RESEARCH ARTICLE
Polyamine transporter potABCD is required
for virulence of encapsulated but not
nonencapsulated Streptococcus pneumoniae
Haley R. Pipkins, Jessica L. Bradshaw, Lance E. Keller
¤
, Edwin Swiatlo, Larry
S. McDaniel*
Department of Microbiology and Immunology, University of Mississippi Medical Center, Jackson, Mississippi,
United States of America
¤ Current address: Department of Molecular Genetics, University of Groningen, Nijenborgh, Groningen, The
Netherlands
* [email protected]
Abstract
Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causa-
tive agent of multiple diseases. Since invasive pneumococcal infections are associated with
encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumo-
coccal vaccines. However, there is an increasing distribution of non-vaccine serotypes,
as well as nonencapsulated S. pneumoniae (NESp). Both encapsulated and nonencapsu-
lated pneumococci possess the polyamine oligo-transport operon (potABCD). Previous
research has shown inactivation of the pot operon in encapsulated pneumococci alters pro-
tein expression and leads to a significant reduction in pneumococcal murine colonization,
but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD
from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumoly-
sin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence
of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla
model of otitis media (OM), the absence of potD does not significantly affect MNZ67 viru-
lence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain
TIGR4 (serotype 4). Deletion of potD also significantly reduced persistence of TIGR4 in the
lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is impor-
tant for the regulation of protein expression and biofilm formation in both encapsulated and
NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated
pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67
murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore,
NESp virulence regulation needs to be further established to identify potential NESp thera-
peutic targets.
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 1 / 19
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Pipkins HR, Bradshaw JL, Keller LE,
Swiatlo E, McDaniel LS (2017) Polyamine
transporter potABCD is required for virulence of
encapsulated but not nonencapsulated
Streptococcus pneumoniae. PLoS ONE 12(6):
e0179159. https://doi.org/10.1371/journal.
pone.0179159
Editor: Eliane N. Miyaji, Instituto Butantan, BRAZIL
Received: January 9, 2017
Accepted: May 24, 2017
Published: June 6, 20.
Paxlovid and Molnupiravir What Are The Differences.pdfDoriaFang
On November 4, 2021, the Medicines and Healthcare Products Regulatory Agency (MHRA) granted marketing approval for Molnupiravir (trade name: Lagevrio), an oral COVID-19 drug co-developed by Merck and Ridgeback, for the treatment of patients with mild to moderate COVID-19. This is the first oral antiviral drug approved globally for the treatment of mild to moderate COVID-19 in adults.
New coronavirus inhibitor exhibits antiviral activity Harm Kiezebrink
Searching for inhibitors of coronaviruses, an international team of scientists led by Edward Trybala, from the University of Gothenburg, Sweden, and Volker Thiel, from the University of Berne, Switzerland, identified a compound called K22.
They initially discovered that K22 had antiviral activity against a relatively harmless coronavirus that causes mild cold-like symptoms in humans.
Follow-up experiments showed that the compound was effective against all other coronaviruses tested, including the SARS and MERS coronaviruses.
The researchers also demonstrated efficient inhibition of virus in cells that line the human airways and are the natural port of entry for respiratory viruses.
i dr manish tiwari a tutor department of microbiology SMC medical college unnao, very interested to make ppt of this subject and upload on slide share for benefit of medical(PG) and UG students. if anybody want any ppt of microbiology kindly message me on my mail address and you can contact me too on contact no.that is given on 1st slide.
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online.
Paxlovid and Molnupiravir What Are The Differences.pdfDoriaFang
On November 4, 2021, the Medicines and Healthcare Products Regulatory Agency (MHRA) granted marketing approval for Molnupiravir (trade name: Lagevrio), an oral COVID-19 drug co-developed by Merck and Ridgeback, for the treatment of patients with mild to moderate COVID-19. This is the first oral antiviral drug approved globally for the treatment of mild to moderate COVID-19 in adults.
New coronavirus inhibitor exhibits antiviral activity Harm Kiezebrink
Searching for inhibitors of coronaviruses, an international team of scientists led by Edward Trybala, from the University of Gothenburg, Sweden, and Volker Thiel, from the University of Berne, Switzerland, identified a compound called K22.
They initially discovered that K22 had antiviral activity against a relatively harmless coronavirus that causes mild cold-like symptoms in humans.
Follow-up experiments showed that the compound was effective against all other coronaviruses tested, including the SARS and MERS coronaviruses.
The researchers also demonstrated efficient inhibition of virus in cells that line the human airways and are the natural port of entry for respiratory viruses.
i dr manish tiwari a tutor department of microbiology SMC medical college unnao, very interested to make ppt of this subject and upload on slide share for benefit of medical(PG) and UG students. if anybody want any ppt of microbiology kindly message me on my mail address and you can contact me too on contact no.that is given on 1st slide.
International Journal of Pharmaceutical Science Invention (IJPSI) is an international journal intended for professionals and researchers in all fields of Pahrmaceutical Science. IJPSI publishes research articles and reviews within the whole field Pharmacy and Pharmaceutical Science, new teaching methods, assessment, validation and the impact of new technologies and it will continue to provide information on the latest trends and developments in this ever-expanding subject. The publications of papers are selected through double peer reviewed to ensure originality, relevance, and readability. The articles published in our journal can be accessed online.
Current situation of nanovaccines technology developmentDoriaFang
Rapid advances in nanotechnology over the past few decades have laid the foundation for the development of nanomedicine and vaccines. Compared with traditional vaccines, nanovaccines utilize a variety of nanoparticles and has significant advantages in delivery efficiency, dosage regimen, route of administration, adjuvant and vaccination effect. Currently, liposomes and lipid nanoparticles play a leading role in the clinical application of nanovaccine, indicating that the good biocompatibility and biosafety of nanomaterials are still indicators that cannot be ignored in the competition for next-generation nanovaccine.
Microbial Flora in Chronic Rhinosinusitis with and without Nasalpolyps by José Gameirodos Santos in Experiments in Rhinology & Otolaryngology
The most common microbial agents in the etiology of chronic rhinosinusitis are defined in the literature as Staphylococcus aureus, Staphylococcus coagulase-negative and Streptococcus spp. In healthy individuals these same microorganisms are also the most frequent (mainly Staphylococcus coagulase negative) ascolonizing flora agents. We often encounter a poly microbial colonization of the nose and sinuses. The contribution of the different pathogens for the disease remains sun certain. The aim of this study is to compare the microbial flora found in patients with chronic rhinosinusitis with and without nasal polyps.
Estudio realizado en Shangai, China. Se basa en la epidemiología de infecciones del torrente sanguíneo causadas por Klebsiella, durante los años 2012 a 2016.
a) Describe two ways the researcher could minimise experimenter bias i.docxbickerstaffinell
a) Describe two ways the researcher could minimise experimenter bias in this study.
b) Describe a way the researchers could minimise sample bias in this study. (distinct from your answers in part a)
Nuclear import of SARS-CoV-2 nucleocapsid (N) protein is not inhibited by overmectin B.A. Loney* and M.A. Larkey* *Bundoora Institute for Applied Medical Research. Introduction The causative agent of the current COVID-19 pandemic, SARS-CoV-2, is a single stranded positive sense RNA virus that is closely related to severe acute respiratory syndrome coronavirus (SARS-CoV). It has been previously shown that SARS-CoV-2 nucleocapsid (N) is present in the cytoplasm but can also actively localize to the nucleolus where it can interact with host proteins and also bind to viral RNA. It has also been previously shown that nuclear import of similar nucleocapsid proteins (including the HIV-1 nucleocapsid protein, NC) from other RNA viruses can be inhibited by the drug overmectin resulting in decreased viral replication efficiency. There are multiple nuclear import pathways mediated by different receptors. The two most common nuclear import pathways are mediated by the importin / heterodimer or by the importin homodimer. Overmectin has previously been demonstrated to inhibit nuclear import by disrupting the importin / pathway. In this study SARS-CoV-2 nucleocapsid (N) was transfected into Hela cells and the effectiveness of overmectin at inhibiting its nuclear import was determined. Methods Expression of N protein in the absence of other viral proteins. To investigate the nuclear import of SARS-CoV-2 N protein three constructs were created. 1. pEGFP-NCov2. The N gene (from SARS-CoV-2, isolate BJ04) was cloned into the eukaryotic expression vector pEGFP-C1 (Promega) such that expression of the N gene was under the control of a cytomegalovirus (CMV) polymerase Il promoter to express an N protein fusion with the C-terminal of EGFP. 2. pEGFP. The pEGFP-C1 expression vector alone. 3. EEGFP-TRF1. A positive control for nuclear import. The human TRF1 gene was cloned into the eukaryotic expression vector pEGFP-C1 to express an N protein fusion with the C-terminal of EGFP. TRF1 nuclear localisation has shown to be mediated by the importin homodimer. Hela cells were cultured in 12 separate culture plates at a density of 1 0 5 cells per 9.6 cm 2 plate with each plate containing 2 coverslips. Cells were cultured using Cell Biologics' Culture Complete Growth Medium with 5\% foetal calf serum at 3 7 C and 5% CO 2 . Cells were transfected with 2 g of either pEGFPNCov2 (plates 1,4,7 and 10), pEGFP (plates 2, 5, 8 and 11) or pEGFP-TRF1 (3, 6, 9 and 12) and 50 g of Lipofectamine (GibcoBRL). 12 hours post-transfection, even numbered plates were treated with 5 M overmectin in DMSO and odd numbered plates were left untreated. After 24 hours coverslips were removed, and the cells fixed. DAPI was added to visualise the nuclei and the localisation of GFP determined by fluorescent mic.
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...Santhi Devasundaram
The demonstrated variable efficacy of the only licensed TB vaccine Mycobacterium
bovis bacillus CalmetteeGue´rin (M. bovis BCG) encourages the need for new vaccine candidates
against TB. Antigen specific cellular immune response is often considered imperative
during Mycobacterium tuberculosis (M. tuberculosis) infection and antigens that are strongly
associated with the latent phase of infection are drawing increasing attention for anti-TB vaccine
development. Here, we investigated the phenotypic and functional profiles of two novel
mycobacterial antigens Rv2251 and Rv2721c during T cell recall response via multi-color flow
cytometry.
Research and intuition tells us that with good choices in our live.docxrgladys1
Research and intuition tells us that with good choices in our lives, we can expect our cognitive health to remain good into late adulthood—and even then, changes do not have to be unmanageable. The kinds of relationships and the ways we interact in relationships may change from phase to phase of adulthood, but our need for strong relationships will remain important to well-being and to making good choices in life. After all, we derive happiness, in part, from offering support to others and from receiving their support for our plans and our actions.
Now that you have read and researched development over a lifespan, how has this helped you plan for positive growth over the next ten years?
Writing Requirements
· 1-2 page reflection
· Reference to concepts learned throughout the course
· APA format for in-text citations and list of references
For this assignments, you will select significant productions of plays (from a national theatre, or featuring important personnel) that feature a monster. As part of your research, you will write a short summary of your findings of each of the productions. This summary must address the following questions: WHAT was the play about (a brief synopsis)? WHEN and WHERE did it take place? WHO was involved? Anyone of renown? Did it affect their careers? WHAT did the production look/sound like? What were the artists trying to ACCOMPLISH? How was it REVIEWED? Was it popular? Controversial? Unnoticed? Did it win any awards? You must include references (cited) to at least two reviews (or, better yet, include copies of the reviews in your research).
