KHV is a double stranded DNA virus that causes Koi Herpes Virus Disease (KHVD) in common carp and koi carp. It can cause high mortality rates of up to 100% and symptoms include skin lesions, gill necrosis, and organ damage. The virus can remain latent and outbreaks typically occur in spring/autumn at 16-25°C. KHV is detected via cellular changes, PCR, and in-situ hybridization showing intranuclear inclusions. Controls include hygiene and an experimental vaccine, though no widely available vaccine currently exists.

2. Introduction
▪ KHV is a double stranded icosahedral DNA virus belonging to
family Alloherpesviridae
▪ It causes Koi Herpes Virus Disease in all common carp varieties
▪ The disease has a severe economic impact in many of the
countries.
▪ The virus causes interstitial nephritis and gill necrosis in
carps, so it is also termed as carp interstitial nephritis and gill
necrosis virus.
▪ KHVD can affect all stages from fry to adult and can kill even
market-size food fish, and high value koi carp and often
resulting in 80 - 100 percent mortality

3. ▪ This virus has the special feature called Latency i.e., the fish
may remain infected by the virus for life without showing any
of the clinical pathology
▪ KHV disease (KHVD) outbreaks typically occur in spring and
autumn when water temperatures are between 16° and 25
°C
▪ Incubation period of 7–21 days depending upon water
temperature
▪ Koi fish infected with KHV may die within 24-48 hours after
the onset of clinical signs.

4. Host range
▪ It causes KHVD disease in wide range of species, mostly to the
ornamental variety of common carp (Koi) and all its varieties
▪ Related ones : mirror carp, leather carp, ghost koi carp.
▪ Other species : Goldfish, crucian carp & grass carp
▪ Even hybrids of goldfish and carp or koi are also susceptible to
experimental infection of KHV, but are moderately resisitant
to mortality
▪ Tenchs are also susceptible to infection, but only act as
unaffected carriers

5. Taxonomic position
▪ The nomenclature is based on its similar structure which
resembles other cyprinid herpesviruses
[Cyprinid herpesvirus 1 : Carp pox virus, fish papilloma virus and
Cyprinid herpesvirus 2 : Goldfish haematopoietic necrosis virus]
Group: Group I (dsDNA)
Order: Herpesvirales
Family: Alloherpesviridae
Genus: Cyprinivirus
Species: Cyprinid herpesvirus 3

6. Disease outbreaks
▪ The first viral disease out break was noticed in cultured common
carp in Isreal and USA (1998) and in Germany (1997-98)
▪ Then the disease was termed as Koi herpes virus disease
(KHVD) and the disease causing agent was identified as Koi
herpes virus (KHV).
▪ KHV was reported to be present in England from 1996
▪ Since then, outbreaks of KHVD are being regularly reported
from Europe, South Africa, USA and Asia.

7. ▪ In Asia, KHV is reported from Israel, Indonesia, Taiwan, China,
Thailand, Japan and Malaysia.
▪ KHV is now known to occur in, or has been recorded from at
least 26 different countries of the world
▪ Information is also available on outbreaks of KHVD from
Canada, USA and many South-east Asian countries.
▪ However it is still not reported in India

9. Virion Structure
(Infectious form of a virus is known as Virion)
KHV is a double stranded DNA (dsDNA) virus, with a genome
size of 295 kbp
It resembles the poxviruses by the presence of thymidylate
monophosphate, ribonucleotide reductase and a B22R-like
genes
KHV virions are composed of an icosahedral capsid containing
➢The genome
➢A lipid envelope bearing viral glycoproteins
➢An amorphous layer of proteins (called tegument)

10. Icosahedron shape

11. Virus entry to host
▪ The disease can manifest itself into naïve fish within 3-8
days when left with infected fish
▪ It was thought that the gills are the primary portal of the
entry
▪ Later it was confirmed that skin and mucosal epithelium
(ingestion) are the primary portal for KHV
▪ Then the virus spreads to internal organs which is confirmed
by DNA detected in the kidney, spleen, liver and gut tissue

12. ▪ The ultra-structural examination reveals that the presence of
capsid and mature nucleocapsid in the nucleus and further
maturation of virion take place in cytoplasm of infected cells
▪ In early stages the hyper mucous secretion takes place, and
high amount of viral DNA can be detected in mucous samples
▪ This suggests the importance of skin in the transmission of
disease
▪ Excretion of virus in urine and faeces is also another
mechanism of transmission

13. Vectors
▪ Water is the major abiotic vector in transmission
▪ Animate vectors involve other fish species - Goldfish, Koi,
Grass carp, etc,. when kept in co-habitation
▪ Parasitic invertebrates, piscivorous birds and mammals

14. Signs of disease
▪ Mass mortalities, with
many dead and moribund
fish floating at the surface
▪ Disorientation and loss of
equilibrium
▪ Erratic swimming
behaviour
▪ Fish coming to the surface
and gasping
▪ Fish separated from the
shoal.
▪ Signs of hyperactivity

15. Detection of KHV
Presumtive
• Clinical Signs
• Gross observations
Definitive
• Cellular changes
• Histopathology
Confirmatory
• TEM
• PCR
• ISH

16. Clinical signs
▪ Pale patches or blisters on
the skin
▪ Sunken eyes (Enophthalmia)
▪ White patches on the gills ,
gill necrosis & bleeding gills
▪ Haemorrhages in the
operculum, fins, tail,
abdomen &fin erosion
▪ Overproduction or
underproduction of mucous
on the skin and gills

17. Gross Observations
▪ Gills - Necrotic patches to extensive discolouration, inflammation.
▪ Skin - Sand paper like appearance due to less production of
mucus
▪ Internal lesions - Variable
▪ Adhesions in the abdominal cavity
▪ Abnormal colouration of internal organs (lighter or darker)
▪ Kidney & Liver - May be enlarged, and may also exhibit petechial
haemorrhages.

