Download to read offline
Uploaded byPratik Chandrani
Molecular-testing-in-Lung-Cancer-_-identification-of-uncommon-mutations-final-1.pptx
1. Molecular testing in lung cancer has identified several new biomarkers in recent years, including ALK, ROS1, MET exon 14 skipping, NTRK fusions, and KRAS G12C mutations. 2. Next-generation sequencing has become a widely used testing method that allows for parallel testing of multiple genes and biomarkers. RNA sequencing is generally preferred over DNA sequencing for detection of fusions. 3. Single gene assays remain important options, especially for established biomarkers like EGFR mutations, but targeted NGS panels provide a more comprehensive approach and have been validated in large testing programs.
More Related Content
Similar to Molecular-testing-in-Lung-Cancer-_-identification-of-uncommon-mutations-final-1.pptx
Molecular-testing-in-Lung-Cancer-_-identification-of-uncommon-mutations-final-1.pptx
- 1. Molecular testing inLung Cancer: Identification of newer biomarkers Dr Anurag Mehta Director Laboratory Services Rajiv Gandhi Cancer Institute Delhi S P O T L I G H T I N N S C L C
- 2. Now KRAS 25% ALK 7% EGFR Sensitizing 17% No KnownOncogenic Driver Detected 31% EGFR Other 4% MET exon 14 skipping 3% > 1 Mutation 3% HER2 exon 20 insertion2% ROS1 2% BRAFV600E2% RET 2% NTRK < 1% PIK3CA 1% MEK1 < 1% 5 years back KRAS G12C 1. 5 additional actionable biomarkers for 1st line use. 2. Sotorasib – accelerated approval KRAS G12C (28/05/2021) after 1 line 3. 2 biomarkers directed therapies being used more often with level 2 evidence 4. New drugs for established drivers Adenocarcinoma 2 druggable biomarkers NRG fusions Boolell V, Alamgeer M, Watkins DN et.al. The evolution of therapies in NSCLC. Cancer(Basel)2015;7:1815-1846
- 3. LCMC demonstrates thatthe best outcomes are seen in patients with identified drivers placed on targeted therapy: 3.5-year median survival but without targeted therapy, 2.4 years Kris MG, Johnson BE, Berry LD, Kwiatkowski DJ et.al. JAMA. 2014;311(19):1998. Genome directed therapy provides improved survival
- 4. Overall survival (months) Combination CT(1973) SCLC and NSCLC 50 40 30 20 10 0 Platinum doublets (2002) NSCLC Platinum doublets and bevacizumab (2006) Non-squamous NSCLC Gefitinib (2009) EastAsian, never or light smoker NSCLC Erlotinib (2009) Spanish EGFR- mutant NSCLC Gefitinib (2009) Japanese EGFR- mutant NSCLC Crizotinib (2017) ALK-mutant NSCLC >45.8 months Extra 10 months 81 months Any ATKI 2019 Colorado 38.6 months Osimertinib FLAURA 2020 80 1. Adapted from Pao W & Chmielecki J. Nat Rev Cancer 2010;10:760–774 2. Mok T et al. Presented at ESMO 2017:LBA50 3. Clin Oncol 36:2251-2258. © 2018 4. Ramalingam SS et. al. N Eng J Med. 2020 Jan 2;382(1):41-50 5. Jose M. Pacheco et. al. J Thorac Oncol. 2019 April ; 14(4): 691–700 Treat as many - by Genome directed therapy
- 5. Know actionable Drivers •EGFR • ALK fusions • ROS1 fusions • BRAFV600E • RET fusions • Δ MET exon 14 • NTRK fusions • KRAS G12C • PDL1 Tissue is a bigger issue Other challenges
- 6. RET rearrangement 1. Seenin 1-2% of NSCLC. 2. Mechanism of action is similar to ALK and ROS1 fusions. • The chimeric protein formed by RET fusion is ligand free and drives cancer due to uninterrupted activated state 3. The RET gene sits in the 3’ position- retains the kinase domain and fuses with a partner at 5’ (KIF5B mostly)
- 7. Method Pros ConsConsider Using? IHC Most Labs, less expensive Performance Variable NO FISH Some Labs False Negative False Positive Rare circumstances RT-PCR Some Labs Not Tissue proficient Extensive multiplexing Long intronic regions – preclude DNA based rtPCR . mRNA based rtPCR preferred YES No commercially available Kit ? AmoyDX DNA NGS A few Labs Tissue proficient Panel design crucial Must Cover all break regions Mate pair reading YES RNA NGS A few Labs Tissue proficient Dependent upon RNA quality YES Expression imbalance Some Labs Fast, relatively inexpensive Need well established cut off YES, especially if part of panel evaluating multiple kinase fusions 40% Testing for RET fusion rearrangement Promising but yet to be fully validated. C. Belli, F. Penault-Llorca, M. Ladanyi, et.al. ESMO recommendations on the standard methods to detect RET fusions and mutations in daily practice and clinical research, Annals of Oncology, Volume 32, Issue 3, 2021,
