The document discusses an RNA-seq workshop agenda with the following key points:
1) It includes sessions on RNA-seq introduction, analysis workflows from mapping to differential expression and enrichment analysis, and available online resources and tools for RNA-seq data analysis.
2) Differential expression analysis will be performed using DESeq2 and genes will be analyzed for enrichment in Gene Ontology terms and KEGG pathways to identify biological processes and pathways impacted.
3) The workshop aims to introduce common RNA-seq analysis concepts and provide hands-on experience with tools like DESeq2, GO and KEGG enrichment to find differentially expressed genes and interpret results biologically.
High-resolution versions of these GIS figures can be viewed at: app.box.com/v/JPartsch-GISPortfolio
These slides are provided as examples of the GIS work products I have created over the past 15 years.
Mr. Martin Luther has successfully completed the Derivatives Market Dealers exam from NCFM. The exam was taken in English on July 03, 2008 in Mumbai. His certification is valid until July 02, 2011 according to the authorized signatory.
12. displacement method of analysis moment distributionChhay Teng
1. The displacement method of analysis, also known as moment distribution, is an iterative technique for analyzing indeterminate structures by redistributing internal moments at joints.
2. Key concepts include member stiffness factors (K), which relate the member end moments (M) to angular displacements (θ), joint stiffness factors (KT), which are the sum of the connected member stiffness factors, and distribution factors (DF), which proportion the influence of each member on a joint based on its stiffness factor.
3. The method involves initially assuming end moments, calculating the distribution factors, and using them to calculate new end moments until the values converge within a specified tolerance. This allows determination of the internal forces throughout the structure.
11. displacement method of analysis slope deflection equationsChhay Teng
1. The document discusses the displacement method of analysis known as the slope-deflection method. This method analyzes the deformations of structures using slope-deflection equations.
2. General procedures for the displacement method are described, including determining degrees of freedom and establishing slope-deflection equations for each member.
3. Slope-deflection equations relate the displacements (rotations and translations) of joints to member end actions (moments and shears). These equations allow determining member forces based on known joint displacements.
1) Plastic analysis was performed using the lower-bound theorem and equilibrium method to determine the collapse load of a W30x99 beam with continuous lateral support.
2) The working load was first determined by calculating the yield moment My. Once yielding occurred, the plastic moment capacity Mp was used.
3) Equilibrium of internal and external moments was satisfied at the collapse mechanism to determine the ultimate load. The uniqueness theorem confirmed this was the collapse load.
13 beams and frames having nonprismatic membersChhay Teng
1) The document discusses methods for analyzing non-prismatic structural members, such as tapered or stepped beams and frames, using the slope-deflection and moment distribution methods.
2) It describes calculating the deflection of non-prismatic members through integration, and introduces the concepts of stiffness factor K, carry-over factor COF, and the conjugate beam method for analyzing loading properties.
3) An example problem is presented to demonstrate calculating the fixed-end moment FEM at joints A and B of a tapered beam using the given stiffness factors K and carry-over factors COF from the conjugate beam analysis.
14. truss analysis using the stiffness methodChhay Teng
1. The document discusses analyzing truss structures using the stiffness method. It begins by introducing the fundamentals of the stiffness method for truss analysis.
2. It describes how to derive the member stiffness matrix for each truss member, which relates the forces and displacements in the member's local coordinate system.
3. It provides equations to transform between the member's local coordinate system and the global coordinate system of the truss, in order to assemble the overall structure stiffness matrix for the truss.
High-resolution versions of these GIS figures can be viewed at: app.box.com/v/JPartsch-GISPortfolio
These slides are provided as examples of the GIS work products I have created over the past 15 years.
Mr. Martin Luther has successfully completed the Derivatives Market Dealers exam from NCFM. The exam was taken in English on July 03, 2008 in Mumbai. His certification is valid until July 02, 2011 according to the authorized signatory.
12. displacement method of analysis moment distributionChhay Teng
1. The displacement method of analysis, also known as moment distribution, is an iterative technique for analyzing indeterminate structures by redistributing internal moments at joints.
2. Key concepts include member stiffness factors (K), which relate the member end moments (M) to angular displacements (θ), joint stiffness factors (KT), which are the sum of the connected member stiffness factors, and distribution factors (DF), which proportion the influence of each member on a joint based on its stiffness factor.