IMPORTANT: Give a SOCIAL CONTEXT for the show. What was going on in the world that made it relevant? Why did THIS monster resonate, or fail to resonate, with its audience?
SOURCES include: Reviews, historical and/or scholarly articles, performance reconstructions, theater biographies, and specialized periodicals, Productions stills or other relevant images. You will need 3 good sources! Here’s a sample of what a production history looks like:
SAMPLE PRODUCTION HISTORY (not of a monster play)
WHAT = A RAISIN IN THE SUN
WHEN = 1959 – MARCH – 10
WHERE = U.S.A. – NEW YORK – ETHEL BARRYMORE THEATRE (BROADWAY)
WHO = LORRAINE HANSBERRY (AUTHOR)
LLOYD RICHARDS (DIRECTOR)
RALPH ALSWANG (SETS AND LIGHTING)
VIRGINIA VOLLAND (COSTUMES)
SIDNEY POITIER (ACTOR – “WALTER”)
RUBY DEE (ACTOR – “RUTH”)
LOUIS GOSSETT (ACTOR – “GEORGE”)
CRITICAL RECEPTION:
Considered the first naturalistic play featuring African-American themes and characters, Hansberry’s semiautobiographical Raisin is still acknowledged as a stunningly ground-breaking play in American theatre history. The story is that of the Lee family, upwardly-mobile African-Americans who encounter tough challenges trying to move into an all-white neighborhood of Chicago. In light of a growing discontent and radicalism in the marginalized and disenfranchised black community of the era, who were being .
research and explain the terms below. around 5-6 sentences EAC.docxrgladys1
research and explain the terms below.
around 5-6 sentences EACH term
Crime Displacement
Benign Displacement
Malign Displacement
Reppetto (1976) offers five forms of displacement: territorial, temporal, tactical, target, and functional
Barr and Pease (1990) offer perpetrator displacement: perpetrator displacement
Hot Spots
Weed and Seed
General Deterrence
Specific Deterrence
Requirements for Deterrence
.
More Related Content
Similar to RESEARCH ARTICLEPolyamine transporter potABCD is required.docx
Current situation of nanovaccines technology developmentDoriaFang
Rapid advances in nanotechnology over the past few decades have laid the foundation for the development of nanomedicine and vaccines. Compared with traditional vaccines, nanovaccines utilize a variety of nanoparticles and has significant advantages in delivery efficiency, dosage regimen, route of administration, adjuvant and vaccination effect. Currently, liposomes and lipid nanoparticles play a leading role in the clinical application of nanovaccine, indicating that the good biocompatibility and biosafety of nanomaterials are still indicators that cannot be ignored in the competition for next-generation nanovaccine.
Microbial Flora in Chronic Rhinosinusitis with and without Nasalpolyps by José Gameirodos Santos in Experiments in Rhinology & Otolaryngology
The most common microbial agents in the etiology of chronic rhinosinusitis are defined in the literature as Staphylococcus aureus, Staphylococcus coagulase-negative and Streptococcus spp. In healthy individuals these same microorganisms are also the most frequent (mainly Staphylococcus coagulase negative) ascolonizing flora agents. We often encounter a poly microbial colonization of the nose and sinuses. The contribution of the different pathogens for the disease remains sun certain. The aim of this study is to compare the microbial flora found in patients with chronic rhinosinusitis with and without nasal polyps.
Estudio realizado en Shangai, China. Se basa en la epidemiología de infecciones del torrente sanguíneo causadas por Klebsiella, durante los años 2012 a 2016.
a) Describe two ways the researcher could minimise experimenter bias i.docxbickerstaffinell
a) Describe two ways the researcher could minimise experimenter bias in this study.
b) Describe a way the researchers could minimise sample bias in this study. (distinct from your answers in part a)
Nuclear import of SARS-CoV-2 nucleocapsid (N) protein is not inhibited by overmectin B.A. Loney* and M.A. Larkey* *Bundoora Institute for Applied Medical Research. Introduction The causative agent of the current COVID-19 pandemic, SARS-CoV-2, is a single stranded positive sense RNA virus that is closely related to severe acute respiratory syndrome coronavirus (SARS-CoV). It has been previously shown that SARS-CoV-2 nucleocapsid (N) is present in the cytoplasm but can also actively localize to the nucleolus where it can interact with host proteins and also bind to viral RNA. It has also been previously shown that nuclear import of similar nucleocapsid proteins (including the HIV-1 nucleocapsid protein, NC) from other RNA viruses can be inhibited by the drug overmectin resulting in decreased viral replication efficiency. There are multiple nuclear import pathways mediated by different receptors. The two most common nuclear import pathways are mediated by the importin / heterodimer or by the importin homodimer. Overmectin has previously been demonstrated to inhibit nuclear import by disrupting the importin / pathway. In this study SARS-CoV-2 nucleocapsid (N) was transfected into Hela cells and the effectiveness of overmectin at inhibiting its nuclear import was determined. Methods Expression of N protein in the absence of other viral proteins. To investigate the nuclear import of SARS-CoV-2 N protein three constructs were created. 1. pEGFP-NCov2. The N gene (from SARS-CoV-2, isolate BJ04) was cloned into the eukaryotic expression vector pEGFP-C1 (Promega) such that expression of the N gene was under the control of a cytomegalovirus (CMV) polymerase Il promoter to express an N protein fusion with the C-terminal of EGFP. 2. pEGFP. The pEGFP-C1 expression vector alone. 3. EEGFP-TRF1. A positive control for nuclear import. The human TRF1 gene was cloned into the eukaryotic expression vector pEGFP-C1 to express an N protein fusion with the C-terminal of EGFP. TRF1 nuclear localisation has shown to be mediated by the importin homodimer. Hela cells were cultured in 12 separate culture plates at a density of 1 0 5 cells per 9.6 cm 2 plate with each plate containing 2 coverslips. Cells were cultured using Cell Biologics' Culture Complete Growth Medium with 5\% foetal calf serum at 3 7 C and 5% CO 2 . Cells were transfected with 2 g of either pEGFPNCov2 (plates 1,4,7 and 10), pEGFP (plates 2, 5, 8 and 11) or pEGFP-TRF1 (3, 6, 9 and 12) and 50 g of Lipofectamine (GibcoBRL). 12 hours post-transfection, even numbered plates were treated with 5 M overmectin in DMSO and odd numbered plates were left untreated. After 24 hours coverslips were removed, and the cells fixed. DAPI was added to visualise the nuclei and the localisation of GFP determined by fluorescent mic.
T cell recall response of two hypothetical proteins (Rv2251 and Rv2721c) from...Santhi Devasundaram
The demonstrated variable efficacy of the only licensed TB vaccine Mycobacterium
bovis bacillus CalmetteeGue´rin (M. bovis BCG) encourages the need for new vaccine candidates
against TB. Antigen specific cellular immune response is often considered imperative
during Mycobacterium tuberculosis (M. tuberculosis) infection and antigens that are strongly
associated with the latent phase of infection are drawing increasing attention for anti-TB vaccine
development. Here, we investigated the phenotypic and functional profiles of two novel
mycobacterial antigens Rv2251 and Rv2721c during T cell recall response via multi-color flow
cytometry.
Research and intuition tells us that with good choices in our live.docxrgladys1
Research and intuition tells us that with good choices in our lives, we can expect our cognitive health to remain good into late adulthood—and even then, changes do not have to be unmanageable. The kinds of relationships and the ways we interact in relationships may change from phase to phase of adulthood, but our need for strong relationships will remain important to well-being and to making good choices in life. After all, we derive happiness, in part, from offering support to others and from receiving their support for our plans and our actions.
Now that you have read and researched development over a lifespan, how has this helped you plan for positive growth over the next ten years?
Writing Requirements
· 1-2 page reflection
· Reference to concepts learned throughout the course
· APA format for in-text citations and list of references
For this assignments, you will select significant productions of plays (from a national theatre, or featuring important personnel) that feature a monster. As part of your research, you will write a short summary of your findings of each of the productions. This summary must address the following questions: WHAT was the play about (a brief synopsis)? WHEN and WHERE did it take place? WHO was involved? Anyone of renown? Did it affect their careers? WHAT did the production look/sound like? What were the artists trying to ACCOMPLISH? How was it REVIEWED? Was it popular? Controversial? Unnoticed? Did it win any awards? You must include references (cited) to at least two reviews (or, better yet, include copies of the reviews in your research).
IMPORTANT: Give a SOCIAL CONTEXT for the show. What was going on in the world that made it relevant? Why did THIS monster resonate, or fail to resonate, with its audience?
SOURCES include: Reviews, historical and/or scholarly articles, performance reconstructions, theater biographies, and specialized periodicals, Productions stills or other relevant images. You will need 3 good sources! Here’s a sample of what a production history looks like:
SAMPLE PRODUCTION HISTORY (not of a monster play)
WHAT = A RAISIN IN THE SUN
WHEN = 1959 – MARCH – 10
WHERE = U.S.A. – NEW YORK – ETHEL BARRYMORE THEATRE (BROADWAY)
WHO = LORRAINE HANSBERRY (AUTHOR)
LLOYD RICHARDS (DIRECTOR)
RALPH ALSWANG (SETS AND LIGHTING)
VIRGINIA VOLLAND (COSTUMES)
SIDNEY POITIER (ACTOR – “WALTER”)
RUBY DEE (ACTOR – “RUTH”)
LOUIS GOSSETT (ACTOR – “GEORGE”)
CRITICAL RECEPTION:
Considered the first naturalistic play featuring African-American themes and characters, Hansberry’s semiautobiographical Raisin is still acknowledged as a stunningly ground-breaking play in American theatre history. The story is that of the Lee family, upwardly-mobile African-Americans who encounter tough challenges trying to move into an all-white neighborhood of Chicago. In light of a growing discontent and radicalism in the marginalized and disenfranchised black community of the era, who were being .
research and explain the terms below. around 5-6 sentences EAC.docxrgladys1
research and explain the terms below.
around 5-6 sentences EACH term
Crime Displacement
Benign Displacement
Malign Displacement
Reppetto (1976) offers five forms of displacement: territorial, temporal, tactical, target, and functional
Barr and Pease (1990) offer perpetrator displacement: perpetrator displacement
Hot Spots
Weed and Seed
General Deterrence
Specific Deterrence
Requirements for Deterrence
.
Research and identify characteristics of two low‐tech and two high t.docxrgladys1
Research and identify characteristics of two low‐tech and two high tech assistive technology devices appropriate for individuals with disabilities that can be used to assist with reading, writing, listening, or oral communication.
For this assignment, complete the "Assistive Technology Device Matrix."
Support your findings with a minimum of two scholarly resources.
This assignment uses a rubric. Review the rubric prior to beginning the assignment to become familiar with the expectations for successful completion.
.