- 8. 8 Advance NSCLC FFPE not available Liquid Biopsy NGS rtPCR FFPE available NGSAvailable DNA sequencing RNA sequencing preferred NGS not available FISH/RTPCR C. Belli, F. Penault-Llorca, M. Ladanyi, et.al. ESMO recommendations on the standard methods to detect RET fusions and mutations in daily practice and clinical research, Annals of Oncology, Volume 32, Issue 3, 2021,
- 9. 1. RET fusiontesting now should be part of any expanded panel of molecular tests 2. Majority of RET fusions detectable with DNA NGS but increased sensitivity with RNA NGS 3. Single gene alternative • FISH albeit limited sensitivity and specificity • IHC is available – not fully validated • rtPCR is a possible method
- 10. MET exon 14skipping 1. A new actionable biomarker 2. n- 3% for all NSCLC. LUAD, SCC, NOS 3. Mutually exclusive with other driver mutations 4. Recently approved highly effective treatments
- 11. Testing options forΔ MET exon 14 Testing Substrate DNA • Look for mutations /indels- 120 • Many may still be unknown mRNA An altered sequence missing bases assigned to exon 14 • A sequence of shorter length- 140 bp • Near perfect sensitivity • Shorter template makes it easy to amplify despite fragmentation of NA in FFPE tissue Optimization of Routine Testing for MET Exon 14 Splice Site Mutations in NSCLC Patients. Journal of Thoracic Oncology Vol. 13 No. 12: 1873-1883. 2018
- 12. NGS- Most favoredplatform Effectiveness of DNA sequencing: design dependent. • Oncomine and Illumina trusight fail to identify 5’ alterations ( No amplicon). • DNA sensitivity- 63% RNA: most sensitive More MET-ex14 mutations identified by RNA NGS than DNA NGS • DNA NGS: 16/644 (2.5%) All mutations identified by DNA assay were at or around splice site for intron 14 since assay did not include intron 13 splice acceptor site • RNA NGS: 25/644 (3.9%) Jurkiewicz. ASCO 2020. Abstr 9036.
- 13. DELETIONS •c.2888 (2-35 bpdel) •c.2903_3028+67del •c.2905_2940del •c.3010_3028+8del •c.3018_3028+8del •c.3020_3028+24del •c.3025_3027GAA>Gfs •c.3028+1_3028+9del MISSENSE •c.3008A>G (Y1003) •c.3028+2T>C •c.3028+1G>T •c.3028G>A (D1010)
- 14. Good call False Call Acceptablecall 1. Confirm by single gene assay 2. The other value may be testing for ∆MET exon 14 in SCC
- 15. PCR 1. DNA: PCRand sequence by Sanger Sequencing - identify SNVs and Dels • Must know all the alterations - skipping • Design the primers/probes accordingly 2. RNA: Amplify – sequence or fragment length analysis • technical considerations- integrity of mRNA
- 17. RISH EXON 13 EXON14 EXON 15 EXON 12 EXON 13 EXON 15 EXON 12
- 18. Summary 1. All NSCLCshould be tested. 2. RNA sequencing preferred as a part of composite NGS for broad molecular testing. 3. Labs not having access to NGS can use rt PCR or fragment sizing assay - a simple and robust method for MET exon14 skipping
- 19. NTRK fusion rearrangement Very rare (0.3% of NSCLC) but actionable if identified! Larotrectinib and Entrectinib both show significant clinical activity in patients with NTRK fusion–positive disease Multiple testing methods available to identify rearrangement
- 20. Testing for NTRKFusions Options: 1. IHC- false positivity 2. FISH – 3 probes 3. RT-PCR- ??? 4. DNA or RNA NGS FISH RT-PCR RNA NGS Marchiò. Ann Oncol. 2019;30:1417. ESMO Working Group Recommendations: Approach for NTRK Fusion Testing in NSCLC NTRK Testing YES NO NO YES Use IHC as a screening tool No TRK expression Detection of TRK expression Use frontline NGS, preferably with RNA testing when possible Is there a sequencing platform available? Histologic type consistent with recurrent NTRK fusions?
