SlideShare a Scribd company logo
Co-opting the Genetic
Code
DNA Binary Encoding Protocol
Amit Snyderman, ITP Design Frontiers, 2010
Genetic Code
The genetic code is the set of rules by which
information encoded in genetic material is translated
into proteins by living cells.
DNA
Deoxyribonucleic acid (DNA) contains the genetic
instructions used in the development and functioning
of all known living organisms. The main role of DNA
molecules is the long-term storage of information.
Units of the Code
Adenosine (A)
Cytosine (C)
Guanine (G)
Thymine (T)
Codons
Mapping between nucleotide triplets and amino acids
43 combinations = 64 possible codons

http://upload.wikimedia.org/wikipedia/en/d/d6/GeneticCode21-
version-2.svg
Amino Acids
20 amino acids

Just as the letters of the alphabet can be combined to
form an almost endless variety of words, amino acids
can be linked together in varying sequences to form a
vast variety of proteins.

http://upload.wikimedia.org/wikipedia/commons/3/37/Aa.svg
Proteins
Every protein is chemically defined by its unique
sequence of amino acid residues, which in turn define
the three-dimensional structure of the protein.
MIME Base64
Encoding scheme that encodes binary data by treating
it numerically and translating it into a base 64
representation.
      TEXT              M         a         n
     ASCII              77        97       110
   BIT PATTERN    010011010110000101101110
     INDEX          19       22        5        46
 BASE64-ENCODED     T        W         F        u
Remap
Rather than mapping to a character, map to a codon.
VALUE   CHARACTE   CODON     AMINO ACID      VALUE   CHARACTE   CODON    AMINO ACID     VALUE   CHARACTE   CODON     AMINO ACID
           R                                            R                                          R
 0         A       AAA       Lysine (K)       22        W       CCG      Proline (P)     43        r       GGT       Glycine (G)

 1         B       AAC     Asparagine (N)     23        X       CCT      Proline (P)     44        s       GTA       Valine (V)

 2         C       AAG       Lysine (K)       24        Y       CGA     Arginine (R)     45        t       GTC       Valine (V)

 3         D       AAT     Asparagine (N)     25        Z       CGC     Arginine (R)     46        u       GTG       Valine (V)

 4         E       ACA     Threonine (T)      26        a       CGG     Arginine (R)     47        v       GTT       Valine (V)

 5         F       ACC     Threonine (T)      27        b       CGT     Arginine (R)     48        w       TAA         STOP

 6         G       ACG     Threonine (T)      28        c       CTA      Leucine (L)     49        x       TAC      Tyrosine (Y)

 7         H       ACT     Threonine (T)      29        d       CTC      Leucine (L)     50        y       TAG         STOP

 8         I       AGA      Arginine (R)      30        e       CTG      Leucine (L)     51        z       TAT      Tyrosine (Y)

 9         J       AGC       Serine (S)       31        f       CTT      Leucine (L)     52        0       TCA       Serine (S)

 10        K       AGG      Arginine (R)      32        g       GAA     Glutamate (E)    53        1       TCC       Serine (S)

 11        L       AGT       Serine (S)       33        h       GAC     Aspartate (D)    54        2       TCG       Serine (S)

 12        M       ATA      Isoleucine (I)    34        i       GAG     Glutamate (E)    55        3       TCT       Serine (S)

 13        N       ATC      Isoleucine (I)    35        j       GAT     Aspartate (D)    56        4       TGA         STOP

 14        O       ATG     Methionine (M)     36        k       GCA      Alanine (A)     57        5       TGC       Cystine (C)

 15        P       ATT      Isoleucine (I)    37        l       GCC      Alanine (A)     58        6       TGG     Tryptophan (W)

 16        Q       CAA     Glutamine (Q)      38        m       GCG      Alanine (A)     59        7       TGT       Cystine (C)

 17        R       CAC      Histidine (H)     39        n       GCT      Alanine (A)     60        8       TTA       Leucine (L)

 18        S       CAG     Glutamine (Q)      40        o       GGA      Glycine (G)     61        9       TTC     Phenylalanine
                                                                                                                        (F)
 19        T       CAT      Histidine (H)     41        p       GGC      Glycine (G)     62        +       TTG      Leucine (L)