Research and explain the types of insurances and how they are .docxrgladys1
Research and explain the types of insurances and how they are acquired:
Medicare
Medicaid
Private/Commercial
Other (self pay) / Government
Discuss the pros’ and cons’ in regards to the reimbursements/financial aspects to providers
Example – comparing reimbursement rates on a basic visit coded 99213
Procedure reimbursement rates between insurances
Requirements: 2-4 pages (not including title/reference page) APA Format
Submit your completed assignment to the drop box below. Please check the Course Calendar for specific due dates.
.
Research and discuss a well known public incident response or data b.docxrgladys1
Research and discuss a well known public incident response or data breach to include how the system was compromised and how the problem was remediated or what could have been done to prevent the intrusion or the compromise of the data before it happened.
Resources:
Any digital forensic forum or blog such as
Forensic Focus (Links to an external site.)
,
SANS Digital Forensics Blog (Links to an external site.)
, or the
Magnet Forensics Blog (Links to an external site.)
.
.
Research and discuss the classifier accuracy concepts- Confu.docxrgladys1
Research and discuss the classifier accuracy concepts
- Confusion Matrix
- Classifier Accuracy
- Why Accuracy is not enough especially for imbalanced datasets?
- What is Precision and Recall
- What is an RoC
- What is AuC
Site references for your explanation - use numerical examples
write in 500 words use APA format.
on time delivery.
plagiarism free.
.
Research and discuss the differences and importance ofIPPSOPPS.docxrgladys1
Research and discuss the differences and importance of:
IPPS
OPPS
MPFS
DMEPOS
1. Which type is paid by which method?
2. What are the payment expectations for each type?
3. What is the potential implication of a case mix involving IPPS, OPPS, and DMEPOS for a small hospital?
.
Research and discuss the differences and importance of IPPS, OPPS,.docxrgladys1
Research and discuss the differences and importance of : IPPS, OPPS, MPFS and DMEPOS. Which provider type is paid by which method? What are the payment expectations for each type? What is the potential implication of a case mix involving IPPS, OPPS and DMEPOS for a small hospital?
Remember that you MUST have at least 2 credible sources
.
Research and discuss about each of the following cybersecurity hot.docxrgladys1
Research and discuss about each of the following cybersecurity hot topics thoroughly:
· Secure Passwords
· Malware
· Privacy
· Data Breaches
· Safe Computing
· Online Scams
· Mobile Protection
· IoT
· Insider Threats
Each of the hot topics must be explored in the following manner:
1. Mention how and why they are important to the field of cybersecurity
2. Why is it critical to understand them? And what value do they provide
3. Provide scenarios on how understanding the topic can prevent threats and vulnerabilities
4. Utilize graphs and screenshots to further elaborate
.
Research and discuss database management systems and the history.docxrgladys1
Research and discuss database management systems and the history. What are the different database management systems, other than SQL Server? What are some advantages and disadvantages of using products other than SQL Server DBMS? What roles and responsibilities are required for various DBMS?
.
Research and develop an MS Word document of at least 1200 word that.docxrgladys1
Research and develop an MS Word document of at least 1200 word that:
1) Discusses a renewable/sustainable energy project in the U.S.
2) The paper must include the background/history of the project. Who are the champions of the project? Who are the beneficiaries of the project? Is there an economical impact? Your opinion of the sustainability of the project.
3) State whether you are for or against the the effort and why.
4) Write a one or two paragraph conclusion stating what would you say to a decision maker to persuade them.
.
Research and analyze using scholarly resources.Lengthformat .docxrgladys1
Research and analyze using scholarly resources.
Length/format: 2 pages (excluding references), APA format.
Include:
summary
problem
significance of the problem
two alternative actions
recommendation
reference page
The Passenger Facility Charge (PFC) Program was implemented as part of the Aviation Safety and Capacity Act of 1990. Read the following two documents highlighting the original intent and current debate surrounding the PFC Program:
https://airwaysmag.com/airports/op-ed-should-passenger-facility-charges-be-increased/
https://scholar.smu.edu/cgi/viewcontent.cgi?referer=https://www.google.com/&httpsredir=1&article=1382&context=jalc
Prepare a case analysis titled: "PFCs: Pros or Cons - Should They Be Raised to Pay for 21st Century Airport Infrastructure?"
.
Research and discuss a particular type of Malware and how has it b.docxrgladys1
Research and discuss a particular type of Malware and how has it been used in "today's news" and the respective impact on cybersecurity. Add to your discussion ways the Malware could have been detected and potentially avoided.
1. No plag
2. 250-300 words with citations.
.
Research and develop an understanding of the followingUSA.docxrgladys1
Research
and develop an understanding of the following:
USA PATRIOT Act of 2001
Domestic Security Enhancement Act of 2003
Homeland Security Act of 2002
Choose
one of the acts to focus on and then identify an event that falls within the jurisdiction of that act. To find pertinent information for this assignment, the event chosen should have culminated in an arrest or other conclusion, and adjudication should be complete, or the case closed (cold cases are not acceptable).
Create
a 10- to 12-slide Microsoft® PowerPoint® presentation with detailed speaker notes in which you:
Summarize the event, including the who, what, where, when, and how. Discuss how the offender was caught.
Identify technological, methodological, and criminological points of interest in the case, including offender typology and profile, to align with the best theory as defined in previous weeks, including physical, biological, psychological, social structure, social processes and development, and social conflict.
Describe the use of technology, DNA, forensics, biometrics, and any other criminal identification tool used in the case.
Discuss what impact crime and global crimes, such as human trafficking, have on crime control policies.
In your conclusion, discuss how the evolution of policing might affect social policy from national and international perspectives and consider how the evolving technologies relate to national and international policymaking.
Cite
at least two academic references according to APA guidelines.
.
Research and discuss a well known public incident response or da.docxrgladys1
Research and discuss a well known public incident response or data breach to include how the system was compromised and how the problem was remediated or what could have been done to prevent the intrusion or the compromise of the data before it happened.
Resources:
Incident Response & Computer Forensics, 3rd Edition
Any digital forensic forum or blog such as
Forensic Focus (Links to an external site.)
,
SANS Digital Forensics Blog (Links to an external site.)
, or the
Magnet Forensics Blog (Links to an external site.)
.
.
Research and develop a MS Word document of at least 2000 word th.docxrgladys1
Research and develop a MS Word document of at least 2000 word that:
1) Discusses a comparison of various Biometric Access Tools or Biometric IT Safeguards
2) The paper must include the background/history of the tools, their uses and applications. Compare at least three (3) different tools.
3) Discuss your thoughts on other places that you would uses these tools.
.
Research and develop a MS Word document of at least 1200 word that.docxrgladys1
Research and develop a MS Word document of at least 1200 word that:
1) Discusses the Digital Divide in the in the U.S. and internationally.
2) The paper must include the background/history of the project. What are some of the causes of the divide? What efforts are engaged to reduce the divide? What are things you can do personally?
3) State whether you believe that there is a "digital divide" and why.
4) Write a one or two paragraph conclusion stating what would you say to a decision maker to persuade them to support or disregard the digital divide..
.
Research and develop a MS Word document of at least 2000 words that.docxrgladys1
Research and develop a MS Word document of at least 2000 words that:
1) Discusses the Digital Divide in the in the U.S. and internationally.
2) The paper must include the background/history of the project. What are some of the causes of the divide? What efforts are engaged to reduce the divide? What are things you can do personally?
3) State whether you believe that there is a "digital divide" and why.
4) Write a one or two paragraph conclusion stating what would you say to a decision maker to persuade them to support or disregard the digital divide.
.
Research and define human error and explain, with supporting.docxrgladys1
Research and define
human error and
explain
, with supporting details, the HFACS method used to classify human error and how
HFACS can be both reactive and proactive
.
Must be APA and have a title page, 300-word body written in the third person, and at least two references.
.
Research and describe your Coco cola companys business activities.docxrgladys1
Research and describe your Coco cola company's business activities on below topics
1)Future direction,
2)Other items of significance to your corporation.
submit a written report that is 2 pages long. The report should be well written with cover page, introduction, the body of the paper (with appropriate subheadings), conclusion, and reference page. References must be appropriately cited. Format: Double-spaced, one-inch margins, using a 12-point Times New Roman font. Use APA format throughout.
.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
Normal Labour/ Stages of Labour/ Mechanism of LabourWasim Ak
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Unit 8 - Information and Communication Technology (Paper I).pdfThiyagu K
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
Synthetic Fiber Construction in lab .pptxPavel ( NSTU)
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
RESEARCH ARTICLEPolyamine transporter potABCD is required.docx
1. RESEARCH ARTICLE
Polyamine transporter potABCD is required
for virulence of encapsulated but not
nonencapsulated Streptococcus pneumoniae
Haley R. Pipkins, Jessica L. Bradshaw, Lance E. Keller
¤
, Edwin Swiatlo, Larry
S. McDaniel*
Department of Microbiology and Immunology, University of
Mississippi Medical Center, Jackson, Mississippi,
United States of America
¤ Current address: Department of Molecular Genetics,
University of Groningen, Nijenborgh, Groningen, The
Netherlands
* [email protected]
Abstract
Streptococcus pneumoniae is commonly found in the human
nasopharynx and is the causa-
tive agent of multiple diseases. Since invasive pneumococcal
infections are associated with
2. encapsulated pneumococci, the capsular polysaccharide is the
target of licensed pneumo-
coccal vaccines. However, there is an increasing distribution of
non-vaccine serotypes,
as well as nonencapsulated S. pneumoniae (NESp). Both
encapsulated and nonencapsu-
lated pneumococci possess the polyamine oligo-transport operon
(potABCD). Previous
research has shown inactivation of the pot operon in
encapsulated pneumococci alters pro-
tein expression and leads to a significant reduction in
pneumococcal murine colonization,
but the role of the pot operon in NESp is unknown. Here, we
demonstrate deletion of potD
from the NESp NCC1 strain MNZ67 does impact expression of
the key proteins pneumoly-
sin and PspK, but it does not inhibit murine colonization.
Additionally, we show the absence
of potD significantly increases biofilm production, both in vitro
and in vivo. In a chinchilla
model of otitis media (OM), the absence of potD does not
significantly affect MNZ67 viru-
lence, but it does significantly reduce the pathogenesis of the
virulent encapsulated strain
3. TIGR4 (serotype 4). Deletion of potD also significantly reduced
persistence of TIGR4 in the
lungs but increased persistence of PIP01 in the lungs. We
conclude the pot operon is impor-
tant for the regulation of protein expression and biofilm
formation in both encapsulated and
NCC1 nonencapsulated Streptococcus pneumoniae. However, in
contrast to encapsulated
pneumococcal strains, polyamine acquisition via the pot operon
is not required for MNZ67
murine colonization, persistence in the lungs, or full virulence
in a model of OM. Therefore,
NESp virulence regulation needs to be further established to
identify potential NESp thera-
peutic targets.
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 1 / 19
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
5. within the paper and supporting information files.
Funding: This study was funded by institutional
research funds. There was no additional external
funding received for this study.
Competing interests: The authors have declared
that no competing interests exist.
https://doi.org/10.1371/journal.pone.0179159
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.
0179159&domain=pdf&date_stamp=2017-06-06
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.
0179159&domain=pdf&date_stamp=2017-06-06
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.
0179159&domain=pdf&date_stamp=2017-06-06
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.
0179159&domain=pdf&date_stamp=2017-06-06
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.
0179159&domain=pdf&date_stamp=2017-06-06
http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.