3. The method involves initially assuming end moments, calculating the distribution factors, and using them to calculate new end moments until the values converge within a specified tolerance. This allows determination of the internal forces throughout the structure.
11. displacement method of analysis slope deflection equationsChhay Teng
1. The document discusses the displacement method of analysis known as the slope-deflection method. This method analyzes the deformations of structures using slope-deflection equations.
2. General procedures for the displacement method are described, including determining degrees of freedom and establishing slope-deflection equations for each member.
3. Slope-deflection equations relate the displacements (rotations and translations) of joints to member end actions (moments and shears). These equations allow determining member forces based on known joint displacements.
1) Plastic analysis was performed using the lower-bound theorem and equilibrium method to determine the collapse load of a W30x99 beam with continuous lateral support.
2) The working load was first determined by calculating the yield moment My. Once yielding occurred, the plastic moment capacity Mp was used.
3) Equilibrium of internal and external moments was satisfied at the collapse mechanism to determine the ultimate load. The uniqueness theorem confirmed this was the collapse load.
13 beams and frames having nonprismatic membersChhay Teng
1) The document discusses methods for analyzing non-prismatic structural members, such as tapered or stepped beams and frames, using the slope-deflection and moment distribution methods.
2) It describes calculating the deflection of non-prismatic members through integration, and introduces the concepts of stiffness factor K, carry-over factor COF, and the conjugate beam method for analyzing loading properties.
3) An example problem is presented to demonstrate calculating the fixed-end moment FEM at joints A and B of a tapered beam using the given stiffness factors K and carry-over factors COF from the conjugate beam analysis.
14. truss analysis using the stiffness methodChhay Teng
1. The document discusses analyzing truss structures using the stiffness method. It begins by introducing the fundamentals of the stiffness method for truss analysis.
2. It describes how to derive the member stiffness matrix for each truss member, which relates the forces and displacements in the member's local coordinate system.
3. It provides equations to transform between the member's local coordinate system and the global coordinate system of the truss, in order to assemble the overall structure stiffness matrix for the truss.
15. beam analysis using the stiffness methodChhay Teng
1. The document discusses analyzing beams using the stiffness method. It introduces node coordinates and degrees of freedom, and defines member stiffness matrices for individual beam elements.
2. It provides examples of applying the method to simple structures like trusses and slider mechanisms by assembling the element stiffness matrices into a global stiffness matrix.
3. The method relates displacements at nodes to applied forces using the member stiffness matrices. This allows solving for unknown displacements given known forces or vice versa.
A.matrix algebra for structural analysisdocChhay Teng
The document provides definitions and examples of different types of matrices including matrix algebra, matrix operations, and properties of matrix operations. It defines matrices, matrix types (square, identity, symmetric, triangular), and matrix operations including addition, subtraction, scalar multiplication, and matrix multiplication. Matrix multiplication involves multiplying the rows of the first matrix with the columns of the second matrix. The properties discussed are that matrix multiplication is noncommutative, distribution over addition holds, and distribution over matrix multiplication holds.
This document provides information on deflection and the elastic curve. It discusses the moment-area method and conjugate beam method for calculating deflection. It also describes using a deflection diagram to represent the elastic curve. The document contains diagrams showing examples of beams with loads and supports, along with the corresponding bending moment and deflection diagrams. Equations for calculating deflection due to bending are also presented.
The document discusses carbohydrates and monosaccharides. It defines carbohydrates and explains that they are produced through photosynthesis. It classifies monosaccharides as aldoses and ketoses and lists examples of three-carbon and four-carbon aldoses, including their chemical structures and names. It also mentions the importance of carbohydrates and some of their uses.
7. approximate analysis of statically indeterminate structuresChhay Teng
This document provides an approximate analysis of statically indeterminate structures. It discusses the use of approximate methods to analyze trusses that are statically indeterminate due to the presence of redundant members. The analysis involves satisfying equilibrium equations at nodes by ignoring compatibility conditions. As an example, it shows the approximate analysis of a plane truss with joints A, B, C, and D. The forces in the members are determined by writing and solving the equations of equilibrium at the joints. Approximate methods provide quick estimates of member forces in statically indeterminate structures for preliminary design.
