SlideShare a Scribd company logo
1 of 29
Molecular testing in Lung Cancer: Identification of
newer biomarkers
Dr Anurag Mehta
Director Laboratory Services
Rajiv Gandhi Cancer Institute
Delhi
S P O T L I G H T I N N S C L C
Now
KRAS
25%
ALK
7%
EGFR Sensitizing
17%
No Known Oncogenic Driver
Detected
31%
EGFR Other 4%
MET exon 14 skipping 3%
> 1 Mutation 3%
HER2 exon 20 insertion2%
ROS1 2%
BRAFV600E2%
RET 2%
NTRK < 1%
PIK3CA 1%
MEK1 < 1%
5 years back
KRAS G12C
1. 5 additional actionable biomarkers for 1st line use.
2. Sotorasib – accelerated approval KRAS G12C (28/05/2021) after 1 line
3. 2 biomarkers directed therapies being used more often with level 2 evidence
4. New drugs for established drivers
Adenocarcinoma
2 druggable biomarkers
NRG fusions
Boolell V, Alamgeer M, Watkins DN et.al. The evolution of
therapies in NSCLC. Cancer(Basel)2015;7:1815-1846
LCMC demonstrates that the best outcomes are seen in
patients with identified drivers placed on targeted therapy:
3.5-year median survival but without targeted therapy, 2.4
years
Kris MG, Johnson BE, Berry LD, Kwiatkowski DJ et.al. JAMA.
2014;311(19):1998.
Genome directed therapy provides improved survival
Overall
survival
(months)
Combination
CT(1973)
SCLC and NSCLC
50
40
30
20
10
0
Platinum
doublets
(2002)
NSCLC
Platinum
doublets
and
bevacizumab
(2006)
Non-squamous
NSCLC
Gefitinib
(2009)
East Asian,
never or light
smoker
NSCLC
Erlotinib
(2009)
Spanish
EGFR- mutant
NSCLC
Gefitinib
(2009)
Japanese
EGFR- mutant
NSCLC
Crizotinib
(2017)
ALK-mutant
NSCLC
>45.8
months
Extra 10
months
81
months
Any ATKI
2019
Colorado
38.6
months
Osimertinib
FLAURA
2020
80
1. Adapted from Pao W & Chmielecki J. Nat Rev Cancer 2010;10:760–774
2. Mok T et al. Presented at ESMO 2017:LBA50
3. Clin Oncol 36:2251-2258. © 2018
4. Ramalingam SS et. al. N Eng J Med. 2020 Jan 2;382(1):41-50
5. Jose M. Pacheco et. al. J Thorac Oncol. 2019 April ; 14(4): 691–700
Treat as many - by
Genome directed therapy
Know actionable Drivers
• EGFR
• ALK fusions
• ROS1 fusions
• BRAFV600E
• RET fusions
• Δ MET exon 14
• NTRK fusions
• KRAS G12C
• PDL1
Tissue is a bigger issue
Other challenges
RET rearrangement
1. Seen in 1-2% of NSCLC.
2. Mechanism of action is similar to ALK and ROS1
fusions.
• The chimeric protein formed by RET fusion is
ligand free and drives cancer due to
uninterrupted activated state
3. The RET gene sits in the 3’ position- retains the
kinase domain and fuses with a partner at 5’
(KIF5B mostly)
Method Pros Cons Consider Using?
IHC
Most Labs, less
expensive
Performance Variable NO
FISH Some Labs
False Negative
False Positive
Rare
circumstances
RT-PCR
Some Labs
Not Tissue proficient
Extensive multiplexing
Long intronic regions – preclude DNA
based rtPCR .
mRNA based rtPCR preferred
YES
No commercially
available Kit
? AmoyDX
DNA NGS
A few Labs
Tissue proficient
Panel design crucial
Must Cover all break regions
Mate pair reading
YES
RNA NGS
A few Labs
Tissue proficient
Dependent upon RNA quality YES
Expression
imbalance
Some Labs
Fast, relatively
inexpensive
Need well established cut off
YES, especially if
part of panel
evaluating
multiple kinase
fusions
40%
Testing for RET fusion rearrangement
Promising but yet to be fully validated.
C. Belli, F. Penault-Llorca, M. Ladanyi, et.al. ESMO recommendations on the standard methods to detect RET fusions and
mutations in daily practice and clinical research, Annals of Oncology, Volume 32, Issue 3, 2021,
8
Advance
NSCLC
FFPE
not available
Liquid
Biopsy
NGS
rtPCR
FFPE available
NGS Available
DNA sequencing
RNA sequencing
preferred
NGS
not available
FISH/RTPCR
C. Belli, F. Penault-Llorca, M. Ladanyi, et.al. ESMO recommendations on the standard methods to detect RET fusions and
mutations in daily practice and clinical research, Annals of Oncology, Volume 32, Issue 3, 2021,
1. RET fusion testing now should be part of any expanded panel of molecular
tests
2. Majority of RET fusions detectable with DNA NGS but increased sensitivity
with RNA NGS
3. Single gene alternative
• FISH albeit limited sensitivity and specificity
• IHC is available – not fully validated
• rtPCR is a possible method
MET exon 14 skipping
1. A new actionable biomarker
2. n- 3% for all NSCLC. LUAD, SCC, NOS
3. Mutually exclusive with other driver mutations
4. Recently approved highly effective treatments
Testing options for Δ MET exon 14
Testing Substrate
DNA