0179159&domain=pdf&date_stamp=2017-06-06
https://doi.org/10.1371/journal.pone.0179159
https://doi.org/10.1371/journal.pone.0179159
http://creativecommons.org/licenses/by/4.0/
Introduction
Streptococcus pneumoniae (the pneumococcus) is a gram
positive coccus that colonizes the
nasopharynx of humans [1]. Although colonization is typically
6. asymptomatic, the organism
can gain access to normally sterile sites and cause illnesses such
as pneumonia, otitis media
(OM), sinusitis, bacteremia, and meningitis [2]. In young
children, the elderly, and immuno-
compromised patients, these pneumococcal infections can lead
to serious complications or
even death [3]. Pneumococcal strains can be typed using either
multilocus sequence typing
(MLST) or by serotyping of the polysaccharide capsule [4].
Strains that lack serological evi-
dence of capsule expression are divided into two
nonencapsulated S. pneumoniae (NESp)
groups [5]. Group I includes NESp that have a mutated,
dysfunctional variant of the character-
istic capsule polysaccharide biosynthetic (cps) locus, while
group II includes NESp whose cps
genes are replaced by novel genes that code for distinct
pneumococcal proteins [6,7].
Currently, there are two licensed pneumococcal vaccines used
in the United States: Pre-
vnar13 and Pneumovax [8]. Because most invasive
pneumococcal infections are associated
with encapsulated pneumococci, these vaccines target the
capsular polysaccharide of 13 or 23
7. invasive disease-associated capsular serotypes, respectively [9].
However, non-invasive pneu-
mococcal disease rates remain high even with vaccine
implementation. For example, middle
ear infections are the most frequent condition for which
antibiotic treatment is prescribed to
children under the age of five in the U.S., and S. pneumoniae is
the leading cause of acute bacte-
rial OM [10–12]. This inefficiency is likely due to selective
pressure against the pneumococcal
capsule resulting in capsular alterations in vaccine serotypes
and increased colonization by
non-vaccine serotypes and NESp [13–15]. A recent study in
Japan analyzed pneumococcal
isolates taken from the nasopharynges of children with OM, and
of those isolates 6.4% were
NESp [16]. The distribution of NESp will likely continue to
escalate as selective pressure is
placed on encapsulated strains. Since current vaccines do not
protect against NESp strains, it is
important to identify new targets that will protect against both
encapsulated and nonencapsu-
lated pneumococci.
All sequenced pneumococcal isolates, whether encapsulated or
NESp, possess the poly-
8. amine oligo-transport operon (potABCD) [17]. A proposed
description of each operon compo-
nent is as follows: PotA is an ATP binding protein that couples
polyamine translocation with
ATP hydrolysis, PotBC compose an α-helical transmembrane
polypeptides with hydrophobic
domains, and PotD is a membrane protein responsible for
binding extracellular polyamines
[18]. Polyamines are cationic organic compounds that are found
ubiquitously in nature and
are essential for normal cell growth of both eukaryotic and
prokaryotic cells [19,20]. The role
of polyamine acquisition and biosynthesis in bacterial growth
and virulence has recently been
investigated, and it has been determined that these pathways are
integral to bacterial fitness
and pathogenesis [21–23]. Additionally, all four genes of the
operon are essential for operon
function, as mutation or deletion of any one of the genes
nullifies activity [24].
Analyses have shown the deletion of potD in encapsulated
pneumococcal isolates signifi-
cantly reduces their ability to colonize and cause disease [25].
The pot operon and the trans-
port of polyamines also appears to be necessary for regulation
of certain encapsulated
9. pneumococcal virulence factors, such as pneumolysin and
capsule [17,18]. Furthermore,
immunization with recombinant PotD both reduces
pneumococcal nasopharyngeal coloniza-
tion and prevents systemic pneumococcal infection in a mouse
model [26–28]. However, the
effects of a potD mutant in NESp have not yet been established.
If potD deletion reduces NESp
virulence as efficiently as it does in encapsulated pneumococci,
then PotD could potentially be
a therapeutic target against both types of pneumococci. Since
the pot operon has thus far been
identified in all sequenced pneumococci, increased prevalence
of non-vaccine strains could be
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 2 / 19
https://doi.org/10.1371/journal.pone.0179159
controlled by targeting PotD. The rationale for this study was
therefore to determine the role
of the pot operon in the virulence and pathogenesis of NESp
subgroup NCC1.
Materials and methods
10. Bacterial strains and growth conditions
Descriptions of bacterial strains used for this work are listed in
Table 1. All pneumococcal
strains were grown at 37˚C in 5% CO2 in Todd-Hewitt medium
with 0.5% yeast extract (THY)
or on blood agar base supplemented with 5% sheep blood (BA).
Mutant strains were grown in
the presence of the appropriate antibiotic selection as indicated
in Table 1. For all experiments,
strains were grown to an OD600 of 0.3. Bacterial lysates were
prepared by suspending 1.5 ml
pelleted bacteria in 150 μl lysis buffer (0.01% sodium dodecyl
sulfate, 0.1% sodium deoxycho-
late, and 0.015 M sodium citrate), incubating the suspension at
37˚C for 30 minutes, and
then diluting the mixture with 150 μl phosphate-buffered saline
(PBS). Plasmid DNA was
extracted from Escherichia coli using a plasmid miniprep kit
following manufacturer’s proto-
cols (Qiagen).
PCR amplification
Polymerase chain reaction (PCR) amplification was used to
isolate a kanamycin resistance cas-
sette from pneumococcal strain DAR831ΔAR4 (donated by Dr.
Ashley Robinson at The Uni-
veristy of Mississippi Medical Center) (primers 5 and 6). PCR
11. was also used to amplify a 750
bp segment upstream of potD (primers 1 and 2) and a 700 bp
segment downstream from potD
(primers 3 and 4) from the NESp isolate MNZ67. These three
fragments were combined using
sequence overlap extension (SOE), and the full-length fragment
was amplified using PCR
(primers 1 and 4) [29]. PCR was additionally used to amplify
potD from MNZ67 (primers 7
and 8), which was cloned into the spectinomycin resistant
plasmid pNE1 to generate pNE1::
potD. Products less than 1 kb were amplified using GoTaq DNA
Polymerase (Promega) and
products greater than 1 kb were amplified using Phusion High
Fidelity DNA Polymerase
(Thermo-Scientific). Cycling parameters recommended by the
manufacturers and an anneal-
ing temp of 55˚ were used for the amplification process, and
size of amplified products was
verified by electrophoresis on an 0.8% agarose gel with EtBr
staining. All primers used for
these studies are listed in Table 2.
Construction of mutant strain
An isogenic potD deletion mutant (PIP01) of MNZ67 was
constructed by allelic replacement
of the potD gene with a kanamycin resistance cassette flanked
12. by the upstream and down-
stream regions of potD (see PCR amplification for details).
MNZ67 grown in competence
media (THY containing .02% CaCl, .04% glucose, and .2%
BSA) was activated with 200 ng of
Table 1. Description of strains used for the studies described in
this manuscript.
Strain Strain Description
MNZ67 PspK
+
Group II NESp (Subgroup NCC1); source of potD
PIP01 MNZ67 isogenic ΔpotD mutant (KanR)
PIP02 PIP01 transformed with pNE1:: potD (Spec
R
)
TIGR4 (T4) Virulent encapsulated pneumococcal isolate
(serotype 4)
T4 ΔpotD TIGR4 isogenic ΔpotD mutant (ErmR)
DAR831ΔAR4 Encapsulated pneumococcus; source of KanR
cassette (Serotype 12F)
https://doi.org/10.1371/journal.pone.0179159.t001
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 3 / 19
13. https://doi.org/10.1371/journal.pone.0179159.t001
https://doi.org/10.1371/journal.pone.0179159
each of competence stimulating peptide 1 and 2 (CSP 1 and CSP
2) for 12 min followed by
transformation with 500 ng of the kanamycin SOE construct for
3 hours. Selection for ΔpotD
mutants was done by plating on BAP containing 500 μg/ml
kanamycin. Complementation
of potD in PIP01 was achieved by transforming PIP01 with
pNE1::potD under previously
described conditions, generating PIP02. Successful
transformants were selected by plating on
BA containing 300 μg/ml spectinomycin.
Real time PCR
Bacterial cultures were grown to an OD600 of 0.3. Cells were
pelleted by centrifugation and
enzymatically lysed with 200 μl TE buffer (10 mM Tris, 1 mM
EDTA) containing 3 mg/ml
lysozyme. Bacterial RNA was purified using a Qiagen RNeasy
Mini kit, and collected RNA was
treated with RQ1 DNase (Promega) following manufacturer’s
protocol. RNA concentrations
were determined using a Qubit 2.0 fluorometer. RT-qPCR was
performed using 200 ng total
RNA, a Luna Universal One-Step RT-qPCR Kit (New England
Biolabs), and gene specific
14. primers. Primers 9 and 10 were used for pspK and primers 11
and 12 were used for gyrA,
which served as an internal control. A no template sample was
used as a negative control. Sam-
ples were analyzed using an iCycler iQ Real-Time PCR
Detection System (Biorad), and the
ΔΔCT method was used to calculate the fold-change in gene
expression.
Protein standardization
A standard bicinchoninic acid (BCA) assay protocol [30] was
used to quantify total protein
concentration of bacterial lysates. Protein concentrations were
determined by reading samples
on an xMark microplate spectrophotometer (BioRad) at OD570.
Lysates were standardized to
equivalent protein amounts by diluting with sterile PBS.
Hemolysis assay
Standardized bacterial lysates were serially diluted in 96-well
round bottom plates containing
100 μl DTT buffer (10 ml PBS, 0.01g BSA, 0.015g DTT) in
each well. Hemolysis was deter-
mined by adding 50 μl of PBS containing 1% sheep red blood
cells (RBCs) to each well, fol-
lowed by incubation at 37˚C in 5% CO2 for 30 minutes. Triton
X-114 served as the positive
15. control, and PBS was used as the negative control. The plate
was centrifuged at 500 x g for 5
minutes. 100 μl of supernatant was removed from each well and
transferred to a 96-well flat
Table 2. Names and sequences of primers used in these studies.
Reference Number Primer Name Primer Sequence (5’ to 3’)
1 potD upstream F TGG GAC TGG TCT TTC TGG TCC TCT
2 potD upstream R CAT TAT CCA TTA AAA ATC AAC GGG
CTT GCT CCT CCT TCT CAC GA
3 potD downstream F TAC CTA TAA TTC ACC AAA AAT
AAA AGA G ATA AAC GTA AGA AGA CGA ATC AG
4 potD downstream R
AACTTGTCATTCTCTTGTTCTTATGCAATTGTA
5 Kan F CCG TTG ATT TTT AAT GGA TAA TG
6 Kan R TTT TAT TTT TGG TGA ATT ATA GGT A
7 potD F GCG GCA TGC GAG AGG AGA GAA A ATG AAA
AAA ATC TAT TCA TTT TTA GCA GG
8 potD R GCG CTG CAG CTA CTT CCG ATA CAT TTT AAA
CTG
9 PspK F RT CTGTGAAAGCAGAGATGGCA
10 PspK R RT CCTCAGCAACCTTGCTCTTT
16. 11 GyrA F RT GCGAGCTCTTCCTGATGTTC
12 GyrA R RT GGGTCACACCCAATTCATTC
https://doi.org/10.1371/journal.pone.0179159.t002
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 4 / 19
https://doi.org/10.1371/journal.pone.0179159.t002
https://doi.org/10.1371/journal.pone.0179159
bottom plate. The plate was read at OD450 on an xMark
microplate spectrophotometer
(BioRad), and percent lysis was normalized to lysis by
detergent set at 100%. Samples were
plated in triplicate and three independent experiments were
performed.