Hello all the aspirants, we are sharing the PDF of NEET 2017 question paper "SET A" with you. Please download it and get the bulk of previous year questions related to the exam.
- The document appears to be code snippets and notes written in both English and another language.
- It discusses topics like Keras, TensorFlow, Python, APIs, variables, plotting, and deploying models to a backend.
- There are also references to creating hybrid models, upgrading models to newer versions, and ensuring models are scalable and secure.
1. Three job vacancies are summarized for different positions - Fitter, Typist, and Storekeeper.
2. For each position, the summary provides the pay scale, educational qualifications, and top 5 preferences from the applicant's reservation of rights form.
3. The form asks applicants to specify their caste/community and rank their work experience preferences that would be considered if multiple candidates have equal qualifications for a position.
Aksharica (अक्षरिका) is a Nepali Language Newsletter. Aksharica is made with a combination of two words “Akshar” and “America”. Akshar means “letter” in Nepali, thus goal of the Aksharica is to educate, inform, inspire, and empower the Nepali speaking community (Bhutanese and Nepalese) residing in America. Rajesh Koirala is working as an editor since it started on August 2010. This is 71st issue, published on May, 2015.
1. This document discusses one-way slabs, including their types, design, and analysis according to the ACI Code.
2. The three main types of one-way slabs are: one-way solid slab, one-way joist floor slab (ribbed slab), and one-way floor system (two-way slab).
3. Design and analysis of one-way slabs must consider the slab's moment of inertia, load distribution, and requirements for minimum slab thickness according to the ACI Code.
This document lists the names and chromosomal locations of 16 genes that were validated using ChIP-PCR on November 8th, 2010. The genes include Tbc1d4, 9030425E11Rik, 1110059E24Rik, Pcolce, Kif20b, Ppp1cc, Ror2, Tgfbi, Eif3h, Flnb, Tpm4, Sik1, Cd248, Pip4k2b, Tdrd7, and Wdr75.
This 3 sentence summary provides the essential information from the document:
The document contains guitar tablature for the song "Classical Gas" as performed by Tommy Emmanuel. The tablature is provided for private study and represents the author's interpretation of the song. Any unauthorized commercial distribution of the tablature file would violate copyright law as the song's copyright holder retains all rights.
This document contains a series of symbols, characters, and punctuation marks with no discernible words, sentences, or meaning. It appears to be random or nonsensical text.
This document discusses Internet of Things (IoT) technologies and applications. It covers the following key points:
1. IoT connects various devices through communication interfaces and networks to collect and exchange data. Common interfaces include Bluetooth, WiFi, LTE, and 5G.
2. Collected data is analyzed using technologies like cloud computing, data mining, machine learning and artificial intelligence. This enables applications in various fields such as smart cities, healthcare, logistics and more.
3. Security and privacy are important challenges to address as more devices are connected. Authentication, access control and encryption help protect data being transmitted over networks.
This document contains a complex mathematical expression with variables, numbers, operators, and functions. It also includes references to technical terms like GPS and abbreviations like PT. The document discusses mathematical and technical concepts across multiple domains.
This document discusses setting up TensorFlow for GPU usage and training models in parallel across multiple GPUs. It provides instructions on limiting GPU memory usage on a per-process basis, distributing TensorFlow workload across GPUs, and monitoring GPU usage.
This document contains a series of numbers, characters, and URLs without clear context or meaning. It discusses VPC subnets, AWS global infrastructure, NAT gateways, network access control lists, security groups, and the shared responsibility model but does not provide a coherent summary.
This document appears to be a collection of unrelated snippets in Korean and English. It includes short passages about learning, neural networks, parsers, lectures, and more. Overall the document does not have a clear topic or main point to summarize succinctly.
TensorFlow 2: New Era of Developing Deep Learning ModelsJeongkyu Shin
This document discusses TensorFlow and provides information about:
1. Major TensorFlow releases from 2016-2018 and new features introduced each year like TensorFlow Serving, Keras API, TensorFlow Lite, etc.
2. Common TensorFlow operations that have changed names or behaviors between TensorFlow 1.x and 2.x like tf.variable, tf.global_variables_initializer, and Session.run.