• Look for mutations /indels- 120
• Many may still be unknown
mRNA
 An altered sequence missing bases assigned to exon 14
• A sequence of shorter length- 140 bp
• Near perfect sensitivity
• Shorter template makes it easy to amplify despite fragmentation of NA in FFPE tissue
Optimization of Routine Testing for MET Exon 14 Splice Site Mutations in NSCLC Patients. Journal of Thoracic Oncology Vol.
13 No. 12: 1873-1883. 2018
NGS- Most favored platform
Effectiveness of DNA sequencing: design dependent.
• Oncomine and Illumina trusight fail to identify 5’ alterations ( No amplicon).
• DNA sensitivity- 63%
RNA: most sensitive
More MET-ex14 mutations identified by RNA NGS than DNA NGS
• DNA NGS: 16/644 (2.5%)
All mutations identified by DNA assay were at or around splice site for intron 14
since assay did not include intron 13 splice acceptor site
• RNA NGS: 25/644 (3.9%) Jurkiewicz. ASCO 2020. Abstr 9036.
DELETIONS
•c.2888 (2-35 bp del)
•c.2903_3028+67del
•c.2905_2940del
•c.3010_3028+8del
•c.3018_3028+8del
•c.3020_3028+24del
•c.3025_3027GAA>Gfs
•c.3028+1_3028+9del
MISSENSE
•c.3008A>G (Y1003)
•c.3028+2T>C
•c.3028+1G>T
•c.3028G>A (D1010)
Good call
False Call
Acceptable call
1. Confirm by single gene assay
2. The other value may be testing for ∆MET
exon 14 in SCC
PCR
1. DNA: PCR and sequence by Sanger Sequencing - identify SNVs and Dels
• Must know all the alterations - skipping
• Design the primers/probes accordingly
2. RNA: Amplify – sequence or fragment length analysis
• technical considerations- integrity of mRNA
RISH
EXON 13 EXON 14 EXON 15
EXON 12
EXON 13 EXON 15
EXON 12
Summary
1. All NSCLC should be tested.
2. RNA sequencing preferred as a part of composite NGS for broad molecular
testing.
3. Labs not having access to NGS can use rt PCR or fragment sizing assay - a simple
and robust method for MET exon14 skipping
NTRK fusion rearrangement
 Very rare (0.3% of NSCLC) but actionable if identified!
 Larotrectinib and Entrectinib both show significant clinical activity in
patients with NTRK fusion–positive disease
 Multiple testing methods available to identify rearrangement
Testing for NTRK Fusions
Options:
1. IHC- false positivity
2. FISH – 3 probes
3. RT-PCR- ???
4. DNA or RNA NGS
FISH
RT-PCR
RNA NGS
Marchiò. Ann Oncol. 2019;30:1417.
ESMO Working Group Recommendations:
Approach for NTRK Fusion Testing in NSCLC
NTRK Testing
YES NO
NO YES
Use IHC as a screening tool
No TRK
expression
Detection of TRK
expression
Use frontline NGS,
preferably with RNA
testing when possible
Is there a sequencing
platform available?
Histologic type
consistent with recurrent
NTRK fusions?
Testing for KRASG12C
1. QIAGEN therascreen® KRAS RGQ PCR Kit- Tissue
2. Guardant 360 – Plasma ( sensitivity -70%)
3. KRAS mutational testing – readily available – rtPCR, ddPCR.
4. NGS can be used both for tissue and plasma
FLOURESCENCE IN SITU HYBRIDIZATION (FISH)1,6
Fluorescent probes label specific gene regions causing them to
fluoresce on microscopy
IMMUNOHISTOCHEMISTRY (IHC)2,6
Antibodies detect specific proteins expressed by cells; a chemical
reaction generates a colored deposit for cells expressing the
antibody, identified using microscopy
REAL TIME PCR
RT-PCR (Reverse transcriptase-polymerase chain reaction)
Target RNA is reverse transcribed to DNA amplified by PCR
NEXT-GENERATION SEQUENCING (NGS)4,
Using micro- and nano-technology to run parallel sequencing
A number of molecular technologies are available
Vincent MD et al. Curr Oncol 2012;19:S33–S44; 2. Ramos-Vara JA. Vet Pathol 2005;42:405–426; 3. Peake I. J Clin Pathol 1989;42:673–676; 4. Grada A &
Weinbrecht K. J Invest Dermatol 2013;133:e11; 5. Kerr KM. J Thorac Oncol 2014;9:593–595 6. Tsao MS et al (eds). IASLC Atlas of ALK Testing in Lung Cancer
2013. https://www.iaslc.org/publications/iaslc-atlas-alk-testing-lung-cancer. Accessed May 28, 2014
Lap 1 a ( save Tissue)
Acinar, papillary, Lepidic
NSCC- ADC
Solid P40+
TTF1+
Solid P40-
TTF1-
Solid P40 -
TTF1
+
NSCC- favour ADC
NSCC- favour ADC
NSCC- NOS
Extract DNA x10
ALK x 2 Ros x 2
Ros x 1
FISH
PDL1 x 1
EGFR & BRAF V600E X 10
Extract RNA X 10
cDNA
NGS
SNV, CNV, Fusions
Lap 1 b ( save Tissue)
Lap 2
Additional 8-10% cases to treat /
recruit in a trial
ARMS PCR
Cobas/ Therascreen
Cytology- cell Blocks
Plasma for EGFR & BRAF
Liquid Biopsy for the other markers
Used saved DNA
Biomarker Genetic aberration for testing
Frequency
(RGCIRC)