Production of pneumolysin (Ply) and pneumococcal surface
protein K
(PspK)
ELISA. Protein levels of both Ply and PspK were determined
using a standard indirect
ELISA protocol. Blocking buffer used consisted of PBST and
1% BSA. Polyclonal rabbit anti-
Ply or rabbit anti-PspK serum was used as the primary antibody.
17. Secondary antibody for all
assays was a polyclonal, biotinylated donkey anti-rabbit IgG
combined with streptavidin-con-
jugated alkaline phosphatase. Protein was visualized by addition
of P-nitrophenyl phosphate
and plates were read at OD405 on an xMark microplate
spectrophotometer (BioRad). Protein
levels were normalized to wild type (WT) MNZ67 set at 100%
expression. All samples were
analyzed in triplicate and three independent experiments were
performed.
Flow cytometry. PspK was further examined using flow
cytometry. Approximately 10
7
mid-log phase bacteria were pelleted by centrifugation,
suspended in PBS containing rabbit
anti-PspK serum, and incubated for 30 minutes at 37˚C [31].
Pneumococcal cells were fluores-
cently labeled by incubation for 30 minutes at room temperature
with biotinylated polyclonal
donkey anti-rabbit IgG combined with streptavidin-conjugated
Alexa Flour 488. Bacteria were
washed three times in sterile PBS after each incubation step and
surface expressed PspK was
18. analyzed using a Becton Dickinson flow cytometer with gate set
to 25,000 bacteria.
Biofilm formation
Biofilm production was determined by seeding a 24-well plate
with 10
5
CFU of bacteria in 1
ml of THY containing 8 units/ml catalase and 10% horse serum.
The plate was incubated for
24 hours at 37˚C in 5% CO2. The media was removed and each
well was stained with 350 μl
0.1% crystal violet for 30 minutes at room temperature. The
excess crystal violet was carefully
removed and the remaining crystal violet was solubilized in 1
ml 100% ethanol for 10 minutes
with shaking. The plate was read at OD630 on an xMark
microplate spectrophotometer
(BioRad). All samples were assayed in triplicate and
experiments were performed three inde-
pendent times.
Epithelial cell adhesion and invasion
Human A549 (ATCC
1
CCL-185™ retrieved from Dr. Stephen Stray at University of
19. Missis-
sippi Medical Center) and Detroit 562 (ATCC
1
CCL-138™ retrieved from Dr. Justin Thornton
at Mississippi State University) epithelial cells were grown to
95% confluency in Eagle’s mini-
mal essential medium (EMEM) supplemented with 10% fetal
calf serum (FCS) and containing
100 μg/ml penicillin, 100 μg/ml amphotericin B, and 50 μg/ml
streptomycin. Epithelial cells
were cultured in 24 well plates at 37˚C in 5% CO2. For
adhesion and invasion assays, epithelial
cells were rinsed 3 times in sterile PBS and incubated with 1x10
7
bacteria suspended in 1 ml of
EMEM without antibiotics. The plates were incubated for 30
minutes for adherence or 2 hours
for invasion and then washed 3 times with sterile PBS. For
adhesion, cells were trypsinized
with 100 μl 0.25% trypsin-EDTA, and the total volume was
brought up to 1 ml by adding
900 μl PBS. For invasion, cells were incubated for an additional
hour in 1 ml of EMEM con-
taining 100 μg/ml penicillin, 100 μg/ml amphotericin B, and 50
μg/ml streptomycin. Cells
were washed 3 times in PBS, detached using 100 μl 0.25%
trypsin-EDTA, and then lysed in
20. 100 μl 0.0125% Tritin X-100. All samples were plated on BA to
enumerate bacteria. Three
independent experiments were performed and all samples were
done in triplicate.
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 5 / 19
https://doi.org/10.1371/journal.pone.0179159
Murine nasopharyngeal colonization
Six to eight week old C57BL/6 mice (n = 5) were briefly
anesthetized with isoflurane and intra-
nasally inoculated with 1x10
7
CFU pneumococci suspended in 10 μl sterile PBS. Mice were
euthanized 5 days post infection by cervical dislocation, and the
nasopharyngeal passage was
washed with 200 μl sterile PBS. The skull was denuded, and the
nasopharyngeal tissues and
bullae were independently collected and homogenized in 200 μl
sterile PBS. Samples were
plated on BA to enumerate CFU. Animal studies performed
were in accordance with protocols
approved by the Institutional Animal Care and Use Committee
of the University of Mississippi
Medical Center. The physical condition of the mice was
21. monitored daily by licensed veterinar-
ians, and all measures to minimize suffering during handling
and euthanasia were taken.
Murine pneumonia
Adult C57BL/6 mice (n = 5) of were anesthetized by
intraperitoneal injection of 500 μl of Aver-
tin (2.5% amylene hydrate solution containing 6.25 mg
tribromoethanol). Mice were intratra-
cheally inoculated with 1x10
7
CFU pneumococci and were euthanized by cervical dislocation
two days post infection. The lungs were collected and
homogenized in 2 ml sterile PBS. Sam-
ples were plated on blood agar to enumerate CFU. Animal
studies performed were in accor-
dance with protocols approved by the Institutional Animal Care
and Use Committee of the
University of Mississippi Medical Center. The physical
condition of the mice was monitored
daily by licensed veterinarians, and all measures to minimize
suffering during handling and
euthanasia were taken.
Chinchilla otitis media
22. Young adult chinchillas (Chinchilla lanigera, 400–500 g body
weight) were inoculated in
each bulla via transbullar injection with 1x10
7
CFU pneumococci suspended in 100 μl PBS
containing 0.04% gelatin. Prior to infection, an otoscope was
used to examine the animals’
tympanic membranes. Chinchillas were euthanized 4 days post
infection in a CO2 chamber,
and tympanic pathology was scored through otoscopic
examination as follows: 0 = none,
1 = inflammation, 2 = effusion, and 3 = tympanic rupture. The
skin was removed from the
top of the head, and the middle ear was accessed by cutting a
small hole in the top of the
bulla. Visible biofilm formation was scored as follows: 0 =
none, 1 = surface formation,
2 = traverses bulla, and 3 = traverses bulla with thickening.
Exudate was collected and each
bulla was washed with 1 ml sterile PBS. Whole bullae were
removed and homogenized in 10
ml PBS. All samples were plated on BA to enumerate CFU.
Animal studies performed were
in accordance with protocols approved by the Institutional
Animal Care and Use Committee
23. of the University of Mississippi Medical Center. The
chinchillas’ physical conditions were
monitored daily by licensed veterinarians, and all measures to
minimize suffering during
handling and euthanasia were taken.
Statistical analysis
Data was compared using a Student’s t test with Prism 5
software (GraphPad Software, Inc.,
San Diego, CA).
Results
Ply activity and production
We examined the effects of potD deletion on the synthesis and
function of the pneumococcal
pore-forming toxin Ply. Hemolysis assays were performed to
examine the differences in
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 6 / 19
https://doi.org/10.1371/journal.pone.0179159
hemolytic potential between MNZ67 and PIP01. A significant
reduction in RBC lysis was
observed by PIP01, whereas WT MNZ67 lysed the RBCs as
24. levels equivalent to the detergent
control set at 100% (Fig 1A). To confirm the reduction in
hemolytic potential was due to lower
production of Ply, an ELISA was performed to establish Ply
concentration. PIP01 bacterial
lysates had significantly lower levels of Ply than WT MNZ67
(Fig 1B). Together, these results
indicate Ply synthesis is reduced in the absence of a functional
pot operon and correlate with
data obtained from similar experiments using T4.
PspK analysis
PspK has thus far only been found in a subset of group II NESp
designated NCC1, in which
pspK replaces capsule synthesis genes [5,32]. PspK is known to
increase epithelial cell adhesion
and has been implicated in increased nasopharyngeal
colonization, as well as enhanced acute
OM [31,33]. We examined the effects of potD deletion on PspK
production in the NESp
MNZ67 using an ELISA to determine relative PspK
concentrations. In comparison to MNZ67,
PIP01 had significantly higher concentrations of PspK (Fig 2A).
To confirm these results, we
also utilized RT-qPCR to analyze pspK expression. In
correlation with our ELISA results, we
25. observed a significant fold change in pspK in PIP01 (Fig 2B).
Since PspK is a surface protein,
we wanted to determine if the increased PspK observed in PIP01
was actually present on the
surface of viable pneumococci. The amount of surface-
associated PspK was assessed by flow
cytometry. Interestingly, there was not a significant difference
in fluorescence intensity, signi-
fying there was no difference in surface expressed PspK (Fig
2C). Taken together, these results
indicate the absence of potD impacts the production of PspK.
Fig 1. Ply activity and expression. Effects of potD deletion on
hemolytic activity were assessed via hemolysis assay, in which
pneumococcal lysates were incubated with sheep RBCs and
lysis was monitored. Lysis by Triton X-114 was set at 100%.
Effects on Ply
synthesis were determined using a standard indirect ELISA, in
which WT values were set at 100%. Deletion of potD from
MNZ67
significantly reduced hemolytic potential (A). A significant
reduction in Ply production was also observed upon deletion of
potD (B). All
samples were analyzed in triplicate and experiments were
performed at least 3 times. Error bars denote standard error of
the mean.
https://doi.org/10.1371/journal.pone.0179159.g001
26. Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 7 / 19
https://doi.org/10.1371/journal.pone.0179159.g001
https://doi.org/10.1371/journal.pone.0179159
Fig 2. PspK analysis. PspK was quantified in pneumococcal
lysates by an indirect ELISA, and pspK expression was
determined via
RT-qPCR. Surface-expressed PspK was assessed by flow
cytometry. Significantly more PspK was produced in potD
mutant PIP01
when compared to wild type MNZ67 (A). Additionally,
significantly higher pspK expression was seen in PIP01 (B).
Although increased
PspK was observed, no difference was seen in surface
associated PspK (C). The ELISA was performed at least three
times, and each
sample was analyzed in triplicate. RT-qPCR was performed
three independent times and data was analyzed using the ΔΔCT
method.
Flow cytometry was performed twice. Error bars denote
standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g002
Polyamine transport and virulence of Streptococcus pneumoniae
27. PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 8 / 19
https://doi.org/10.1371/journal.pone.0179159.g002
https://doi.org/10.1371/journal.pone.0179159
Complementation of potD expression
To validate results, potD was restored in PIP01, and production
of Ply and PspK was analyzed
via ELISA. Expression of potD was complemented into PIP01
via transformation with pNE1::
potD to generate the strain PIP02. Whereas deletion of potD
resulted in increased PspK expres-
sion and decreased Ply expression (Figs 1 and 2), restoration of
potD resulted in decreased
PspK expression (Fig 3A) and increased Ply expression (Fig
3B). Furthermore, Ply levels were
significantly greater than WT, while PspK levels were
significantly lower than WT (Fig 3).