3. How to distribute training across multiple GPUs and CPUs using strategies like MirroredStrategy in TensorFlow 2.x.
- The document contains a long list of letters, numbers, symbols and other characters with no clear meaning or context.
- It jumps between different languages and scripts making the overall content very difficult to understand or summarize concisely.
- The document appears to be nonsense with no discernible overall topic, purpose or main ideas that could be summarized in just a few sentences.
15. beam analysis using the stiffness methodChhay Teng
1. The document discusses analyzing beams using the stiffness method. It introduces node coordinates and degrees of freedom, and defines member stiffness matrices for individual beam elements.
2. It provides examples of applying the method to simple structures like trusses and slider mechanisms by assembling the element stiffness matrices into a global stiffness matrix.
3. The method relates displacements at nodes to applied forces using the member stiffness matrices. This allows solving for unknown displacements given known forces or vice versa.
A.matrix algebra for structural analysisdocChhay Teng
The document provides definitions and examples of different types of matrices including matrix algebra, matrix operations, and properties of matrix operations. It defines matrices, matrix types (square, identity, symmetric, triangular), and matrix operations including addition, subtraction, scalar multiplication, and matrix multiplication. Matrix multiplication involves multiplying the rows of the first matrix with the columns of the second matrix. The properties discussed are that matrix multiplication is noncommutative, distribution over addition holds, and distribution over matrix multiplication holds.
This document provides information on deflection and the elastic curve. It discusses the moment-area method and conjugate beam method for calculating deflection. It also describes using a deflection diagram to represent the elastic curve. The document contains diagrams showing examples of beams with loads and supports, along with the corresponding bending moment and deflection diagrams. Equations for calculating deflection due to bending are also presented.
The document discusses carbohydrates and monosaccharides. It defines carbohydrates and explains that they are produced through photosynthesis. It classifies monosaccharides as aldoses and ketoses and lists examples of three-carbon and four-carbon aldoses, including their chemical structures and names. It also mentions the importance of carbohydrates and some of their uses.
7. approximate analysis of statically indeterminate structuresChhay Teng
This document provides an approximate analysis of statically indeterminate structures. It discusses the use of approximate methods to analyze trusses that are statically indeterminate due to the presence of redundant members. The analysis involves satisfying equilibrium equations at nodes by ignoring compatibility conditions. As an example, it shows the approximate analysis of a plane truss with joints A, B, C, and D. The forces in the members are determined by writing and solving the equations of equilibrium at the joints. Approximate methods provide quick estimates of member forces in statically indeterminate structures for preliminary design.
Hello all the aspirants, we are sharing the PDF of NEET 2017 question paper "SET A" with you. Please download it and get the bulk of previous year questions related to the exam.
- The document appears to be code snippets and notes written in both English and another language.
- It discusses topics like Keras, TensorFlow, Python, APIs, variables, plotting, and deploying models to a backend.
- There are also references to creating hybrid models, upgrading models to newer versions, and ensuring models are scalable and secure.
1. Three job vacancies are summarized for different positions - Fitter, Typist, and Storekeeper.
2. For each position, the summary provides the pay scale, educational qualifications, and top 5 preferences from the applicant's reservation of rights form.
3. The form asks applicants to specify their caste/community and rank their work experience preferences that would be considered if multiple candidates have equal qualifications for a position.
Aksharica (अक्षरिका) is a Nepali Language Newsletter. Aksharica is made with a combination of two words “Akshar” and “America”. Akshar means “letter” in Nepali, thus goal of the Aksharica is to educate, inform, inspire, and empower the Nepali speaking community (Bhutanese and Nepalese) residing in America. Rajesh Koirala is working as an editor since it started on August 2010. This is 71st issue, published on May, 2015.
1. This document discusses one-way slabs, including their types, design, and analysis according to the ACI Code.
2. The three main types of one-way slabs are: one-way solid slab, one-way joist floor slab (ribbed slab), and one-way floor system (two-way slab).
3. Design and analysis of one-way slabs must consider the slab's moment of inertia, load distribution, and requirements for minimum slab thickness according to the ACI Code.
This document lists the names and chromosomal locations of 16 genes that were validated using ChIP-PCR on November 8th, 2010. The genes include Tbc1d4, 9030425E11Rik, 1110059E24Rik, Pcolce, Kif20b, Ppp1cc, Ror2, Tgfbi, Eif3h, Flnb, Tpm4, Sik1, Cd248, Pip4k2b, Tdrd7, and Wdr75.