Single gene assay FDA approved method
EGFR Sensitizing Mutation 29.4% ARMS
1. Roche: Cobas EGFR Mutation Test v2
2. Qiagen: Therascreen EGFR RGQ PCR Kit
3. NGS: Oncomine Dx Target Test
4. Foundation One CDx
EML4-ALK Rearrangement 8% IHC/ FISH/RTPCR
1. VENTANA ALK (D5F3) CDx Assay
2. Vysis ALK Break Apart FISH Probe Kit
3. Foundation One CDx
Ros-1 Rearrangement 1.17%
FISH
IHC-D4D6(CONFIRM POSITIVE BY
FISH
1. NGS: Oncomine Dx Target Test
BRAFV600E Mutation 2% rtPCR
1. NGS: Oncomine Dx Target Test
2. Foundation One CDx
Mutation- exon
14 skipping
Mutations leading to truncated
mRNA
3%
Reverse transcriptase -PCR with
sequencing or fragment sizing
FoundationOne CDx NGS for Capmatinib
Archer DX based RNA seq and ctDNA - NGS
NTRK Fusion rearrangement 2% IHC/FISH/rtPCR FoundationOne CDx - larotrectinib
RET Rearrangement FISH
Oncomine Dx Target Test-Selpercatinib
Oncomine Dx Target Tes- Pralsetinib
NGS is an acceptable platform for testing several biomarkers together.
Biomarker testing using Tissue/cytology- Single gene assays versus NGS
In conclusion, single gene assays and NGS methods offer a good complementary workflow, with rapid results based on
a restricted analysis using probes, followed by NGS analysis. We demonstrated that targeted NGS is a cost and
time effective platform to detect multiple mutations simultaneously in various genes with
high reproducibility and sensitivity. Thus, targeted NGS at diagnosis may provide useful information. This
work is a proof of concept that targeted NGS is accessible in routine including large screening and reasonable cost.
NGS should not be restricted to specific patients because many of the non-validated molecular alterations susceptible
to targeted therapies have low prevalence.
Is NGS a valid testing methodology?
NGS HAS BEEN USED TO FACILITATE PARALLEL TESTING FOR MULTIPLE GENE MUTATIONS IN
A NATIONWIDE PROGRAM
Barlesi F et al. Lancet 2016;387:1415–1426
• French National Cancer Institute-funded nationwide program
• Systematic routine analysis of EGFR mutations, ALK rearrangements, KRAS, BRAF, HER2
and PIK3CA mutations in 17,664 patients with advanced NSCLC over 1 year
Frequency of molecular aberrations from analyzed samples
 Genetic aberration recorded in ~50%
 Screen failure rates varied from 1 to 4%
 Presence of genetic aberration affected
1st-line treatment in ~51% of patients
Successes
• Reliable in detecting known standard-of-care mutations, with good sensitivity and
specificity1
• NGS testing panels may provide data on all known mutations allowing access to targeted
treatment in 1st or later lines of therapy1
• Accurate identification of more clinically actionable alterations compared to current
diagnostic tests2
• Acceptable turnaround time in obtaining analysis results3
NGS testing panels have been validated, though challenges exist
1. McCourt CM et al. PLoS One 2013;8:e69604;
2. Frampton GM et al. Nat Biotech 2013;31:1023–1031;
3. Barlesi F et al. Lancet 2016;387:1415–1426
1. Because of highly effective targeted therapies (and little
likelihood of benefit from ICIs), testing for
EGFR/ALK/ROS1/BRAF/NTRK/METex14/RET / KRASG12C
shall be offered to all patients with advance
nonsquamous NSCLC
• Exception – MET exon 14 skipping – test all
histologies
2. Additional drugs likely to be approved in the not-too-
distant future for HER2 and EGFR exon 20 insertions
3. Broad testing with NGS for both required and emerging
biomarkers is now well recognized
Conclusions
For Pathologist
1. Take care of the tissue.
2. Use minimum IHC to type biopsies -LUAD/SCC/NOS
3. For squamous NSCLC, consider testing in young,
never or light smokers, or if biopsy specimen is small
or of mixed histology and for MET exon 14 skipping
4. Primary tumors and metastatic lesions are equally
suitable
5. Bone biopsy potentially suboptimal due to
decalcification and degradation of DNA
6. Bring NGS in to practice at greater pace
7. Liquid biopsy is an option worth considering
• cDNA based assay
• Forward: TGGGTTTTTCCTGTGGCTGA
• Reverse: AGGATACTGCACTTGTCGGC
Primers for fragment sizing assay for Met exon 14 skipping
Total size of fragment= 235
Skipped 14- 140
TGGGTTTTTCCTGTGGCTGAAAAAGAGAAAGCAAATTAAAGATCTGG
GCAGTGAATTAGTTCGCTACGATGCAAGAGTACACACTCCTCATTTGG
ATAGGCTTGTAAGTGCCCGAAGTGTAAGCCCAACTACAGAAATGGTT
TCAAATGAATCTGTAGACTACCGAGCTACTTTTCCAGAAGATCAGTTT
CCTAATTCATCTCAGAACGGTTCATGCCGACAAGTGCAGTATCCT