Epithelial cell adhesion and invasion
Adhesion and invasion of epithelial cells is a key component of
pneumococcal pathogenesis.
Since an increase in the adhesive protein PspK was observed in
PIP01, we analyzed whether or
not adhesion to human epithelial cells was also increased.
Adhesion and invasion assays were
performed using two different human-derived epithelial cell
lines: the pulmonary cell line
28. A549 and the pharyngeal cell line Detroit 562. For adhesion to
Detroit 562 cells, there was no
discernable difference between MNZ67 and PIP01 (Fig 4A). In
contrast, there was a significant
increase in adhesion to A549 cells by PIP01 (Fig 4B). Epithelial
cell invasion was not signifi-
cantly altered when using Detroit 562 cells (Fig 4C) or A549
cells (Fig 4D).
Biofilm production
It has been shown polyamine acquisition and biosynthesis play
an integral role in biofilm for-
mation of certain bacterial species [34,35]. We therefore sought
to establish if polyamine
transport via the pot operon was necessary for biofilm
production in pneumococci and to
determine if there were variances between encapsulated
pneumococci and NCC1 NESp. Bio-
film assays were utilized to assess biofilm formation, and
results showed significantly more
biofilm was formed by PIP01 in comparison to WT MNZ67 (Fig
5A). In contrast, biofilm
assays using encapsulated strain T4 and a T4ΔpotD showed
biofilm formation was significantly
lower in TIGR4ΔpotD (Fig 5B). Thus, polyamine acquisition
29. appears to differentially affect
encapsulated pneumococci and NESp progression to biofilm.
Fig 3. Restoration of protein synthesis in PIP01 after
complementation of potD. PIP01 was transformed
with pNE1::potD to produce PIP02. An indirect ELISA was
used to determine effects on PspK and
pneumolysin production. PspK was reduced to levels
significantly less than wild type after potD
complementation (A), while pneumolysin was increased to
levels significantly higher than wild type after
complementation (B). All samples were analyzed in triplicate
and experiments were performed at least 3
times. Error bars denote standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g003
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 9 / 19
https://doi.org/10.1371/journal.pone.0179159.g003
https://doi.org/10.1371/journal.pone.0179159
Murine colonization and ascension
Deletion of the pot operon in encapsulated pneumococcal strain
T4 severely attenuates its
ability to colonize the nasopharynx of a mouse [17]. However,
30. NESp ΔpotD mutant PIP01
expresses higher levels of the adhesive protein PspK and shows
increased biofilm formation
Fig 4. Epithelial cell adhesion and invasion. Changes in
epithelial cell adhesion and invasion were assessed using
adhesion/invasion
assays with either Detroit 562 (pharyngeal) or A549 (lung)
human epithelial cells. Epithelial cells were incubated with 10
7
pneumococci
and adhered or internalized pneumococci were enumerated on
BA. Adhesion to Detroit 562 was not significantly affected by
the absence
of potD in MNZ67 (A), but adhesion to A549 cells was
significantly increased in the absence of potD (B). A significant
difference was not
observed between MNZ67 and PIP01 when examining Detroit
562 or A549 cell invasion (C and D). All samples were analyzed
in
triplicate and experiments were performed at least 3 times.
Error bars denote standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g004
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 10 / 19
31. https://doi.org/10.1371/journal.pone.0179159.g004
https://doi.org/10.1371/journal.pone.0179159
(Figs 2, 3, 4, and 5A), factors that aid in colonization. We
therefore investigated if the absence
of potD significantly affects MNZ67 nasopharyngeal
colonization and ascension into the mid-
dle ear in a mouse model. Interestingly, CFU recovered from the
nasopharynxes and middle
ears of mice infected with PIP01 did not significantly differ
from those infected with MNZ67
(Fig 6).
Chinchilla otitis media
We examined the effects of potD deletion on pneumococcal
pathogenesis during OM using a
chinchilla model. Although there was no significant difference
in CFU recovered from the
bullae of chinchillas infected with PIP01 in comparison to those
infected with MNZ67, a
strong trend towards increased CFU was observed (Fig 7A).
Additionally, PIP01 infected
chinchillas had higher otic and biofilm scores in comparison to
WT MNZ67 (Table 3). In
contrast, the absence of a functional pot operon significantly
reduced OM caused by T4.
32. This included a reduction in pathology and biofilm formation
(Table 3), as well as signifi-
cantly fewer CFU recovered from the bullae of chinchillas
infected with T4 ΔpotD (Fig 7B).
These results further illustrate the pot operon has contrasting
effects on encapsulated pneu-
mococci and NESp.
Murine pneumonia
Ware et al. demonstrated disruption of the pot operon
significantly attenuates virulence of
encapsulated strains during a pulmonary infection [25]. We
investigated the ability of PIP01 to
persist within the lungs of a mouse to determine if the pot
operon is required for NESp pulmo-
nary infections. After a two day infection period, significantly
more pneumococci were
Fig 5. Differential effects on biofilm production. Effects of
potD deletion on biofilm production were determined using a
biofilm assay,
in which biofilm formation was assessed 24 hours after seeding
1x10
5
pneumococci in a 24 well plate. Data is presented as OD630.
NESp
PIP01 formed significantly more biofilm than WT MNZ67 (A),
while T4ΔpotD produced significantly less biofilm than WT T4
(B). Samples
33. were analyzed in triplicate and experiments were performed at
least three times. Error bars denote standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g005
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 11 / 19
https://doi.org/10.1371/journal.pone.0179159.g005
https://doi.org/10.1371/journal.pone.0179159
Fig 6. Murine nasopharyngeal colonization and ascension to the
middle ear. Murine colonization and ascension were determined
five days post infection after an intranasal challenge with 10
7
pneumococci. Changes in colonization (A) and ascension (B) in
the
absence of potD were not significantly different. Five mice
were infected with each strain, and two independent
experiments were
performed. Error bars denote standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g006
Fig 7. Chinchilla acute OM. Experimental OM was assessed
using a chinchilla model. Animals were infected via transbullar
injection
and were euthanized 4 days post infection. Pneumococci
34. recovered from chinchilla bullae did not significantly differ
between WT MNZ67
and PIP01 (A). Significantly less CFU were recovered from
chinchillas infected with T4ΔpotD in comparison to wild type
T4 (B). For each
strain, 3 chinchillas were infected in both ears, yielding 6
individual infections. Experiments were performed twice and
error bars denote
standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g007
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 12 / 19
https://doi.org/10.1371/journal.pone.0179159.g006
https://doi.org/10.1371/journal.pone.0179159.g007
https://doi.org/10.1371/journal.pone.0179159
recovered from the lungs of mice infected with PIP01 in
comparison to those infected with
MNZ67 (Fig 8). Furthermore, all five mice infected with PIP01
had bacteria in the lungs after 2
days, whereas no bacteria were recovered from the lungs of two
of the mice infected with
MNZ67.
Discussion
35. The pot operon has been identified in all sequenced
pneumococcal isolates [17]. Inactivation
of the pot operon attenuates virulence of encapsulated
pneumococcal strains [15,25,36], thus
making the pot operon an intriguing target for pneumococcal
treatment and prevention. How-
ever, the challenge of finding a target that truly conveys
protection against all pneumococci,
and not just encapsulated strains, remains an obstacle. Because
research targeting the pot
operon of encapsulated strains proved promising as a disease
preventative, we aimed to evalu-
ate the involvement of the pot operon in NESp virulence.
Attenuation of NESp virulence after
potABCD inactivation would confirm the pot operon is
important for both types of pneumo-
cocci and would further validate its potential as an all-inclusive
pneumococcal therapeutic.
Since potABCD is highly conserved amongst pneumococcal
isolates [17], we hypothesized it
would have conserved effects on pneumococcal virulence as
well. However, here we show inac-
tivating the pot operon in the NESp isolate MNZ67 produces
results dissimilar to those
obtained using a Δpot encapsulated strain. The only data that
correlated with previous encap-
sulated studies was effects on the pore-forming toxin Ply (Fig
1). Ply is an important virulence
factor of S. pneumoniae and has been shown to greatly impact
the ability of the organism to
36. cause infection [37,38]. Proteomic analysis of the virulent
pneumococcal isolate T4 showed the
T4-derived mutant lacking a functional pot operon had reduced
expression of Ply [17]. We
observed reduced lysis of RBCs when potD was deleted from
MNZ67. Our quantitative ELISA
results confirmed the loss of hemolytic potential observed in
our hemolysis assay was from a
decrease in Ply production. Therefore, it appears polyamine
acquisition does serve a similar
function in relation to regulation of this specific protein.
In MNZ67, the cps genes are replaced by pspK [32]. Examining
PspK expression not only
further elucidated the effects of potD deletion on pneumococcal
protein expression, but it also
allowed us to investigate the effects on a protein unique to
NESp. Previous studies noted a
decrease in capsule synthesis proteins when potABCD was
deleted from T4 [17]. In contrast,
we noted increased expression of PspK in MNZ67 ΔpotD
mutant, PIP01 (Fig 2). Interestingly,
although cps and pspK genes occupy the same locus within the
different strains, polyamine
transport appears to positively regulate capsule production but
negatively regulate pspK
expression. Taken together with our Ply data and previous
research involving encapsulated
strains, we conclude polyamine acquisition via the pot operon is
important for protein regula-
37. tion in both encapsulated and nonencapsulated pneumococci.
However, this appears to have
strain and gene dependent variances.
Table 3. OM tympanic pathology scores and biofilm scores 4
days post infection.
Strain *Otic Score ± SEM #Biofilm Score ± SEM
MNZ67 1.5 ± 0.33 1.0 ± 0.66
PIP01 2 1.75 ± 0.28
T4 2.2 ± 0.21 2.5 ± 0.24
T4 ΔpotD 1.0 ± 0.33 0.71± 0.75
* 0 = none, 1 = inflammation, 2 = effusion, and 3 = tympanic
rupture
#
0 = none, 1 = surface formation, 2 = traverses bulla, and 3 =
traverses bulla with thickening
https://doi.org/10.1371/journal.pone.0179159.t003
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 13 / 19
https://doi.org/10.1371/journal.pone.0179159.t003
https://doi.org/10.1371/journal.pone.0179159
To confirm potD deletion was responsible for changes in protein
expression, we comple-
38. mented potD in PIP01 and determined if protein levels were
returned to those of wild type.
When potD was restored in PIP01, not only was Ply increased
and PspK decreased, but these
changes were significantly higher or lower than WT (Fig 3).
Because potD was complemented
into PIP01 via transformation with the plasmid pNE1, these
significant changes are likely due
to increased copy number of potD. This data further indicates
the involvement of polyamine
acquisition in NESp protein expression regulation, as increased
presence of PotD significantly
alters protein levels.