This 3 sentence summary provides the essential information from the document:
The document contains guitar tablature for the song "Classical Gas" as performed by Tommy Emmanuel. The tablature is provided for private study and represents the author's interpretation of the song. Any unauthorized commercial distribution of the tablature file would violate copyright law as the song's copyright holder retains all rights.
This document contains a series of symbols, characters, and punctuation marks with no discernible words, sentences, or meaning. It appears to be random or nonsensical text.
This document discusses Internet of Things (IoT) technologies and applications. It covers the following key points:
1. IoT connects various devices through communication interfaces and networks to collect and exchange data. Common interfaces include Bluetooth, WiFi, LTE, and 5G.
2. Collected data is analyzed using technologies like cloud computing, data mining, machine learning and artificial intelligence. This enables applications in various fields such as smart cities, healthcare, logistics and more.
3. Security and privacy are important challenges to address as more devices are connected. Authentication, access control and encryption help protect data being transmitted over networks.
This document contains a complex mathematical expression with variables, numbers, operators, and functions. It also includes references to technical terms like GPS and abbreviations like PT. The document discusses mathematical and technical concepts across multiple domains.
This document discusses setting up TensorFlow for GPU usage and training models in parallel across multiple GPUs. It provides instructions on limiting GPU memory usage on a per-process basis, distributing TensorFlow workload across GPUs, and monitoring GPU usage.
This document contains a series of numbers, characters, and URLs without clear context or meaning. It discusses VPC subnets, AWS global infrastructure, NAT gateways, network access control lists, security groups, and the shared responsibility model but does not provide a coherent summary.
This document appears to be a collection of unrelated snippets in Korean and English. It includes short passages about learning, neural networks, parsers, lectures, and more. Overall the document does not have a clear topic or main point to summarize succinctly.
TensorFlow 2: New Era of Developing Deep Learning ModelsJeongkyu Shin
This document discusses TensorFlow and provides information about:
1. Major TensorFlow releases from 2016-2018 and new features introduced each year like TensorFlow Serving, Keras API, TensorFlow Lite, etc.
2. Common TensorFlow operations that have changed names or behaviors between TensorFlow 1.x and 2.x like tf.variable, tf.global_variables_initializer, and Session.run.
3. How to distribute training across multiple GPUs and CPUs using strategies like MirroredStrategy in TensorFlow 2.x.
- The document contains a long list of letters, numbers, symbols and other characters with no clear meaning or context.
- It jumps between different languages and scripts making the overall content very difficult to understand or summarize concisely.
- The document appears to be nonsense with no discernible overall topic, purpose or main ideas that could be summarized in just a few sentences.
This document contains contact information for Satoru Funai, including links to his Twitter, LinkedIn, SlideShare, and Facebook profiles. It also includes links to presentation slides on OpenPIE and the most important aspects of operations. The document contains various Japanese text and technical terms.
This document discusses several topics:
1. It mentions a U.S. organization and initials F, I, J, and K.
2. It refers to transferring or moving something between locations B and N.
3. It lists several names or terms: T, V, O, W, E, X, C, L, and P.
Stratégies orthogonales pour la caractérisation de glycoprotéines thérapeutiq...Quality Assistance s.a.
Stratégies orthogonales pour la caractérisation de glycoprotéines thérapeutiques par LC/MS par Arnaud Delobel, R&D Director
Visit www.quality-assistance.com for more information
1. The document contains a series of numbers, letters, symbols and punctuation that do not form clear words or sentences.
2. There are numeric and alphabetic characters separated by spaces with some punctuation marks interspersed throughout.
3. It is not possible to discern any meaning or summarize the content from the document as it does not contain coherent sentences, phrases or ideas.
1. Cables and arches are important structural elements that are commonly used in bridges and buildings to support concentrated and distributed loads.
2. Cables can support significant loads and transfer forces over large distances when subjected to tension. The behavior of cables depends on their ability to carry only tensile forces and flexibility.
3. When cables are subjected to concentrated loads, their sag or deflection can be determined through equilibrium equations. The forces in the cables can then be solved for each connection.
