1. DIVALENT METAL TRANSPORTER-1 (DMT-1) EXPRESSION IN CADMIUM ACCUMULATED HUMAN PLACENTA Miss Keerakarn Somsuan Master Student in Anatomy Faculty of Medical Science Naresuan University

2. Cadmium(Cd) 4,000 to 13,000 tons per year ATSDR, 1999 Pigment Industrials Ores battery nickel cadmium Cd Cd Cd Cd

4. Cd Absorption 5-10% of the Cd was absorbed by GI tract (WHO, 1989). 20-40 years in human (WHO, 2000) 40–60% of the Cd was absorbed by lung (Elinder Et al., 1976). 2 to 3 μg of Cd was excreted in feces and urine (ATSDR, 1989) Standard of urinary Cd at 2 µg/g creatinine (WHO, 2000)

5. Pathway of Cd in Human Body Bernard, et al., 2008 Duodenum Urine & Feces >> Cd-MT, Cd-Alb, Cd-(GSH) 2 , Cd-(Cys) 2 , Cd-(Thiol) 2 Nordberg et al., 2009, Zalups, et al., 2003

6. Cd Transporters in GI tract Zalups. And Ahmad , (2003) ZIP family: Zrt-, Irt-related protein family DMT-1: Divalent metal transporter-1 MTP1: Metal transporter protein-1 or ferroportin-1 ZnT1 Lumen Portal Blood DMT1 Ca ++ channels ZIP family Amino acid and peptide transporter Ca ++ ATPase MTP1 Amino Acid Transporters Cd-MT complex endocytosis plasma membrane damaged Cd

8. Placenta Fetal surface Maternal surface Cotyledons Umbilical cord (Umbilical vessels) Chorionic vessels Amnion Chorion

9. Ultrastructure of Placenta Carlson et al., 1999, Gude et al. 2004 Chorionic villi Decidual cell Zhang , 1998 Maternal portion Fetal portion Chorionic plate

15. Expression of four DMT-1 isoforms * High expression isoforms Species Organ expression Functions References DMT-1 IRE Mouse heart, kidney*, liver, lung, spleen, thymus, testis*, esophagus, stomach, duodenum*, jejunum, ileum Fe regulation Hubert & Henze, 2002 Fe & Cd transport Kim et al., 2007 Rat Placenta Fe regulation Gambling et al. 2001 DMT-1 non-IRE Mouse heart, kidney*, liver, lung*, spleen*, thymus*, testis, esophagus, stomach, duodenum, jejunum, ileum Fe transport Hubert & Henze, 2002, Ghio et al., 2003 DMT-1 exon 1A Mouse Kidney*, duodenum*, testis, gastrointestinal Fe regulation Hubert & Henze, 2002 DMT-1 exon 1B Mouse heart, kidney*, liver, lung*, spleen*, thymus*, testis, esophagus, stomach, duodenum*, jejunum, ileum Fe transport Hubert & Henze, 2002

16. DMT-1 Expression in Placenta DMT-1 isoforms Species Functions References DMT-1 IRE Human Fe absorption Chong et al., 2002 * Rat Fe regulation Gambling et al. 2001 DMT-1 non-IRE Human Divalent metal ions Absorption & Excretion Chong et al., 2002

17. Regulation of DMT-1 Expression IRP-IRE system   Θ Θ Papanikolaoua and Pantopoulos., 2005 and Henze et al., 2004 Iron Regulatory Protein (IRP): Cellular Fe regulation 3’ 5’ 3’ 5’ ? DMT1

19. Iron Transportation in Placenta McArdle et al., 2008 5 4 3 2 Tf: transferrin, IREG1: iron regulated transporter 1 Fetal circulation Maternal circulation 1

23. Placental Tissue Collection I; cord insertion area (yellow line) C; central area (blue line) M; marginal area (green line) Immunolocalize analysis (blue) Metal and molecular analysis (Pink) Immunolocalize collection

27. Results : Metal analysis The BMI and fetal birth weight Normal weight(18.5-24.9), over weight (25-29.9), obesity (≥ 30) Group Maternal weight (kg) Maternal height (m) BMI (kg/m 2 ) Fetal birth weight(kg) non-Cd contaminated group 65.26±2.09 (n=23) 1.58±0.01 (n=23) normal weight = 7 overweight = 14 obesity = 2 3.09±0.12 (n=10) Cd contaminated group 68.78±3.86 (n=15) 1.55±0.01 (n=15 normal weight = 3 overweight = 8 obesity = 4 3.15±0.1 (n=10)