Fig 8. Persistence in murine lungs. The lungs of intratracheally
infected mice were collected 2 days post infection, and the
ability of
MNZ67 and PIP01 to persist in the lungs was determined by
enumerating CFU. Significantly more pneumococci were
recovered from
mice infected with PIP01. Five mice were infected with each
strain. Error bars denote standard error of the mean.
https://doi.org/10.1371/journal.pone.0179159.g008
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 14 / 19
https://doi.org/10.1371/journal.pone.0179159.g008
https://doi.org/10.1371/journal.pone.0179159
39. We established PspK was increased in PIP01 by analyzing cell
lysates via ELISA. Because
PspK is a surface protein, we also wanted to determine if the
increased PspK observed in
PIP01 was actually expressed on the surface, or if the PspK
detected by the ELISA was intra-
cellular protein released into the environment after cell lysis.
Flow cytometric analysis
showed no discernable difference in surface bound PspK (Fig
2C). We therefore hypothesize
these variances in expression and surface bound analyses are
due to two possible explana-
tions. The first explanation being higher levels of PspK were
produced in PIP01, but it was
kept within the cell and released during cell lysis; this could be
because the cells already have
the maximum amount of PspK on their surfaces. The second
explanation is that PIP01 is
actually expressing more PspK than MNZ67 on the cell surface.
Due to steric hindrance,
however, the antibody cannot access, and therefore cannot bind,
the excess proteins, thus
skewing flow cytometry results. To discern which was accurate,
40. we looked for functionality
of the increased protein.
PspK is an adhesive surface protein known to aid in adhesion to
human epithelia. This
adhesiveness propagates nasopharyngeal colonization and
increases persistence during infec-
tion [31,33]. Our studies showed PIP01 to have increased PspK
expression but no difference in
surface bound PspK, which led us to investigate if PIP01
exhibited any changes in epithelial
cell adhesion and invasion. We showed PIP01 had increased
adhesion to human A549 pulmo-
nary epithelial cells in vitro (Fig 4B). This data, combined with
our data showing PIP01 to
have increased persistence in the lungs of a mouse, led us to
conclude the increased PspK
being produced in PIP01 is functional and surface bound. If
PspK were truncated or kept
within the cell, it would not aid in adherence. However,
increased PspK expression did not
alter adhesion to Detroit 562 pharyngeal cells or
nasopharyngeal colonization. Based on these
results, we hypothesize lung epithelia may have an additional
PspK ligand not present on pha-
41. ryngeal cells. PspK has thus far been implicated in colonization
and OM, but this data suggests
PspK may also be important for adherence and pathogenesis
within the lungs.
Biofilm production is a central characteristic of numerous
bacterial species. For pneumo-
cocci, it is thought biofilm formation aids in colonization [39].
Biofilms also serve as a point of
interaction between strains, facilitating genetic exchange of
virulence factors and antibiotic
resistances [40]. Previous studies have shown that polyamines
are essential for biofilm forma-
tion by the plague-causing organism Yersinia pestis [34].
Additionally, biofilm formation by
Vibrio cholerae was shown to increase when excess polyamines
were added to growth media
[35]. We examined changes in biofilm formation in both T4 and
MNZ67 in the absence of a
functional pot operon. However, these results were contrasting,
with T4ΔpotD having
decreased biofilm formation and PIP01 having increased biofilm
formation in comparison to
WT. Polyamine acquisition is generally thought to aid in
progression to biofilm, which seems
to be the case for encapsulated pneumococci. Yet, in MNZ67
the inactivation of the polyamine
42. transporter appears to enhance biofilm development.
Although we did not see an increase in pharyngeal cell adhesion
in vitro (Fig 4A), we still
wanted to examine in vivo nasopharyngeal colonization.
Pneumococci must first colonize the
nasopharynx before it can disseminate to other parts of the body
and cause disease. It has been
shown potABCD deletion significantly reduces the ability of
encapsulated pneumococci to col-
onize the nasopharynx of a mouse [17], further supporting the
claim that the pot operon is a
good target for pneumococcal disease prevention. However, our
results showed deletion of
potD from MNZ67 did not reduce murine colonization or
ascension from the nasopharynx to
the middle ear. In fact, CFU recovered from mice infected with
PIP01 were slightly higher
than CFU recovered from mice infected with WT MNZ67 (Fig
6). Unlike encapsulated pneu-
mococci, polyamine acquisition via the pot operon is not vital to
successful colonization and
disease development by NESp subgroup NCC1. This can be
explained by the difference in
Polyamine transport and virulence of Streptococcus pneumoniae
43. PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 15 / 19
https://doi.org/10.1371/journal.pone.0179159
biofilm formation, with reduced biofilm formation in
encapsulated strain leading to reduced
colonization and more biofilm in MNZ67 leading to slightly
more colonization.
Middle ear infections are the most frequent reason for pediatric
visits in the United States,
and S. pneumoniae is a leading cause of OM [11]. Although the
involvement of polyamine
acquisition in other pneumococcal diseases has been explored,
the role of polyamines in pneu-
mococcal OM has not been determined. We therefore examined
effects of potD deletion on T4
and MNZ67 associated OM in a chinchilla model. In MNZ67,
potD deletion produced slight
increases in recovered CFU, otic pathology, and biofilm
formation. In contrast, deletion of
potD in T4 significantly attenuated pathology, biofilm
formation, and bacterial persistence in
the middle ear. This data further supports our idea that
polyamine acquisition by the pot
operon is essential for pathogenesis of encapsulated
pneumococci, but it is dispensable for
pathogenesis of NCC1 NESp.
44. Together, the increased biofilm development, increased
epithelial adhesion, increased col-
onization, and increased OM pathology reinforce that the
absence of a functional pot operon
in MNZ67 actually increases virulence. We propose two
explanations for these results: 1)
polyamine acquisition and metabolism negatively regulate
virulence in the NESp, or 2) inac-
tivation of the pot operon results in upregulation of polyamine
biosynthetic pathways, thus
overcompensating for the loss of polyamine acquisition and
resulting in increased poly-
amine-associated virulence. In any case, we conclude
polyamines are an integral component
of pneumococcal virulence. Their role however, is altered
between encapsulated and natu-
rally occurring nonencapsulated strains. These finding
exemplify the diversity amongst
pneumococci and further elucidate the challenge of finding all-
inclusive pneumococcal tar-
gets. Although our studies do not illustrate the pot operon to be
a suitable target for reducing
NESp virulence, our data does shed light on NCC1 protein
regulation. Furthermore, our
45. studies show NESp have unique mechanisms of virulence
regulation that differ from encap-
sulated pneumococci. Together, our results illuminate the need
to further investigate NESp
virulence factors, virulence regulation, and metabolic processes.
Supporting information
S1 Fig. 1–3 Data. Datasets underlying Figs 1, 2, and 3. Protein
levels were measured by indi-
rect ELISA and pneumolysin function was determined by
hemolysis assay. Triplicates were
averaged, and percent production was calculated by dividing
mutant values by WT/control
values and multiplying by 100. Gene expression was determined
by RT-qPCR. Change is
expression was determined by the ΔΔCT method with gyrA
serving as an internal control.
(PDF)
S2 Fig. 4 Data. Dataset underlying Fig 4. Human epithelial cells
were incubated with pneu-
mococci to allow adherence or invasion. CFU was determined
by plating on BA. Data is
reported as log CFU.
(PDF)
46. S3 Fig. 5 Data. Dataset underlying Fig 5. Biofilm formation was
determined by crystal violet
staining, alcohol solubilization, and OD630 analysis. OD
readings and triplicate averages are
reported here.
(PDF)
S4 Fig. 6 Data. Dataset underlying Fig 6. Mice were
intranasally infected with pneumococci
and CFU were determined 5 days post infection. CFU counts for
nasal samples and bullae
were determined separately. Data is reported as log CFU.
(PDF)
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 16 / 19
http://www.plosone.org/article/fetchSingleRepresentation.action
?uri=info:doi/10.1371/journal.pone.0179159.s001
http://www.plosone.org/article/fetchSingleRepresentation.action
?uri=info:doi/10.1371/journal.pone.0179159.s002
http://www.plosone.org/article/fetchSingleRepresentation.action
?uri=info:doi/10.1371/journal.pone.0179159.s003
http://www.plosone.org/article/fetchSingleRepresentation.action
?uri=info:doi/10.1371/journal.pone.0179159.s004
https://doi.org/10.1371/journal.pone.0179159
47. S5 Fig. 7 Data. Dataset underlying Fig 7. Chinchillas were
infected in each bullae with pneu-
mococci and CFU were determined 4 days post infection.
Counts for the wash, exudate, and
whole bullae were combined and data is reported as log CFU.
(PDF)
S6 Fig. 8 Data. Dataset underlying Fig 8. Mice were
intratracheally infected with pneumo-
cocci and CFU were determined 2 days post infection. Data is
reported as log CFU.
(PDF)
Acknowledgments
We would like to acknowledge Cheshil Dixit and Jessica Friley
for their assistance collecting
and processing colonization and OM samples.
Author Contributions
Conceptualization: LSM ES LEK.
Data curation: HRP LSM.
Formal analysis: HRP JLB LSM ES LEK.
Funding acquisition: LSM.
Investigation: HRP JLB LEK.
48. Methodology: HRP JLB LEK LSM.
Project administration: LSM.
Resources: ES LEK LSM.
Supervision: LSM.
Validation: HRP JLB LEK LSM.
Visualization: HRP JLB LSM.
Writing – original draft: HRP.
Writing – review & editing: HRP JLB LEK ES LSM.
References
1. Kadioglu A, Weiser JN, Paton JC, Andrew PW. The role of
Streptococcus pneumoniae virulence factors
in host respiratory colonization and disease. Nat Rev Microbiol.
2008; 6: 288–301. https://doi.org/10.
1038/nrmicro1871 PMID: 18340341
2. Musher DM. Infections Caused by Streptococcus
pneumoniae: Clinical Spectrum, Pathogenesis,
Immunity, and Treatment. Clin Infect Dis. 1992; 14: 801–809.
https://doi.org/10.1093/clinids/14.4.801
PMID: 1576274
3. Forrester HL, Jahnigen DW, Marc Laforce F. Inefficacy of
pneumococcal vaccine in a high-risk popula-
49. tion. Am J Med. 1987; 83: 425–430.
https://doi.org/10.1016/0002-9343(87)90751-0 PMID: 3661581
4. Enright MC, Spratt BG. A multilocus sequence typing scheme
for Streptococcus pneumoniae: identifi-
cation of clones associated with serious invasive disease.