Db2 Warehouseを理由するユーザー及び、構築、運用管理を行うユーザー向けに作成したガイドです。Db2 Warehouseの構築、運用管理の際に必要に応じて参照ください。本ドキュメントはDb2 Warehouse v3.0をベースに作成されています。
It is a guide created for users who reason for Db2 Warehouse, and for users who conduct construction and operation management. Please refer to Db 2 Warehouse as necessary for construction and operation management. This document is based on Db 2 Warehouse v 3.0.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
How to Add Chatter in the odoo 17 ERP ModuleCeline George
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...PECB
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
How to Setup Warehouse & Location in Odoo 17 InventoryCeline George
In this slide, we'll explore how to set up warehouses and locations in Odoo 17 Inventory. This will help us manage our stock effectively, track inventory levels, and streamline warehouse operations.
4. R
o mh bz
rutyjacpR i ezh
P ) NP
D)
)
i ezizd
( T
TACCGGCTTGCAACTCAATTACCGCGGCTGCT
GGCACGTAGTTAGCCGTGACTTTCTGGTTGAT
TACCGTCAAATAAAGGCCAGTTACTACCTCTA
TCCTTCTTC
T o m
G . 1 /
2 1 /1 A 1 1 : : 1
lci g
ivs
/C :
o mh bzn p
lci R P
13. RNA-seq hr
RNA-seq hr
Selected genes
by edgeR, DESeq2
(RNA-seq) and
limma,
RankProduct
(microarray)
BAM2ReadCount
Gene α
Gene ω
Gene β
ŸŸŸ
Gene α
Gene ω
Gene β
Time-course visualization
Enrichment
Clustering
Network
inference
i
Keratinization
⏎
GO/KEG
G
PPI, pathway
R Thr
I TS PG ka
e dhr
T R lma
P ncqibgs
- - ( :
) )( 2 B2A 2
/- ) 2 B2A 2
op P N
: 2 E :: - B2A
I hr
A D - 2A :
14. D mlu o D d R bE
n moV
Lamontagne J, Mell JC, Bouchard MJ (2016) Transcriptome-Wide Analysis of Hepatitis B Virus-Mediated Changes
to Normal Hepatocyte Gene Expression. PLoS Pathog 12(2): e1005438. doi:10.1371/journal.ppat.1005438
Accession number: GSE68113
D n s i 0( / )) - b HbE
n d B A Lb J b
HbE D B d b J acb E
r D n n Dr moqg t MM
B Nc IbE
D er e d d bE
n I
A d I 2 C C vn 0
15. Assembly, mapping
0+ 0+ + MQ F U m vt
/I BI B& - 1& - - my o bd[g - - m I Q B
DBJ IB II( x + N S FB) LE ) d . + NB A
eln b I ps m QJ A o Q NB A b o
( - 1 f f ps
- 1 BMQBJ B B A +N EFRB N m 0+ e C M AQIL
F LU E J k L DB +A - 1 f LNBCB E o [g f ps
w
) Q F U EB d x
wu r f k q o an ] n d] n
0+ - 2 R k F eln MQ F U EB NFI II F eln
q k xo an
hcf .3& e ] n
e id TT X
LLFJD y BI U
16. Quality Check
PS eb C
) Q rx PF muh eCc eb Qy Q ( Qos
/ Plq A d C 0 aC G A
Qt TQiP
= 0 Q = 4 G
nG A = 4 Qh
G ST G R
A
17. Triming
- A d ni -
g qke q m d ni c T - c a t
)( X F d ni c XF - L XF