 20        U       CCA       Proline (P)      42        q       GGG      Glycine (G)     63        /       TTT     Phenylalanine
                                                                                                                        (F)
 21        V       CCC       Proline (P)
Example: Hello,
world!
    BASE64       SGVsbG8sIHdvcmxkIQo=
  BASE64 INDEX   18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 8 16 40
     DNA         CAGACGCCCGTACGTACGTTAGTAAGAACTCTCGTTCTAGCGTACGCAAG
                 ACAAGGA
    PROTEIN      QTPVRTLVRTLVLAYARQG


Any binary data can be represented: text (unicode),
bitmap, audio, video, etc.
Try It: http://amitsnyderman.com/school/designfrontiers/
encoder.php
Disk is cheap.
Who cares?
Non-Digital Library
Via recombinant DNA technologies, craft a portable,
reproducible, time-resistant library. Embed, grow and
spread in bacteria. Package as a pill. Organic time
capsule.
Spime
"The key to the Spime is identity. A Spime is, by
definition, the protagonist of a documented process. It
is an historical entity with an accessible, precise
trajectory through space and time."
                           –Bruce Sterling, Shaping Things
Spime Ingredients
Unique ID code
History of ownership
Geographical position
Customization details
Public discourse
Etc.
Human
Identification
Tools, artifacts, archeology
Bone structure, teeth, dental records, fingerprints, DNA
Yellowpages, resume, Facebook/LinkedIn/etc, Google
Narrative
Embedded Histories. Family trees and Lineage. Stories.
Junk DNA
Noncoding DNA describes sequences that do not
encode for protein sequences. Much of this DNA has no
known biological function and is sometimes referred to
as "junk DNA".

More than 98% of the human genome is non-coding.
Human Spime
Recycle junk DNA by recombining encoded messages
into non-coding DNA regions.
In-vitro manipulation. Gene therapy.
Hereditary storytelling.

More Related Content

Recently uploaded

Skybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoptionSkybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoption
Tatiana Kojar
 
"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota
Fwdays
 
Mutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented ChatbotsMutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented Chatbots
Pablo Gómez Abajo
 
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
saastr
 
Introduction of Cybersecurity with OSS at Code Europe 2024
Introduction of Cybersecurity with OSS  at Code Europe 2024Introduction of Cybersecurity with OSS  at Code Europe 2024
Introduction of Cybersecurity with OSS at Code Europe 2024
Hiroshi SHIBATA
 
Christine's Supplier Sourcing Presentaion.pptx
Christine's Supplier Sourcing Presentaion.pptxChristine's Supplier Sourcing Presentaion.pptx
Christine's Supplier Sourcing Presentaion.pptx
christinelarrosa
 
Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...
Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...
Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...
Pitangent Analytics & Technology Solutions Pvt. Ltd
 
Taking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdfTaking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdf
ssuserfac0301
 
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge GraphGraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
Neo4j
 
Demystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through StorytellingDemystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through Storytelling
Enterprise Knowledge
 
PRODUCT LISTING OPTIMIZATION PRESENTATION.pptx
PRODUCT LISTING OPTIMIZATION PRESENTATION.pptxPRODUCT LISTING OPTIMIZATION PRESENTATION.pptx
PRODUCT LISTING OPTIMIZATION PRESENTATION.pptx
christinelarrosa
 
Apps Break Data
Apps Break DataApps Break Data
Apps Break Data
Ivo Velitchkov
 
Main news related to the CCS TSI 2023 (2023/1695)
Main news related to the CCS TSI 2023 (2023/1695)Main news related to the CCS TSI 2023 (2023/1695)
Main news related to the CCS TSI 2023 (2023/1695)
Jakub Marek
 
Monitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdfMonitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdf
Tosin Akinosho
 
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
Fwdays
 
What is an RPA CoE? Session 1 – CoE Vision
What is an RPA CoE?  Session 1 – CoE VisionWhat is an RPA CoE?  Session 1 – CoE Vision
What is an RPA CoE? Session 1 – CoE Vision
DianaGray10
 
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development ProvidersYour One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
akankshawande
 
Y-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PPY-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PP
c5vrf27qcz
 
The Microsoft 365 Migration Tutorial For Beginner.pptx
The Microsoft 365 Migration Tutorial For Beginner.pptxThe Microsoft 365 Migration Tutorial For Beginner.pptx
The Microsoft 365 Migration Tutorial For Beginner.pptx
operationspcvita
 
Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |
AstuteBusiness
 

Recently uploaded (20)

Skybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoptionSkybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoption
 
"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota"Choosing proper type of scaling", Olena Syrota
"Choosing proper type of scaling", Olena Syrota
 
Mutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented ChatbotsMutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented Chatbots
 
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
 
Introduction of Cybersecurity with OSS at Code Europe 2024
Introduction of Cybersecurity with OSS  at Code Europe 2024Introduction of Cybersecurity with OSS  at Code Europe 2024
Introduction of Cybersecurity with OSS at Code Europe 2024
 
Christine's Supplier Sourcing Presentaion.pptx
Christine's Supplier Sourcing Presentaion.pptxChristine's Supplier Sourcing Presentaion.pptx
Christine's Supplier Sourcing Presentaion.pptx
 
Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...
Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...
Crafting Excellence: A Comprehensive Guide to iOS Mobile App Development Serv...
 
Taking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdfTaking AI to the Next Level in Manufacturing.pdf
Taking AI to the Next Level in Manufacturing.pdf
 
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge GraphGraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
 
Demystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through StorytellingDemystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through Storytelling
 
PRODUCT LISTING OPTIMIZATION PRESENTATION.pptx
PRODUCT LISTING OPTIMIZATION PRESENTATION.pptxPRODUCT LISTING OPTIMIZATION PRESENTATION.pptx
PRODUCT LISTING OPTIMIZATION PRESENTATION.pptx
 
Apps Break Data
Apps Break DataApps Break Data
Apps Break Data
 
Main news related to the CCS TSI 2023 (2023/1695)
Main news related to the CCS TSI 2023 (2023/1695)Main news related to the CCS TSI 2023 (2023/1695)
Main news related to the CCS TSI 2023 (2023/1695)
 
Monitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdfMonitoring and Managing Anomaly Detection on OpenShift.pdf
Monitoring and Managing Anomaly Detection on OpenShift.pdf
 
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk"Frontline Battles with DDoS: Best practices and Lessons Learned",  Igor Ivaniuk
"Frontline Battles with DDoS: Best practices and Lessons Learned", Igor Ivaniuk
 
What is an RPA CoE? Session 1 – CoE Vision
What is an RPA CoE?  Session 1 – CoE VisionWhat is an RPA CoE?  Session 1 – CoE Vision
What is an RPA CoE? Session 1 – CoE Vision
 
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development ProvidersYour One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
 
Y-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PPY-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PP
 
The Microsoft 365 Migration Tutorial For Beginner.pptx
The Microsoft 365 Migration Tutorial For Beginner.pptxThe Microsoft 365 Migration Tutorial For Beginner.pptx
The Microsoft 365 Migration Tutorial For Beginner.pptx
 
Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |Astute Business Solutions | Oracle Cloud Partner |
Astute Business Solutions | Oracle Cloud Partner |
 

Featured

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot
Marius Sescu
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPT
Expeed Software
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage Engineerings
Pixeldarts
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
ThinkNow
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
marketingartwork
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
Skeleton Technologies
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
Neil Kimberley
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
contently
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
Albert Qian
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
Kurio // The Social Media Age(ncy)
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
Search Engine Journal
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
SpeakerHub
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
Tessa Mero
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Lily Ray
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
Rajiv Jayarajah, MAppComm, ACC
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
Christy Abraham Joy
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
Vit Horky
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
MindGenius
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
RachelPearson36
 

Featured (20)

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPT
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage Engineerings
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 

