial commitments to be fulfilled,the children would have grown up and for their future they might have left the parents for their life settlements , deterioration of physical health, financial status ,empty nest syndrome, felling isolated and left out all these may also lead to psychological depression. A positive approach to life is a very important factor in the process of aging. in older adults the body immune system becomes fragile , resources for support become depleted and such other causes will have an effect in the process of aging.Psychological well being is an indication of successful adaptation to old age . Acceptance to change as a part of life provides strength in overcoming several psychological problems and studies have indicated that adults who are active are more likely to be successful in their old age than those who expect a leisurely and lazy dependent life as this tend to negative interactions with the family mainly. As people age remaining socially active provides a positive health benefits to the aged people. Successful connectedness,isolation, mobility, spirituality all have a say in dealing with the geriatric problems.one can adapt themselves to the age by being socially active .Voulenteering is a notable factor in relation to social support for adults.It helps in building companionship and interact with more people of the community.They can engage themselves in spiritual activities , develop more realistic goals ,opportunities for self discovery. Physical health plays a very important role in successful aging,with the advancement of age .social support in terms of maintaining day to day affairs also plays a crucial role and studies have suggested that it also helps in enhanced well being , less depression and often provides a senses of meaning to life. To conclude aging is a general process and acceptance with grace provides the main solution for successful aging and the social support either monetary, physical or psychological all play a very important role in helping the elderly people in the late years of their life.