g qke q mc T cs a I aI q m I Na
Gene001 958
Gene002 7
Gene003 491
Gene004 1649
Gene005 1187
Gene006 12
Gene001 492
Gene002 4
Gene003 246
Gene004 861
Gene005 620
Gene006 7
lqp lqpy - - - alqorh
lqorh q mI w
XRTFa
-/- A X I a -
- - / -/ S
lqorh
cv u TJ a
18. (Spliced) mapping
Tophat / Bowtie2 / subread hps (spliced) mapping)
R Re I 9 a I I 9 I9E IAG uP o x fTca
e h tdTs I I E E D l D9GGAE s i
R i P e D 2) u ,2) h dWq s P
j i ta h s f SsamPD9GGAE h GCA AE dTs
GCA BLE A E u s hgs N A j g D9GGAE C eS
rP G 9 jP GCA BLE A E u d N A h PD9GGAE s R eSs
19GGAE jP L E )CA ED E 19G 9D n j h ts
)1 j b P )1 j w R e vw u sffnhP
GCA BLE A E u o TpUhgcdTs
i ejP/CCLDAE9 A E D h I I E E D N A 8) AE
o 9EE 9 A E vw WtdTs 2 / -1 0 P R en
gs vw x j DD( DD ej ( p Tqts g
PA E D Wq ,0 e gT jPI I E E D Wq N A LAC u T
d N A AE u s Ss
)1 vw hjP i fi I I 9 tdTs WqP
E i u a vw 9EE 9 A E vw f u TdP
Pn j GCA AE M9IA9E n a I9E IAG i R u s feP
h Ts R I 9 LE 9 9 qts
19. Alignment
STAR S ultra-fast alignment
83 - NT - m TS op G
r - dabh m
/ Tn
1 2
- / S 88 2
RT q S
/ x T
2 Tn / S
beAc efg s
i B w t
TefgA
G
24. Enrichment
Enrichment ( )
STAT3 ( ) GO terms
Gene Ontology MF (Molecular Function), CC (Cellular Component),
BP (Biological Process) (ontology)
GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II
transcription factor activity,
sequence-specific DNA
binding
IEA
GO:0004871 signal transducer activity IEA,TAS 7512451
GO:0005515 protein binding IPI 8662591
GO:0008134 transcription factor binding IPI 15664994
GO:0046983 protein dimerization activity ISS
GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA
GO:0090575 RNA polymerase II
transcription factor complex
IMP 16946298
25. Enrichment
Enrichment ( )
(DEG)
STAT3, JAK2, NFkB, IRF4, CRCX12, CCR5, IL1b etc…
GO:0019221 (cytokine-mediated signaling pathway) GO term
GO:0019221
GO:0019221
N
n K k
(GO term)
DEG (GO term)
p
Gene Ontology DEG (
) Gene Set Enrichment Analysis
(parametric GSEA)
26. Enrichment
(GO enrichment)
DEGSeq2 Gene Ontology (MF/BP/CC)
KEGG pathway, Reactome pathway ontology pathway
Gene Ontology (Biological Process)
GO:0006082 organic acid metabolic process 1.76E-22
Ehhadh/Adh7/Adh1/Cyp2d3/Cyp4a2/Ddc/Fabp1/Fbp1/Agxt/Cyp2a2/Sds/Cyp2e1/
Rgn/Gnmt/Acox2/Otc/G6pc/Ugt2b1/Cyp2c7/Glyat/Cyp2c6v1/Baat/Cyp4a3/Hgd/P
ck1/Bhmt2/Cyp4a1/Kmo/Slc27a2/Marc1/Slc27a5/Bhmt/Abat/Cdo1/Hao2/Ftcd
GO:0043436 oxoacid metabolic process 6.61E-22
Ehhadh/Adh7/Adh1/Cyp2d3/Cyp4a2/Ddc/Fabp1/Fbp1/Agxt/Cyp2a2/Sds/Cyp2e1/