Microbiology. 1998; 144 (Pt 1: 3049–60.
https://doi.org/10.1099/00221287-144-11-3049 PMID: 9846740
5. Park IH, Kim K-H, Andrade AL, Briles DE, McDaniel LS,
Nahm MH. Nontypeable Pneumococci Can Be
Divided into Multiple cps Types, Including One Type
Expressing the Novel Gene pspK. MBio. 2012; 3:
e00035–12–e00035–12. https://doi.org/10.1128/mBio.00035-12
PMID: 22532557
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 17 / 19
http://www.plosone.org/article/fetchSingleRepresentation.action
?uri=info:doi/10.1371/journal.pone.0179159.s005
http://www.plosone.org/article/fetchSingleRepresentation.action
?uri=info:doi/10.1371/journal.pone.0179159.s006
https://doi.org/10.1038/nrmicro1871
https://doi.org/10.1038/nrmicro1871
http://www.ncbi.nlm.nih.gov/pubmed/18340341
https://doi.org/10.1093/clinids/14.4.801
http://www.ncbi.nlm.nih.gov/pubmed/1576274
https://doi.org/10.1016/0002-9343(87)90751-0
50. http://www.ncbi.nlm.nih.gov/pubmed/3661581
https://doi.org/10.1099/00221287-144-11-3049
http://www.ncbi.nlm.nih.gov/pubmed/9846740
https://doi.org/10.1128/mBio.00035-12
http://www.ncbi.nlm.nih.gov/pubmed/22532557
https://doi.org/10.1371/journal.pone.0179159
6. Hathaway LJ, Meier PS, Battig P, Aebi S, Muhlemann K. A
Homologue of aliB Is Found in the Capsule
Region of Nonencapsulated Streptococcus pneumoniae. J
Bacteriol. 2004; 186: 3721–3729. https://
doi.org/10.1128/JB.186.12.3721-3729.2004 PMID: 15175285
7. Geno KA, Gilbert GL, Song JY, Skovsted IC, Klugman KP,
Jones C, et al. Pneumococcal Capsules and
Their Types: Past, Present, and Future. Clin Microbiol Rev.
2015; 28: 871–899. https://doi.org/10.1128/
CMR.00024-15 PMID: 26085553
8. Castiglia P. Recommendations for Pneumococcal
Immunization Outside Routine Childhood Immuniza-
tion Programs in Western Europe. Adv Ther. 2014; 31: 1011–
1044. https://doi.org/10.1007/s12325-
014-0157-1 PMID: 25300593
9. Bonten MJM, Huijts SM, Bolkenbaas M, Webber C, Patterson
S, Gault S, et al. Polysaccharide Conju-
gate Vaccine against Pneumococcal Pneumonia in Adults. N
51. Engl J Med. 2015; 372: 1114–1125.
https://doi.org/10.1056/NEJMoa1408544 PMID: 25785969
10. FADEN H, DUFFY L, BOEVE M. Otitis media: back to
basics. Pediatr Infect Dis J. 1998; 17: 1105–
1113. https://doi.org/10.1097/00006454-199812000-00002
PMID: 9877357
11. Faden H, Duffy L, Wasielewski R, Wolf J, Krystofik D,
Tung Y. Relationship between nasopharyngeal col-
onization and the development of otitis media in children.
Tonawanda/Williamsville Pediatrics. J Infect
Dis. 1997; 175: 1440–5. Available:
http://www.ncbi.nlm.nih.gov/pubmed/9180184 PMID: 9180184
12. Gonzales R, Malone DC, Maselli JH, Sande MA. Excessive
Antibiotic Use for Acute Respiratory Infec-
tions in the United States. Clin Infect Dis. 2001; 33: 757–762.
https://doi.org/10.1086/322627 PMID:
11512079
13. Hicks LA, Harrison LH, Flannery B, Hadler JL, Schaffner
W, Craig AS, et al. Incidence of Pneumococcal
Disease Due to Non—Pneumococcal Conjugate Vaccine (PCV7)
Serotypes in the United States during
the Era of Widespread PCV7 Vaccination, 1998–2004. J Infect
Dis. 2007; 196: 1346–1354. https://doi.
52. org/10.1086/521626 PMID: 17922399
14. Tavares DA, Simões AS, Bootsma HJ, Hermans PW, de
Lencastre H, Sá-Leão R. Non-typeable pneu-
mococci circulating in Portugal are of cps type NCC2 and have
genomic features typical of encapsu-
lated isolates. BMC Genomics. 2014; 15: 863.
https://doi.org/10.1186/1471-2164-15-863 PMID:
25283442
15. Croucher NJ, Harris SR, Fraser C, Quail MA, Burton J, van
der Linden M, et al. Rapid Pneumococcal
Evolution in Response to Clinical Interventions. Science (80-).
2011; 331: 430–434. https://doi.org/10.
1126/science.1198545 PMID: 21273480
16. Hotomi M, Nakajima K, Hiraoka M, Nahm MH, Yamanaka
N. Molecular epidemiology of nonencapsu-
lated Streptococcus pneumoniae among Japanese children with
acute otitis media. J Infect Chemother.
2016; 22: 72–77. https://doi.org/10.1016/j.jiac.2015.10.006
PMID: 26705748
17. Shah P, Nanduri B, Swiatlo E, Ma Y, Pendarvis K.
Polyamine biosynthesis and transport mechanisms
are crucial for fitness and pathogenesis of Streptococcus
pneumoniae. Microbiology. 2011; 157: 504–
515. https://doi.org/10.1099/mic.0.042564-0 PMID: 20966092
53. 18. Shah P, Swiatlo E. A multifaceted role for polyamines in
bacterial pathogens. Mol Microbiol. 2008; 68:
4–16. https://doi.org/10.1111/j.1365-2958.2008.06126.x PMID:
18405343
19. Pegg AE, McCann P. Polyamine metabolism and function.
Am J Physiol—Cell Physiol. 1982; 243:
212–221. Available:
http://ajpcell.physiology.org/content/243/5/C212
20. Cohen S. A Guide to Polyamines. New York: Oxford
University Press; 1997.
21. Chattopadhyay MK, Tabor CW, Tabor H. Polyamines
protect Escherichia coli cells from the toxic effect
of oxygen. Proc Natl Acad Sci. 2003; 100: 2261–2265.
https://doi.org/10.1073/pnas.2627990100
PMID: 12591940
22. Jung IL, Kim IG. Polyamines and Glutamate Decarboxylase-
based Acid Resistance in Escherichia coli.
J Biol Chem. 2003; 278: 22846–22852.
https://doi.org/10.1074/jbc.M212055200 PMID: 12670930
23. Ware D, Watt J, Swiatlo E. Utilization of putrescine by
Streptococcus pneumoniae during growth in cho-
line-limited medium. J Microbiol. 2005; 43: 398–405.
Available: http://www.ncbi.nlm.nih.gov/pubmed/
54. 16273030 PMID: 16273030
24. Furuchi T, Kashiwagi K, Kobayashi H, Igarashi K.
Characteristics of the gene for a spermidine and
putrescine transport system that maps at 15 min on the
Escherichia coli chromosome. J Biol Chem.
1991; 266: 20928–33. Available:
http://www.jbc.org/content/266/31/20928.long PMID: 1939142
25. Ware D, Jiang Y, Lin W, Swiatlo E. Involvement of potD in
Streptococcus pneumoniae Polyamine
Transport and Pathogenesis. Infect Immun. 2006; 74: 352–361.
https://doi.org/10.1128/IAI.74.1.352-
361.2006 PMID: 16368990
26. Shah P, Briles DE, King J, Hale Y, Swiatlo E. Mucosal
Immunization with Polyamine Transport Protein
D (PotD) Protects Mice Against Nasopharyngeal Colonization
with Streptococcus pneumoniae. Exp
Biol Med. 2009; 234: 403–409. https://doi.org/10.3181/0809-
RM-269 PMID: 19176871
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 18 / 19
https://doi.org/10.1128/JB.186.12.3721-3729.2004
https://doi.org/10.1128/JB.186.12.3721-3729.2004
http://www.ncbi.nlm.nih.gov/pubmed/15175285
57. sciencedirect.com/science/article/pii/0378111989903594 PMID:
2744488
30. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner
FH, Provenzano MD, et al. Measurement of
protein using bicinchoninic acid. Anal Biochem. 1985; 150: 76–
85. https://doi.org/10.1016/0003-2697
(85)90442-7 PMID: 3843705
31. Keller LE, Jones C V., Thornton JA, Sanders ME, Swiatlo
E, Nahm MH, et al. PspK of Streptococcus
pneumoniae Increases Adherence to Epithelial Cells and
Enhances Nasopharyngeal Colonization.
Infect Immun. 2013; 81: 173–181.
https://doi.org/10.1128/IAI.00755-12 PMID: 23115034
32. Keller LE, Robinson DA, McDaniel LS. Nonencapsulated
Streptococcus pneumoniae: Emergence and
Pathogenesis. MBio. 2016; 7: e01792–15.
https://doi.org/10.1128/mBio.01792-15 PMID: 27006456
33. Keller LE, Friley J, Dixit C, Nahm MH, McDaniel LS.
Nonencapsulated Streptococcus pneumoniae
Cause Acute Otitis Media in the Chinchilla That Is Enhanced by
Pneumococcal Surface Protein K.
Open Forum Infect Dis. 2014; 1: ofu037–ofu037.
https://doi.org/10.1093/ofid/ofu037 PMID: 25734113
34. Patel CN, Wortham BW, Lines JL, Fetherston JD, Perry RD,
58. Oliveira MA. Polyamines Are Essential for
the Formation of Plague Biofilm. J Bacteriol. 2006; 188: 2355–
2363. https://doi.org/10.1128/JB.188.7.
2355-2363.2006 PMID: 16547021
35. Karatan E, Duncan TR, Watnick PI. NspS, a Predicted
Polyamine Sensor, Mediates Activation of Vibrio
cholerae Biofilm Formation by Norspermidine. J Bacteriol.
2005; 187: 7434–7443. https://doi.org/10.
1128/JB.187.21.7434-7443.2005 PMID: 16237027
36. Rai AN, Thornton JA, Stokes J, Sunesara I, Swiatlo E,
Nanduri B. Polyamine transporter in Streptococ-
cus pneumoniae is essential for evading early innate immune
responses in pneumococcal pneumonia.
Sci Rep. 2016; 6: 26964. https://doi.org/10.1038/srep26964
PMID: 27247105
37. Hirst RA, Gosai B, Rutman A, Guerin CJ, Nicotera P,
Andrew PW, et al. Streptococcus pneumoniae
Deficient in Pneumolysin or Autolysin Has Reduced Virulence
in Meningitis. J Infect Dis. 2008; 197:
744–751. https://doi.org/10.1086/527322 PMID: 18260758
38. Berry AM, Alexander JE, Mitchell TJ, Andrew PW,
Hansman D, Paton JC. Effect of defined point muta-
tions in the pneumolysin gene on the virulence of Streptococcus
59. pneumoniae. Infect Immun. 1995; 63:
1969–1974. Available:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC173251/ PMID:
7729909
39. Allegrucci M, Sauer K. Characterization of Colony
Morphology Variants Isolated from Streptococcus
pneumoniae Biofilms. J Bacteriol. 2007; 189: 2030–2038.
https://doi.org/10.1128/JB.01369-06 PMID:
17189375
40. Marks LR, Reddinger RM, Hakansson AP. High Levels of
Genetic Recombination during Nasopharyn-
geal Carriage and Biofilm Formation in Streptococcus
pneumoniae. MBio. 2012; 3: e00200–12–
e00200–12. https://doi.org/10.1128/mBio.00200-12 PMID:
23015736
Polyamine transport and virulence of Streptococcus pneumoniae
PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June
6, 2017 19 / 19
https://doi.org/10.1128/IAI.00553-06
https://doi.org/10.1128/IAI.00553-06
http://www.ncbi.nlm.nih.gov/pubmed/16988268
http://www.sciencedirect.com/science/article/pii/S0264410X163
1074X
https://doi.org/10.1016/j.vaccine.2016.11.027
https://doi.org/10.1016/j.vaccine.2016.11.027
http://www.ncbi.nlm.nih.gov/pubmed/27884476