More Related Content

Similar to Molecular testing in Lung Cancer identifies new biomarkers

Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
 
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Thermo Fisher Scientific
 
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...Thermo Fisher Scientific
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
 
AFLP A New Technique For DNA Fingerprinting
AFLP  A New Technique For DNA FingerprintingAFLP  A New Technique For DNA Fingerprinting
AFLP A New Technique For DNA FingerprintingJim Webb
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochureAffymetrix
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
 
Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...
Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...
Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...Marta Marinucci
 
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCRMultiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCRThermo Fisher Scientific
 
trusight-tumor-15-cfdna-white-paper-1170-2016-016
trusight-tumor-15-cfdna-white-paper-1170-2016-016trusight-tumor-15-cfdna-white-paper-1170-2016-016
trusight-tumor-15-cfdna-white-paper-1170-2016-016Andrew Hinton
 
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030Thermo Fisher Scientific
 
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAAn NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAThermo Fisher Scientific
 
Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,Karan Veer Singh
 
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...The OncoScan(TM) platform for analysis of copy number and somatic mutations i...
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...Lawrence Greenfield
 
Personalized Oncology Through Integrative High-Throughput Sequencing:
Personalized Oncology Through Integrative High-Throughput Sequencing:Personalized Oncology Through Integrative High-Throughput Sequencing:
Personalized Oncology Through Integrative High-Throughput Sequencing:Raunak Shrestha
 
Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...
Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...
Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...Thermo Fisher Scientific
 
Silencing RNA techniques
Silencing RNA techniquesSilencing RNA techniques
Silencing RNA techniquesmds-web
 

Similar to Molecular testing in Lung Cancer identifies new biomarkers (20)

Transcriptomics approaches
Transcriptomics approachesTranscriptomics approaches
Transcriptomics approaches
 
Selective, Potent, Different: How to Enhance Clinical Benefits With Next-Gene...
Selective, Potent, Different: How to Enhance Clinical Benefits With Next-Gene...Selective, Potent, Different: How to Enhance Clinical Benefits With Next-Gene...
Selective, Potent, Different: How to Enhance Clinical Benefits With Next-Gene...
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
 
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...
 
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
 
AFLP A New Technique For DNA Fingerprinting
AFLP  A New Technique For DNA FingerprintingAFLP  A New Technique For DNA Fingerprinting
AFLP A New Technique For DNA Fingerprinting
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochure
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
 
Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...
Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...
Final Dissertation - Gene silencing of a receptor-targeted bioconjugate with ...
 
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCRMultiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR
Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR
 
trusight-tumor-15-cfdna-white-paper-1170-2016-016
trusight-tumor-15-cfdna-white-paper-1170-2016-016trusight-tumor-15-cfdna-white-paper-1170-2016-016
trusight-tumor-15-cfdna-white-paper-1170-2016-016
 
Thesis Intro for LinkedIn
Thesis Intro for LinkedInThesis Intro for LinkedIn
Thesis Intro for LinkedIn
 
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
TaqMan® Rare Mutation Assays w/ Digital PCR | ESHG 2015 Poster PM14.030
 
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAAn NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
 
Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,Single nucleotide polymorphisms (sn ps), haplotypes,
Single nucleotide polymorphisms (sn ps), haplotypes,
 
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...The OncoScan(TM) platform for analysis of copy number and somatic mutations i...
The OncoScan(TM) platform for analysis of copy number and somatic mutations i...
 
Personalized Oncology Through Integrative High-Throughput Sequencing:
Personalized Oncology Through Integrative High-Throughput Sequencing:Personalized Oncology Through Integrative High-Throughput Sequencing:
Personalized Oncology Through Integrative High-Throughput Sequencing:
 
Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...
Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...
Verification of an Ion AmpliSeq™ RNA Fusion Lung Cancer Research Panel, workf...
 