- 21. Testing for KRASG12C 1.QIAGEN therascreen® KRAS RGQ PCR Kit- Tissue 2. Guardant 360 – Plasma ( sensitivity -70%) 3. KRAS mutational testing – readily available – rtPCR, ddPCR. 4. NGS can be used both for tissue and plasma
- 22. FLOURESCENCE IN SITUHYBRIDIZATION (FISH)1,6 Fluorescent probes label specific gene regions causing them to fluoresce on microscopy IMMUNOHISTOCHEMISTRY (IHC)2,6 Antibodies detect specific proteins expressed by cells; a chemical reaction generates a colored deposit for cells expressing the antibody, identified using microscopy REAL TIME PCR RT-PCR (Reverse transcriptase-polymerase chain reaction) Target RNA is reverse transcribed to DNA amplified by PCR NEXT-GENERATION SEQUENCING (NGS)4, Using micro- and nano-technology to run parallel sequencing A number of molecular technologies are available Vincent MD et al. Curr Oncol 2012;19:S33–S44; 2. Ramos-Vara JA. Vet Pathol 2005;42:405–426; 3. Peake I. J Clin Pathol 1989;42:673–676; 4. Grada A & Weinbrecht K. J Invest Dermatol 2013;133:e11; 5. Kerr KM. J Thorac Oncol 2014;9:593–595 6. Tsao MS et al (eds). IASLC Atlas of ALK Testing in Lung Cancer 2013. https://www.iaslc.org/publications/iaslc-atlas-alk-testing-lung-cancer. Accessed May 28, 2014
- 23. Lap 1 a( save Tissue) Acinar, papillary, Lepidic NSCC- ADC Solid P40+ TTF1+ Solid P40- TTF1- Solid P40 - TTF1 + NSCC- favour ADC NSCC- favour ADC NSCC- NOS Extract DNA x10 ALK x 2 Ros x 2 Ros x 1 FISH PDL1 x 1 EGFR & BRAF V600E X 10 Extract RNA X 10 cDNA NGS SNV, CNV, Fusions Lap 1 b ( save Tissue) Lap 2 Additional 8-10% cases to treat / recruit in a trial ARMS PCR Cobas/ Therascreen Cytology- cell Blocks Plasma for EGFR & BRAF Liquid Biopsy for the other markers Used saved DNA
- 24. Biomarker Genetic aberrationfor testing Frequency (RGCIRC) Single gene assay FDA approved method EGFR Sensitizing Mutation 29.4% ARMS 1. Roche: Cobas EGFR Mutation Test v2 2. Qiagen: Therascreen EGFR RGQ PCR Kit 3. NGS: Oncomine Dx Target Test 4. Foundation One CDx EML4-ALK Rearrangement 8% IHC/ FISH/RTPCR 1. VENTANA ALK (D5F3) CDx Assay 2. Vysis ALK Break Apart FISH Probe Kit 3. Foundation One CDx Ros-1 Rearrangement 1.17% FISH IHC-D4D6(CONFIRM POSITIVE BY FISH 1. NGS: Oncomine Dx Target Test BRAFV600E Mutation 2% rtPCR 1. NGS: Oncomine Dx Target Test 2. Foundation One CDx Mutation- exon 14 skipping Mutations leading to truncated mRNA 3% Reverse transcriptase -PCR with sequencing or fragment sizing FoundationOne CDx NGS for Capmatinib Archer DX based RNA seq and ctDNA - NGS NTRK Fusion rearrangement 2% IHC/FISH/rtPCR FoundationOne CDx - larotrectinib RET Rearrangement FISH Oncomine Dx Target Test-Selpercatinib Oncomine Dx Target Tes- Pralsetinib NGS is an acceptable platform for testing several biomarkers together. Biomarker testing using Tissue/cytology- Single gene assays versus NGS
- 25. In conclusion, singlegene assays and NGS methods offer a good complementary workflow, with rapid results based on a restricted analysis using probes, followed by NGS analysis. We demonstrated that targeted NGS is a cost and time effective platform to detect multiple mutations simultaneously in various genes with high reproducibility and sensitivity. Thus, targeted NGS at diagnosis may provide useful information. This work is a proof of concept that targeted NGS is accessible in routine including large screening and reasonable cost. NGS should not be restricted to specific patients because many of the non-validated molecular alterations susceptible to targeted therapies have low prevalence. Is NGS a valid testing methodology?