28. The concentration of blood Cd, urinary Cd placental Cd, serum ferritin and placental Fe * p < 0.05 a > 2 μg/g creatinine, recommened by PTWI. Group blood Cd (ug/L) urinary Cd (ug/g creatinine) placental Cd (ug/kg) serum ferritin (ng/mL) placental Fe (mg/kg) non-Cd contaminated group 0.67±0.1 (n=25) 1.51±0.18 (n=24) 9.14±0.72 (n=24) 19.26±1.35 (n=28) 57.68±4.72 (n=24) Cd contaminated group 1.30±0.21* (n=21) 2.20±0.41 a (n=21) 20.31±4.68* (n=17) 23.00±3.51 (n=23) 57.11±6.12 (n=18)

30. DISCUSSION In this study: (WHO., 2000) We suggest that; Pregnancies exposed in Cd contaminated area may risk for Cd effect in kidney. Previous study: (Wu et al., 2001) In Cd group: ↑ [Cd] in urine > 2 ug/g creatinine Urinary Cd (> 2 ug/g creatinine) ↑ calciuria

31. RESULT & DISCUSSION In this study: Blood Cd: acute Cd exposure Urinay Cd: chronic Cd exposure (Järup et al.. 1998) (Järup et al., 1997) We suggest that;  ↑ Blood Cd  ↑ Urinary Cd  Pregnancies receive chronic low dose of Cd. Previous study: [Cd] in maternal blood & urine were positive relationship .

32. DISCUSSION In this study: We suggest that all pregnant participants received the same dosage of Fe supplement (folate). In this study: We suggest that; Cd accumulated in placenta. (Osman, et al., 2000) [Fe] in blood & placenta in both non-Cd & Cd groups were similar . Previous study: Fe status in maternal body seems to be correlated with Fe supplementation. (Burns & Patersn, 1993) . [Cd] in placenta was significantly increased in Cd group.

33. RESULT & DISCUSSION We suggest that; Fe easily passes through placental barrier and final enters fetal capillaries more than Cd. In this study: Placenta playing a role in preventing Cd transport. Previous study: (Kurivaki, et al., 2005) Placental Cd and placental Fe was likely inverse correlation.

34. Results: DMT-1 mRNA and protein * p < 0.05 a > 2 μg/g creatinine, recommened by PTWI. The concentration of blood Cd, placental Cd, urinary Cd, serum ferritin and placental Fe (n=12) Group Blood Cd (μg/L) Placental Cd (μg/kg) Urinary Cd (μg/g creatinine) Serum ferritin (ng/mL) Placental Fe (mg/kg) low-Cd group 0.40±0.06 (n=6) 7.50±1.00 (n=6) 1.16±0.10 (n=6) 20.43±3.71 (n=6) 43.86±3.11 (n=6) high-Cd group 1.83±0.43* (n=6) 37.55±9.90* (n=6) 3.16±1.31 a (n=6) 28.65±9.26 (n=6) 40.20±4.72 (n=6)

36. Results: Localization of DMT-1 protein in placental tissues Fetal portion: DMT-1 was localized in apical portion of cytoplasm and basal membranes of STB. Ivs: intervillous space, STB: syncytiotrophoblast cell, S: nucleus of STB, Fc: fetal capillary

37. Fetal portion: DMT-1 was localized in cytoplasm of endothelial cell of fetal capillary. Ivs: intervillous space, Fc: fetal capillary 100X Fc Fc Fc IVs Fc Fc IVs 40X

39. Fetal portion: DMT-1 was localized in cytoplasm of hofbuaer cells. Ivs: intervillous space, S: nucleus of STB, H: hofbuaer cell, Fc: fetal capillary Fc IVs H 40X IVs Fc S H H S 100X

40. Maternal portion: DMT-1 was localized in cytoplasm of decidual cells. ICM: intracellular matrix, D: decidual cell

41. The DMT-1 positive immunoreactivity in human placental cells + ; positive DMT-1 immunoreactivity - ; negative DMT-1 immunoreactivity Placental portions Placental Cells DMT-1 immunoreactivity Fetal portion syncytiotrophoblast cells cytotrophoblast cells endothelial cell of fetal capillary hofbuaer cells mesenchymal cells + - + + - Maternal portion decidual cells +

43. Comparison of DMT-1 protein expression in STB in different areas of placenta Insertion Center Margin High-Cd Low-Cd

44. The % quantitative of DMT-1 localization DMT-1 was predominantly localized in insertion area followed by central and marginal areas, respectively ( ** p < 0.01). DMT-1 positive immunoreactivity in low-Cd and high-Cd groups were similar. Group Insertion** Center** Margin** low-Cd group 80.96± 4.47 67.4± 7.69 49.96±6.98 high-Cd group 81.28± 3.97 71.23± 5.18 52.41± 7.38