Silencing RNA techniques
Silencing RNA techniquesSilencing RNA techniques
Silencing RNA techniques
 

Recently uploaded

Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...narwatsonia7
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...narwatsonia7
 
Call Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service SuratCall Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service Suratnarwatsonia7
 
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service MumbaiLow Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbaisonalikaur4
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024Gabriel Guevara MD
 
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...narwatsonia7
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...narwatsonia7
 
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbersBook Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbersnarwatsonia7
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Miss joya
 
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfHemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfMedicoseAcademics
 
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service BangaloreCall Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalorenarwatsonia7
 
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safenarwatsonia7
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 

Recently uploaded (20)

Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service MumbaiVIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
VIP Call Girls Mumbai Arpita 9910780858 Independent Escort Service Mumbai
 
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
Call Girls Frazer Town Just Call 7001305949 Top Class Call Girl Service Avail...
 
Call Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service SuratCall Girl Surat Madhuri 7001305949 Independent Escort Service Surat
Call Girl Surat Madhuri 7001305949 Independent Escort Service Surat
 
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service MumbaiLow Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
Low Rate Call Girls Mumbai Suman 9910780858 Independent Escort Service Mumbai
 
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
Call Girls ITPL Just Call 7001305949 Top Class Call Girl Service Available
 
Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024Asthma Review - GINA guidelines summary 2024
Asthma Review - GINA guidelines summary 2024
 
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
Call Girls Service in Bommanahalli - 7001305949 with real photos and phone nu...
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment BookingCall Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
Call Girl Koramangala | 7001305949 At Low Cost Cash Payment Booking
 
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jp Nagar Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
Call Girls Kanakapura Road Just Call 7001305949 Top Class Call Girl Service A...
 
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbersBook Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
Book Call Girls in Kasavanahalli - 7001305949 with real photos and phone numbers
 
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Jayanagar Just Call 7001305949 Top Class Call Girl Service Available
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
 
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdfHemostasis Physiology and Clinical correlations by Dr Faiza.pdf
Hemostasis Physiology and Clinical correlations by Dr Faiza.pdf
 
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service BangaloreCall Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
 
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% SafeBangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
Bangalore Call Girls Majestic 📞 9907093804 High Profile Service 100% Safe
 
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Hebbal Just Call 7001305949 Top Class Call Girl Service Available
 