- 26. NGS HAS BEENUSED TO FACILITATE PARALLEL TESTING FOR MULTIPLE GENE MUTATIONS IN A NATIONWIDE PROGRAM Barlesi F et al. Lancet 2016;387:1415–1426 • French National Cancer Institute-funded nationwide program • Systematic routine analysis of EGFR mutations, ALK rearrangements, KRAS, BRAF, HER2 and PIK3CA mutations in 17,664 patients with advanced NSCLC over 1 year Frequency of molecular aberrations from analyzed samples Genetic aberration recorded in ~50% Screen failure rates varied from 1 to 4% Presence of genetic aberration affected 1st-line treatment in ~51% of patients
- 27. Successes • Reliable indetecting known standard-of-care mutations, with good sensitivity and specificity1 • NGS testing panels may provide data on all known mutations allowing access to targeted treatment in 1st or later lines of therapy1 • Accurate identification of more clinically actionable alterations compared to current diagnostic tests2 • Acceptable turnaround time in obtaining analysis results3 NGS testing panels have been validated, though challenges exist 1. McCourt CM et al. PLoS One 2013;8:e69604; 2. Frampton GM et al. Nat Biotech 2013;31:1023–1031; 3. Barlesi F et al. Lancet 2016;387:1415–1426
- 28. 1. Because ofhighly effective targeted therapies (and little likelihood of benefit from ICIs), testing for EGFR/ALK/ROS1/BRAF/NTRK/METex14/RET / KRASG12C shall be offered to all patients with advance nonsquamous NSCLC • Exception – MET exon 14 skipping – test all histologies 2. Additional drugs likely to be approved in the not-too- distant future for HER2 and EGFR exon 20 insertions 3. Broad testing with NGS for both required and emerging biomarkers is now well recognized Conclusions For Pathologist 1. Take care of the tissue. 2. Use minimum IHC to type biopsies -LUAD/SCC/NOS 3. For squamous NSCLC, consider testing in young, never or light smokers, or if biopsy specimen is small or of mixed histology and for MET exon 14 skipping 4. Primary tumors and metastatic lesions are equally suitable 5. Bone biopsy potentially suboptimal due to decalcification and degradation of DNA 6. Bring NGS in to practice at greater pace 7. Liquid biopsy is an option worth considering
- 29. • cDNA basedassay • Forward: TGGGTTTTTCCTGTGGCTGA • Reverse: AGGATACTGCACTTGTCGGC Primers for fragment sizing assay for Met exon 14 skipping Total size of fragment= 235 Skipped 14- 140 TGGGTTTTTCCTGTGGCTGAAAAAGAGAAAGCAAATTAAAGATCTGG GCAGTGAATTAGTTCGCTACGATGCAAGAGTACACACTCCTCATTTGG ATAGGCTTGTAAGTGCCCGAAGTGTAAGCCCAACTACAGAAATGGTT TCAAATGAATCTGTAGACTACCGAGCTACTTTTCCAGAAGATCAGTTT CCTAATTCATCTCAGAACGGTTCATGCCGACAAGTGCAGTATCCT
Editor's Notes
- #2 What additional biomarker tests are required to meet new standards of care? The available testing methodologies and which one is best suited for the clinical practice? A schema to economize the use of tissue and optimize the use of extracted NA.
- #3 Rapid strides. From identifying driver mutations in 60% LUAD – we are now identifying drivers in as many as 70% LUAD. From 2 druggable biomarkers to 8 actionable tier1 drivers and another 2 or 3 as tier 2 drivers
- #20 NGS, next-generation sequencing; NSCLC, non-small-cell lung cancer; TAT, turnaround time.
- #23 CHALLENGES: FISH: requires an experienced cytogenetics lab with specialized personnel and equipment and the cost is high. IHC: relatively easy to perform, but the test has to be optimized and validated with adequate controls . The paraffin slides have to be cut fresh. IHC is sensitive to time of fixation. In general. Tumour specimens that are going to undergo IHC and molecular analysis should not be fixed for more than 48 hs. A strong amplification step may produce a false positive result. Different pathologists may have different appreciation of the staining results: different interpretation. IHC for EGFR exon 19 deletion and exon 21 mutation only. Absence of reaction needs to be corroborrated by sequencing. Maybe could be used in worse case scenario where no more tissue can be obtained and a positive EGFR IHC result is the only “biomarker” that the oncologist could use for treatment, however, CAP guidelines do not include IHC as a biomarker for EGFR TKI use. This kind of use out of the recommendation would depend on the oncologist decision. IHC FOR ALK: Two different antibodies: clone 5A4 from Abcam and D5F3 from Cell Singalling D5F3 is companion diagnostic for Crizotinib use RT-PCR: highly specific for particular gene fusion and does not detect alternative partners unless they are included in the assay. So it cannot be used for discovery It needs high quality RNA and high levels of skill NEXT GENERATION SEQUENCING: special assays can capture intronic sequences but needs higher tumour content. RNA degrades rapidly and it is difficult to use.
- #24 Pan-TRK (EPR17341) [NTRK]
- #25 BRAF V 600E and G469A, and D594G. V600E account for 50% of BRAF mutations.