45. (A) (n=12) ** p < 0.01 (B) (n=6) ** p < 0.01 (C) (n=6)

47. Western Blot analysis * 65 kDa * 43 kDa Placental protein bands on SDS-PAGE and transferred to membrane Ladder SDS-PAGE Membrane Mouse anti DMT-1 antibody Mouse anti β -Actin antibody 250 148 98 64 50 36 22 16 6 4

48. Comparison of β -Actin & DMT-1 protein bands on X-ray film with PVDF membrane β -Actin DMT-1

49. DMT-1 protein expression in placental tissues 64 kD, DMT-1 43 kD, β -Actin low-Cd group high-Cd group DMT-1 protein was significantly increased in high-Cd group compared with low-Cd group ( p =0.001, n=6). ** p <0.01

50. RT-PCR analysis Total RNA extraction Total RNA concentration measurement cDNA synthesis PCR condition

51. Oligonucleotide primers for RT-PCR Genes Accession No. Direction Primer sequence Size (bp) DMT-1 NM_001174130 (Chong, et al, 2005) Forward Reverse 5’ GAGCCAGTGTGTTTCTATGG 3’ 5’ CCTAAGCCTGATAGAGCTAG 3’ 518 β-Actin NM_001101 Forward Reverse 5’ CATCGAGCACGGCATCGTCA 3’ 5’TAGCACAGCCTGGATAGCAAC 3’ 211

52. Results: The photograph of DMT-1 and β-actin mRNA expressions in term human placental tissues on 1% agarose gel

53. DMT-1 mRNA expression in placental tissues 518 bp, DMT-1 211 bp, β -Actin low-Cd group high-Cd group DMT-1 mRNA was significantly increased in high-Cd group compared with low-Cd group ( p =0.032, n=6). * p <0.05

54. The correlation of DMT-1 protein & mRNA expressions DMT-1 protein and mRNA expressions showed positive correlation (** p =0.001).

55. Discussion In rat brain: ↑ [Pb] and [Cd] in blood ↑ DMT-1 protein In this study: In pregnant rat: ↑ [Cd] in several organs of pregnant rat ↑ DMT-1 mRNA in these organs especially in placenta Previous study: (Gu C. et al. 2009) (Leazer et al. 2002.) In Cd group: ↑ [Cd] in placenta ~ 5.36 times ↑ DMT-1 protein ~ 1.19 times ↑ DMT-1 mRNA ~ 1.30 times

56. Discussion In this study: In HEK293 cell lines, DMT-1 showed the matal affinity ranking that: Mn > Cd? > Fe? > Pb ~ Co ~ Ni > Zn. We suggest that; DMT-1 plays an important role in Fe transport and may also transport Cd into placental tissue. ( Garrick et al. 2006) Previous study: ↑ Cd accumulation in placenta. ↑ DMT-1 protein & mRNA in placenta

57. Conclusions In this study: We suggest that; DMT-1 may be activated by placental Cd accumulation. In high-Cd group: ↑ [Cd] in maternal blood and placenta ↑ [Cd] in urine > 2 ug/g creatinine ↑ DMT-1 protein ~ 1.19 times ↑ DMT-1 mRNA ~ 1.30 times

58. cell 1 2 3 DMT-1 transcription ↑ Novel pathway of DMT-1 transcription in high placental Cd accumulation 4 DMT-1 3’ 5’ MRE’ s MTF-1 nucleus MTF-1 Zn MTF-1 Zn Cd MT Cd Cd Zn MT Zn Zn

59. STB Apical membrane Basal membrane Cd-MT complex Cd 2+ Fe 2+ Fe 2+ Fe 2+ Fe 2+ Cd 2+ Cd 2+ Fe 2+ Maternal circulation Fetal circulation Fe-ferritin Novel mechanism of placental Cd transport mediated by DMT-1 transporter in STB Fe 2+ Cd 2+ Cd 2+ Fe 2+ Fe 2+ Cd 2+ Cd 2+ Fe 2+ Fe 2+ Transferrin Transferrin receptor DMT-1 ferroportin-1

61. Pathway of Cd in human body

62. and found a significant increase in DMT-1 mRNA in gd 18 and gd 21 placenta compared with gd 15 placenta levels. DMT-1 increased in placenta during late pregnancy. The interaction between iron and Cd is not a new concept, as it was studied decades ago in laboratory animals.