Molecular testing in Lung Cancer identifies new biomarkers

  • 1. Molecular testing in Lung Cancer: Identification of newer biomarkers Dr Anurag Mehta Director Laboratory Services Rajiv Gandhi Cancer Institute Delhi S P O T L I G H T I N N S C L C
  • 2. Now KRAS 25% ALK 7% EGFR Sensitizing 17% No Known Oncogenic Driver Detected 31% EGFR Other 4% MET exon 14 skipping 3% > 1 Mutation 3% HER2 exon 20 insertion2% ROS1 2% BRAFV600E2% RET 2% NTRK < 1% PIK3CA 1% MEK1 < 1% 5 years back KRAS G12C 1. 5 additional actionable biomarkers for 1st line use. 2. Sotorasib – accelerated approval KRAS G12C (28/05/2021) after 1 line 3. 2 biomarkers directed therapies being used more often with level 2 evidence 4. New drugs for established drivers Adenocarcinoma 2 druggable biomarkers NRG fusions Boolell V, Alamgeer M, Watkins DN et.al. The evolution of therapies in NSCLC. Cancer(Basel)2015;7:1815-1846
  • 3. LCMC demonstrates that the best outcomes are seen in patients with identified drivers placed on targeted therapy: 3.5-year median survival but without targeted therapy, 2.4 years Kris MG, Johnson BE, Berry LD, Kwiatkowski DJ et.al. JAMA. 2014;311(19):1998. Genome directed therapy provides improved survival
  • 4. Overall survival (months) Combination CT(1973) SCLC and NSCLC 50 40 30 20 10 0 Platinum doublets (2002) NSCLC Platinum doublets and bevacizumab (2006) Non-squamous NSCLC Gefitinib (2009) East Asian, never or light smoker NSCLC Erlotinib (2009) Spanish EGFR- mutant NSCLC Gefitinib (2009) Japanese EGFR- mutant NSCLC Crizotinib (2017) ALK-mutant NSCLC >45.8 months Extra 10 months 81 months Any ATKI 2019 Colorado 38.6 months Osimertinib FLAURA 2020 80 1. Adapted from Pao W & Chmielecki J. Nat Rev Cancer 2010;10:760–774 2. Mok T et al. Presented at ESMO 2017:LBA50 3. Clin Oncol 36:2251-2258. © 2018 4. Ramalingam SS et. al. N Eng J Med. 2020 Jan 2;382(1):41-50 5. Jose M. Pacheco et. al. J Thorac Oncol. 2019 April ; 14(4): 691–700 Treat as many - by Genome directed therapy
  • 5. Know actionable Drivers • EGFR • ALK fusions • ROS1 fusions • BRAFV600E • RET fusions • Δ MET exon 14 • NTRK fusions • KRAS G12C • PDL1 Tissue is a bigger issue Other challenges
  • 6. RET rearrangement 1. Seen in 1-2% of NSCLC. 2. Mechanism of action is similar to ALK and ROS1 fusions. • The chimeric protein formed by RET fusion is ligand free and drives cancer due to uninterrupted activated state 3. The RET gene sits in the 3’ position- retains the kinase domain and fuses with a partner at 5’ (KIF5B mostly)
  • 7. Method Pros Cons Consider Using? IHC Most Labs, less expensive Performance Variable NO FISH Some Labs False Negative False Positive Rare circumstances RT-PCR Some Labs Not Tissue proficient Extensive multiplexing Long intronic regions – preclude DNA based rtPCR . mRNA based rtPCR preferred YES No commercially available Kit ? AmoyDX DNA NGS A few Labs Tissue proficient Panel design crucial Must Cover all break regions Mate pair reading YES RNA NGS A few Labs Tissue proficient Dependent upon RNA quality YES Expression imbalance Some Labs Fast, relatively inexpensive Need well established cut off YES, especially if part of panel evaluating multiple kinase fusions 40% Testing for RET fusion rearrangement Promising but yet to be fully validated. C. Belli, F. Penault-Llorca, M. Ladanyi, et.al. ESMO recommendations on the standard methods to detect RET fusions and mutations in daily practice and clinical research, Annals of Oncology, Volume 32, Issue 3, 2021,
  • 8. 8 Advance NSCLC FFPE not available Liquid Biopsy NGS rtPCR FFPE available NGS Available DNA sequencing RNA sequencing preferred NGS not available FISH/RTPCR C. Belli, F. Penault-Llorca, M. Ladanyi, et.al. ESMO recommendations on the standard methods to detect RET fusions and mutations in daily practice and clinical research, Annals of Oncology, Volume 32, Issue 3, 2021,
  • 9. 1. RET fusion testing now should be part of any expanded panel of molecular tests 2. Majority of RET fusions detectable with DNA NGS but increased sensitivity with RNA NGS 3. Single gene alternative • FISH albeit limited sensitivity and specificity • IHC is available – not fully validated • rtPCR is a possible method
  • 10. MET exon 14 skipping 1. A new actionable biomarker 2. n- 3% for all NSCLC. LUAD, SCC, NOS 3. Mutually exclusive with other driver mutations 4. Recently approved highly effective treatments
  • 11. Testing options for Δ MET exon 14 Testing Substrate DNA • Look for mutations /indels- 120 • Many may still be unknown mRNA  An altered sequence missing bases assigned to exon 14 • A sequence of shorter length- 140 bp • Near perfect sensitivity • Shorter template makes it easy to amplify despite fragmentation of NA in FFPE tissue Optimization of Routine Testing for MET Exon 14 Splice Site Mutations in NSCLC Patients. Journal of Thoracic Oncology Vol. 13 No. 12: 1873-1883. 2018
  • 12. NGS- Most favored platform Effectiveness of DNA sequencing: design dependent. • Oncomine and Illumina trusight fail to identify 5’ alterations ( No amplicon). • DNA sensitivity- 63% RNA: most sensitive More MET-ex14 mutations identified by RNA NGS than DNA NGS • DNA NGS: 16/644 (2.5%) All mutations identified by DNA assay were at or around splice site for intron 14 since assay did not include intron 13 splice acceptor site • RNA NGS: 25/644 (3.9%) Jurkiewicz. ASCO 2020. Abstr 9036.
  • 13. DELETIONS •c.2888 (2-35 bp del) •c.2903_3028+67del •c.2905_2940del •c.3010_3028+8del •c.3018_3028+8del •c.3020_3028+24del •c.3025_3027GAA>Gfs •c.3028+1_3028+9del MISSENSE •c.3008A>G (Y1003) •c.3028+2T>C •c.3028+1G>T •c.3028G>A (D1010)
  • 14. Good call False Call Acceptable call 1. Confirm by single gene assay 2. The other value may be testing for ∆MET exon 14 in SCC
  • 15. PCR 1. DNA: PCR and sequence by Sanger Sequencing - identify SNVs and Dels • Must know all the alterations - skipping • Design the primers/probes accordingly 2. RNA: Amplify – sequence or fragment length analysis • technical considerations- integrity of mRNA
  • 16.
  • 17. RISH EXON 13 EXON 14 EXON 15 EXON 12 EXON 13 EXON 15 EXON 12
  • 18. Summary 1. All NSCLC should be tested. 2. RNA sequencing preferred as a part of composite NGS for broad molecular testing. 3. Labs not having access to NGS can use rt PCR or fragment sizing assay - a simple and robust method for MET exon14 skipping
  • 19. NTRK fusion rearrangement  Very rare (0.3% of NSCLC) but actionable if identified!  Larotrectinib and Entrectinib both show significant clinical activity in patients with NTRK fusion–positive disease  Multiple testing methods available to identify rearrangement