DNA Encoding Protocol

  • 1. Co-opting the Genetic Code DNA Binary Encoding Protocol Amit Snyderman, ITP Design Frontiers, 2010
  • 2. Genetic Code The genetic code is the set of rules by which information encoded in genetic material is translated into proteins by living cells.
  • 3. DNA Deoxyribonucleic acid (DNA) contains the genetic instructions used in the development and functioning of all known living organisms. The main role of DNA molecules is the long-term storage of information.
  • 4. Units of the Code Adenosine (A) Cytosine (C) Guanine (G) Thymine (T)
  • 5. Codons Mapping between nucleotide triplets and amino acids 43 combinations = 64 possible codons http://upload.wikimedia.org/wikipedia/en/d/d6/GeneticCode21- version-2.svg
  • 6. Amino Acids 20 amino acids Just as the letters of the alphabet can be combined to form an almost endless variety of words, amino acids can be linked together in varying sequences to form a vast variety of proteins. http://upload.wikimedia.org/wikipedia/commons/3/37/Aa.svg
  • 7. Proteins Every protein is chemically defined by its unique sequence of amino acid residues, which in turn define the three-dimensional structure of the protein.
  • 8. MIME Base64 Encoding scheme that encodes binary data by treating it numerically and translating it into a base 64 representation. TEXT M a n ASCII 77 97 110 BIT PATTERN 010011010110000101101110 INDEX 19 22 5 46 BASE64-ENCODED T W F u
  • 9. Remap Rather than mapping to a character, map to a codon.
  • 10. VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID R R R 0 A AAA Lysine (K) 22 W CCG Proline (P) 43 r GGT Glycine (G) 1 B AAC Asparagine (N) 23 X CCT Proline (P) 44 s GTA Valine (V) 2 C AAG Lysine (K) 24 Y CGA Arginine (R) 45 t GTC Valine (V) 3 D AAT Asparagine (N) 25 Z CGC Arginine (R) 46 u GTG Valine (V) 4 E ACA Threonine (T) 26 a CGG Arginine (R) 47 v GTT Valine (V) 5 F ACC Threonine (T) 27 b CGT Arginine (R) 48 w TAA STOP 6 G ACG Threonine (T) 28 c CTA Leucine (L) 49 x TAC Tyrosine (Y) 7 H ACT Threonine (T) 29 d CTC Leucine (L) 50 y TAG STOP 8 I AGA Arginine (R) 30 e CTG Leucine (L) 51 z TAT Tyrosine (Y) 9 J AGC Serine (S) 31 f CTT Leucine (L) 52 0 TCA Serine (S) 10 K AGG Arginine (R) 32 g GAA Glutamate (E) 53 1 TCC Serine (S) 11 L AGT Serine (S) 33 h GAC Aspartate (D) 54 2 TCG Serine (S) 12 M ATA Isoleucine (I) 34 i GAG Glutamate (E) 55 3 TCT Serine (S) 13 N ATC Isoleucine (I) 35 j GAT Aspartate (D) 56 4 TGA STOP 14 O ATG Methionine (M) 36 k GCA Alanine (A) 57 5 TGC Cystine (C) 15 P ATT Isoleucine (I) 37 l GCC Alanine (A) 58 6 TGG Tryptophan (W) 16 Q CAA Glutamine (Q) 38 m GCG Alanine (A) 59 7 TGT Cystine (C) 17 R CAC Histidine (H) 39 n GCT Alanine (A) 60 8 TTA Leucine (L) 18 S CAG Glutamine (Q) 40 o GGA Glycine (G) 61 9 TTC Phenylalanine (F) 19 T CAT Histidine (H) 41 p GGC Glycine (G) 62 + TTG Leucine (L) 20 U CCA Proline (P) 42 q GGG Glycine (G) 63 / TTT Phenylalanine (F) 21 V CCC Proline (P)
  • 11. Example: Hello, world! BASE64 SGVsbG8sIHdvcmxkIQo= BASE64 INDEX 18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 8 16 40 DNA CAGACGCCCGTACGTACGTTAGTAAGAACTCTCGTTCTAGCGTACGCAAG ACAAGGA PROTEIN QTPVRTLVRTLVLAYARQG Any binary data can be represented: text (unicode), bitmap, audio, video, etc. Try It: http://amitsnyderman.com/school/designfrontiers/ encoder.php
  • 13. Non-Digital Library Via recombinant DNA technologies, craft a portable, reproducible, time-resistant library. Embed, grow and spread in bacteria. Package as a pill. Organic time capsule.
  • 14.
  • 15.
  • 16. Spime "The key to the Spime is identity. A Spime is, by definition, the protagonist of a documented process. It is an historical entity with an accessible, precise trajectory through space and time." –Bruce Sterling, Shaping Things
  • 17. Spime Ingredients Unique ID code History of ownership Geographical position Customization details Public discourse Etc.
  • 18. Human Identification Tools, artifacts, archeology Bone structure, teeth, dental records, fingerprints, DNA Yellowpages, resume, Facebook/LinkedIn/etc, Google
  • 19.
  • 20.
  • 21.
  • 22.
  • 23. Narrative Embedded Histories. Family trees and Lineage. Stories.
  • 24. Junk DNA Noncoding DNA describes sequences that do not encode for protein sequences. Much of this DNA has no known biological function and is sometimes referred to as "junk DNA". More than 98% of the human genome is non-coding.
  • 25. Human Spime Recycle junk DNA by recombining encoded messages into non-coding DNA regions. In-vitro manipulation. Gene therapy. Hereditary storytelling.

Editor's Notes