Protein synthesis - codons – Triplet base nucleotides that carry a single specific amino acid.
Our genes control protein synthesis. Every protein is a sequence of amino acids linked together in a particular order . How the amino acids are joined
together is controlled be the pairing of the triplet bases with the corresponding triplets on a gene. Genes provide the code for building proteins from
amino acids. All proteins are made of about 20 amino acids arranged in particular orders.



TTT                  GTA                    the letters represent the triplet code

                                             The shape represents the amino acid


GENE code sequence
Below represents a sequence of bases of a gene (from part of a chromosome) that synthesises a particular enzyme protein. The chromosome had opened
to expose the base nucleotides A T G C – these have been copied (mRNA) then the copied gene is taken into the cytoplasm where a ‘ribosome’ is used to
build the protein. Use the triplet base codons with the attached amino acids to construct the protein. Cut out and stick the triplet codes with amino acid
onto the gene below. Begin a ATA.




ATAATATTGTTACAGCTCCTCGGTATCCTGCGGGTG
Below is a series of base triplets with the amino acid shape attached – cut them out close to the letters and then arrange and stick
them to the gene code sequence.


TTA                              AAT                                    GTC                              GAG



CCA                              AGA                                    CAC                              AAC



TAG                              GAC                                    TAT                              GCC
TTA   AAT   GTC   GAG



CCA   AGA   CAC   AAC



TAG   GAC   TAT   GCC

ScienceShare.co.uk Shared Resource

  • 1.
    Protein synthesis -codons – Triplet base nucleotides that carry a single specific amino acid. Our genes control protein synthesis. Every protein is a sequence of amino acids linked together in a particular order . How the amino acids are joined together is controlled be the pairing of the triplet bases with the corresponding triplets on a gene. Genes provide the code for building proteins from amino acids. All proteins are made of about 20 amino acids arranged in particular orders. TTT GTA the letters represent the triplet code The shape represents the amino acid GENE code sequence Below represents a sequence of bases of a gene (from part of a chromosome) that synthesises a particular enzyme protein. The chromosome had opened to expose the base nucleotides A T G C – these have been copied (mRNA) then the copied gene is taken into the cytoplasm where a ‘ribosome’ is used to build the protein. Use the triplet base codons with the attached amino acids to construct the protein. Cut out and stick the triplet codes with amino acid onto the gene below. Begin a ATA. ATAATATTGTTACAGCTCCTCGGTATCCTGCGGGTG
  • 2.
    Below is aseries of base triplets with the amino acid shape attached – cut them out close to the letters and then arrange and stick them to the gene code sequence. TTA AAT GTC GAG CCA AGA CAC AAC TAG GAC TAT GCC
  • 3.
    TTA AAT GTC GAG CCA AGA CAC AAC TAG GAC TAT GCC