  • 20. Testing for NTRK Fusions Options: 1. IHC- false positivity 2. FISH – 3 probes 3. RT-PCR- ??? 4. DNA or RNA NGS FISH RT-PCR RNA NGS Marchiò. Ann Oncol. 2019;30:1417. ESMO Working Group Recommendations: Approach for NTRK Fusion Testing in NSCLC NTRK Testing YES NO NO YES Use IHC as a screening tool No TRK expression Detection of TRK expression Use frontline NGS, preferably with RNA testing when possible Is there a sequencing platform available? Histologic type consistent with recurrent NTRK fusions?
  • 21. Testing for KRASG12C 1. QIAGEN therascreen® KRAS RGQ PCR Kit- Tissue 2. Guardant 360 – Plasma ( sensitivity -70%) 3. KRAS mutational testing – readily available – rtPCR, ddPCR. 4. NGS can be used both for tissue and plasma
  • 22. FLOURESCENCE IN SITU HYBRIDIZATION (FISH)1,6 Fluorescent probes label specific gene regions causing them to fluoresce on microscopy IMMUNOHISTOCHEMISTRY (IHC)2,6 Antibodies detect specific proteins expressed by cells; a chemical reaction generates a colored deposit for cells expressing the antibody, identified using microscopy REAL TIME PCR RT-PCR (Reverse transcriptase-polymerase chain reaction) Target RNA is reverse transcribed to DNA amplified by PCR NEXT-GENERATION SEQUENCING (NGS)4, Using micro- and nano-technology to run parallel sequencing A number of molecular technologies are available Vincent MD et al. Curr Oncol 2012;19:S33–S44; 2. Ramos-Vara JA. Vet Pathol 2005;42:405–426; 3. Peake I. J Clin Pathol 1989;42:673–676; 4. Grada A & Weinbrecht K. J Invest Dermatol 2013;133:e11; 5. Kerr KM. J Thorac Oncol 2014;9:593–595 6. Tsao MS et al (eds). IASLC Atlas of ALK Testing in Lung Cancer 2013. https://www.iaslc.org/publications/iaslc-atlas-alk-testing-lung-cancer. Accessed May 28, 2014
  • 23. Lap 1 a ( save Tissue) Acinar, papillary, Lepidic NSCC- ADC Solid P40+ TTF1+ Solid P40- TTF1- Solid P40 - TTF1 + NSCC- favour ADC NSCC- favour ADC NSCC- NOS Extract DNA x10 ALK x 2 Ros x 2 Ros x 1 FISH PDL1 x 1 EGFR & BRAF V600E X 10 Extract RNA X 10 cDNA NGS SNV, CNV, Fusions Lap 1 b ( save Tissue) Lap 2 Additional 8-10% cases to treat / recruit in a trial ARMS PCR Cobas/ Therascreen Cytology- cell Blocks Plasma for EGFR & BRAF Liquid Biopsy for the other markers Used saved DNA
  • 24. Biomarker Genetic aberration for testing Frequency (RGCIRC) Single gene assay FDA approved method EGFR Sensitizing Mutation 29.4% ARMS 1. Roche: Cobas EGFR Mutation Test v2 2. Qiagen: Therascreen EGFR RGQ PCR Kit 3. NGS: Oncomine Dx Target Test 4. Foundation One CDx EML4-ALK Rearrangement 8% IHC/ FISH/RTPCR 1. VENTANA ALK (D5F3) CDx Assay 2. Vysis ALK Break Apart FISH Probe Kit 3. Foundation One CDx Ros-1 Rearrangement 1.17% FISH IHC-D4D6(CONFIRM POSITIVE BY FISH 1. NGS: Oncomine Dx Target Test BRAFV600E Mutation 2% rtPCR 1. NGS: Oncomine Dx Target Test 2. Foundation One CDx Mutation- exon 14 skipping Mutations leading to truncated mRNA 3% Reverse transcriptase -PCR with sequencing or fragment sizing FoundationOne CDx NGS for Capmatinib Archer DX based RNA seq and ctDNA - NGS NTRK Fusion rearrangement 2% IHC/FISH/rtPCR FoundationOne CDx - larotrectinib RET Rearrangement FISH Oncomine Dx Target Test-Selpercatinib Oncomine Dx Target Tes- Pralsetinib NGS is an acceptable platform for testing several biomarkers together. Biomarker testing using Tissue/cytology- Single gene assays versus NGS
  • 25. In conclusion, single gene assays and NGS methods offer a good complementary workflow, with rapid results based on a restricted analysis using probes, followed by NGS analysis. We demonstrated that targeted NGS is a cost and time effective platform to detect multiple mutations simultaneously in various genes with high reproducibility and sensitivity. Thus, targeted NGS at diagnosis may provide useful information. This work is a proof of concept that targeted NGS is accessible in routine including large screening and reasonable cost. NGS should not be restricted to specific patients because many of the non-validated molecular alterations susceptible to targeted therapies have low prevalence. Is NGS a valid testing methodology?
  • 26. NGS HAS BEEN USED TO FACILITATE PARALLEL TESTING FOR MULTIPLE GENE MUTATIONS IN A NATIONWIDE PROGRAM Barlesi F et al. Lancet 2016;387:1415–1426 • French National Cancer Institute-funded nationwide program • Systematic routine analysis of EGFR mutations, ALK rearrangements, KRAS, BRAF, HER2 and PIK3CA mutations in 17,664 patients with advanced NSCLC over 1 year Frequency of molecular aberrations from analyzed samples  Genetic aberration recorded in ~50%  Screen failure rates varied from 1 to 4%  Presence of genetic aberration affected 1st-line treatment in ~51% of patients
  • 27. Successes • Reliable in detecting known standard-of-care mutations, with good sensitivity and specificity1 • NGS testing panels may provide data on all known mutations allowing access to targeted treatment in 1st or later lines of therapy1 • Accurate identification of more clinically actionable alterations compared to current diagnostic tests2 • Acceptable turnaround time in obtaining analysis results3 NGS testing panels have been validated, though challenges exist 1. McCourt CM et al. PLoS One 2013;8:e69604; 2. Frampton GM et al. Nat Biotech 2013;31:1023–1031; 3. Barlesi F et al. Lancet 2016;387:1415–1426
  • 28. 1. Because of highly effective targeted therapies (and little likelihood of benefit from ICIs), testing for EGFR/ALK/ROS1/BRAF/NTRK/METex14/RET / KRASG12C shall be offered to all patients with advance nonsquamous NSCLC • Exception – MET exon 14 skipping – test all histologies 2. Additional drugs likely to be approved in the not-too- distant future for HER2 and EGFR exon 20 insertions 3. Broad testing with NGS for both required and emerging biomarkers is now well recognized Conclusions For Pathologist 1. Take care of the tissue. 2. Use minimum IHC to type biopsies -LUAD/SCC/NOS 3. For squamous NSCLC, consider testing in young, never or light smokers, or if biopsy specimen is small or of mixed histology and for MET exon 14 skipping 4. Primary tumors and metastatic lesions are equally suitable 5. Bone biopsy potentially suboptimal due to decalcification and degradation of DNA 6. Bring NGS in to practice at greater pace 7. Liquid biopsy is an option worth considering
  • 29. • cDNA based assay • Forward: TGGGTTTTTCCTGTGGCTGA • Reverse: AGGATACTGCACTTGTCGGC Primers for fragment sizing assay for Met exon 14 skipping Total size of fragment= 235 Skipped 14- 140 TGGGTTTTTCCTGTGGCTGAAAAAGAGAAAGCAAATTAAAGATCTGG GCAGTGAATTAGTTCGCTACGATGCAAGAGTACACACTCCTCATTTGG ATAGGCTTGTAAGTGCCCGAAGTGTAAGCCCAACTACAGAAATGGTT TCAAATGAATCTGTAGACTACCGAGCTACTTTTCCAGAAGATCAGTTT CCTAATTCATCTCAGAACGGTTCATGCCGACAAGTGCAGTATCCT