Rgn/Gnmt/Acox2/Otc/Ugt2b1/Cyp2c7/Glyat/Cyp2c6v1/Baat/Cyp4a3/Hgd/Pck1/B
hmt2/Cyp4a1/Kmo/Slc27a2/Marc1/Slc27a5/Bhmt/Abat/Cdo1/Hao2/Ftcd
GO:0019752 carboxylic acid metabolic process 8.77E-22
Ehhadh/Adh7/Adh1/Cyp2d3/Cyp4a2/Ddc/Fabp1/Fbp1/Agxt/Cyp2a2/Sds/Cyp2e1/
Rgn/Gnmt/Acox2/Otc/Ugt2b1/Cyp2c7/Glyat/Cyp2c6v1/Baat/Cyp4a3/Hgd/Pck1/B
hmt2/Cyp4a1/Kmo/Slc27a2/Slc27a5/Bhmt/Abat/Cdo1/Hao2/Ftcd
GO:0044281 small molecule metabolic process 3.24E-20
Ehhadh/Adh7/Adh1/Cat/Cyp2d3/Cyp4a2/Ddc/Fabp1/Fbp1/Hsd3b5/Lcat/Agxt/Cyp
2a2/Sds/Cyp2e1/Rgn/Gnmt/Acox2/Otc/G6pc/Rbp4/Cyp3a2/Ugt2b1/Cyp2c7/Glyat
/Cyp2c6v1/Baat/Cyp4a3/Hgd/Pck1/Bhmt2/Apof/Cyp4a1/Car5a/Kmo/Slc27a2/Mar
c1/Slc27a5/Bhmt/Abat/Cdo1/Hao2/Ftcd
GO:0032787 monocarboxylic acid metabolic process 4.05E-19
Ehhadh/Adh7/Adh1/Cyp2d3/Cyp4a2/Fabp1/Fbp1/Agxt/Cyp2a2/Sds/Cyp2e1/Rgn/
Acox2/Ugt2b1/Cyp2c7/Glyat/Cyp2c6v1/Baat/Cyp4a3/Pck1/Cyp4a1/Kmo/Slc27a2/
Slc27a5/Abat/Hao2/Ftcd
GO:0044710 single-organism metabolic process 8.60E-18
Ehhadh/Adh7/Adh1/C4bpb/C6/Cat/Cyp2d3/Cyp4a2/Ddc/Fabp1/Fbp1/Hsd3b5/Lca
t/Mbl1/Agxt/Cyp2a2/Sult2a1/Sds/Cyp2e1/Rgn/Gnmt/Acox2/Cyp3a18/Thrsp/Crp/
Otc/G6pc/Rbp4/Cyp3a2/Ugt2b1/Ces1e/Cyp2c7/Glyat/Cyp2c6v1/Baat/Cyp4a3/Dhr
s7/Serpina6/Hgd/Pck1/Adhfe1/Bhmt2/Aox3/RGD1564865/Apof/Cyp4a1/Slco1a1/
Car5a/Kmo/Slc27a2/Marc1/Slc27a5/Bhmt/Abat/Cdo1/Cyp8b1/Hao2/Ftcd
GO:0055114 oxidation-reduction process 1.19E-16
Ehhadh/Adh7/Adh1/Cat/Cyp2d3/Cyp4a2/Fabp1/Hsd3b5/Cyp2a2/Cyp2e1/Gnmt/A
cox2/Cyp3a18/G6pc/Cyp3a2/Cyp2c7/Cyp2c6v1/Cyp4a3/Dhrs7/Hgd/Adhfe1/Aox3/
RGD1564865/Cyp4a1/Kmo/Slc27a2/Marc1/Cdo1/Cyp8b1/Hao2
GO:0006629 lipid metabolic process 2.78E-14
Ehhadh/Adh7/Adh1/Cat/Cyp2d3/Cyp4a2/Fabp1/Hsd3b5/Lcat/Cyp2a2/Sult2a1/Cy
p2e1/Rgn/Acox2/Thrsp/G6pc/Rbp4/Cyp3a2/Ces1e/Cyp2c7/Cyp2c6v1/Baat/Cyp4a
3/Serpina6/Pck1/Apof/Cyp4a1/Slc27a2/Slc27a5/Hao2
GO:0044255 cellular lipid metabolic process 1.54E-13
Ehhadh/Adh7/Adh1/Cat/Cyp2d3/Cyp4a2/Fabp1/Lcat/Cyp2a2/Cyp2e1/Rgn/Acox2/
Thrsp/G6pc/Rbp4/Cyp3a2/Cyp2c7/Cyp2c6v1/Baat/Cyp4a3/Pck1/Apof/Cyp4a1/Slc
27a2/Slc27a5/Hao2
35. ComBat
W.E. Johnson, C. Li, and A. Rabinovic. Adjusting batch effects in microarray data
using empirical bayes methods. Biostatistics, 8(1):118–127, 2007.
: Caleb K Stein et al, Blood 2014 124:3355; Fig.1
replicate
ComBat sva package
ComBat
36. replicate
RNA-seq differential expression studies: more sequence or more replication?
Vol. 30 no. 3 2014, pages 301–304 doi:10.1093/bioinformatics/btt688
10M
replicate
(
depth
replicate
)