Editor's Notes

  1. What additional biomarker tests are required to meet new standards of care? The available testing methodologies and which one is best suited for the clinical practice? A schema to economize the use of tissue and optimize the use of extracted NA.
  2. Rapid strides. From identifying driver mutations in 60% LUAD – we are now identifying drivers in as many as 70% LUAD. From 2 druggable biomarkers to 8 actionable tier1 drivers and another 2 or 3 as tier 2 drivers
  3. NGS, next-generation sequencing; NSCLC, non-small-cell lung cancer; TAT, turnaround time.
  4. CHALLENGES: FISH: requires an experienced cytogenetics lab with specialized personnel and equipment and the cost is high. IHC: relatively easy to perform, but the test has to be optimized and validated with adequate controls . The paraffin slides have to be cut fresh. IHC is sensitive to time of fixation. In general. Tumour specimens that are going to undergo IHC and molecular analysis should not be fixed for more than 48 hs. A strong amplification step may produce a false positive result. Different pathologists may have different appreciation of the staining results: different interpretation. IHC for EGFR exon 19 deletion and exon 21 mutation only. Absence of reaction needs to be corroborrated by sequencing. Maybe could be used in worse case scenario where no more tissue can be obtained and a positive EGFR IHC result is the only “biomarker” that the oncologist could use for treatment, however, CAP guidelines do not include IHC as a biomarker for EGFR TKI use. This kind of use out of the recommendation would depend on the oncologist decision. IHC FOR ALK: Two different antibodies: clone 5A4 from Abcam and D5F3 from Cell Singalling D5F3 is companion diagnostic for Crizotinib use RT-PCR: highly specific for particular gene fusion and does not detect alternative partners unless they are included in the assay. So it cannot be used for discovery It needs high quality RNA and high levels of skill NEXT GENERATION SEQUENCING: special assays can capture intronic sequences but needs higher tumour content. RNA degrades rapidly and it is difficult to use.
  5. Pan-TRK (EPR17341) [NTRK]
  6. BRAF V 600E and G469A, and D594G. V600E account for 50% of BRAF mutations.