18. Cellular changes
▪ Brain
▪ Congestion in the valvula cerebelli and medulla oblongata
▪ Dissociation of nerve fibers
▪ Meningeal and parameningeal inflammation
▪ Spleen
▪ Necrosis of parenchyma
▪ Intranuclear inclusions
▪ Margination of chromatin
▪ Liver & Pancreas
▪ Infiltration of lymhocytes
▪ Severe necrosis of acinar cells
▪ Gut & Oral epithelium
▪ Exessive mucous secretion
▪ Hyperplasia with foci of necrosis
▪ Skin
▪ Seperation of basement membrane

19. Kidney
➢ Nuclear inclusions in
haematopoietic cells,
glomeruli and in some of the
inflammatory interstitial cells.
➢ Necrosis of renal tubular
epithelium and individual
haematopoietic cells
➢ Nephron wall odematous and
with cell infiltrations
Histopathology of the kidney of
KHV infected carp-intranuclear
eosinophilic inclusion bodies
Histopathological changes

20. Gill
➢ Erosion of primary
lamellae, fusion of
secondary lamellae
(adhesion of gill filaments)
➢ Hyperplasia and
hypertrophy of branchial
epithelium
➢ Swelling at tips of the
primary and secondary
lamella.
➢ Branchial epithelial cells
and leucocytes have
prominent nuclear
swelling.
Hyperplasia and fusion of gill
lamellae

21. Epithelial cells of the gill filaments
exhibit hyperplasia, hypertrophy
and severe inflammation,
resulting in lamellar fusion.
Histopathology of the gill of KHV
infected carp-intranuclear
eosinophilic inclusion bodies

22. Transmission Electron microscopy (TEM)
▪ Examination of fixed and stained tissue in virus-infected cells
from gill, gut and kidney tissue can reveal nuclear inclusion
bodies
▪ For virus to be detected by TEM the glutaraldehyde-fixed
tissues need to be in good condition and heavily infected with
at least 106 virus particles.
▪ Tissues to be sampled at an optimal time in the virus infection
cycle and this is not always possible.

23. TEM micrograph of KHV infected tissue

24. In-situ Hybridisation
▪ Organ specimens were formalin-fixed and paraffin-embedded
according to standard protocols.
▪ DIG-labelled probes were used to visualise the virus
▪ Positive signal will be visible as violet-black foci in infected
cells

25. Dot-blot hybridization
▪ Mock - infected fish and 3 KHV-infected fish on days 17–19 post-infection.
▪ The DNA was immobilized on a membrane and hybridized with DIG-
labelled BamHI-6 (a) or SphI-5 DNA (b) probes. Hybridization was
detected by chemiluminescence
▪ The bottom row (KHV) is a positive control and corresponds to the
BamHI-6 and SphI-5 probes hybridized to immobilized DNA derived from
KHV-infected CCB cells.

26. PCR
▪ A highly sensitive PCR method for detection of TK gene
(Thymidine kinase gene) of KHV
▪ It is able to detect 10 fg (10-15) of KHV DNA
▪ The sensitivity of this method is ~10–1,000 times greater than
other PCR methods
PCR primers targets
▪ DNA polymerase gene have a sensitivity of 100 fg
▪ Major envelope protein gene of KHV have a sensitivity of 1,000
fg of KHV DNA in infected gills

27. ▪ KHV can be detected in infected fish dropping by PCR assay
with a detection limit of 40 fg of viral DNA
▪ MCP gene (Membrane co-factor protein) has been also used
to develop PCR for detection of KHV
▪ The real-time PCR is however considered as the “Gold
standard” for detection and absolute virus quantification.
▪ A new on-tube semi-nested PCR (sn PCR) recognizing the KHV
major glycoprotein gene can identify latent infection with a
virus load between 5 and 10 KHV copies

28. Nested PCR
Nested PCR also have the same sensitivity as the “gold
standard” which correspond to 10 fg DNA
KHV-PCR amplification of a 484 bp fragment (single round) or a
400 bp fragment (nested) in the 1400 bp Sacl - Kpnl restriction
fragment of the KHV genome
In first step - KHV9/5F primer and 30 KHV9/5R primer.
In second step - KHV-1Fn primer and 30 KHV-1Rn primer.

29. SacI-KpnI RE fragment (1400bp)
Nested PCR product
(400bp)
KHV-Rev
5’CACAAGTTCAGTCTGTTCCTCAAC3’
KHV-For
5’GACGACGCCGGAGACCTTGTG3
KHV-Rev-Int
5’CTCGCCGAGCAGAGGAAGCG3'
KHV-For-Int
5’CTCGCCGAGCAGAGGAAGCG3’
Primers
1st step KHV-For and KHV-Rev
2nd step KHV-For-Int and KHV-Rev-Int
1st round PCR product (484bp)

30. The limit of detection of KHV DNA by single round PCR is at the dilution corresponding to
102 TCID50/ml (first lane) and it is at least at 10-7 TCID50/ml by nested PCR (second lane).
(TCID50 - Median Tissue Culture Infectious Dose -the concentration at which 50% of the
cells are infected when cultured)
100bp - 103 102 10-4 10-5 10-6 10-7 - 100bp
100bp - 103 102 10-4 10-5 10-6 10-7 - 100bp
100bp - 103 102 10-4 10-5 10-6 10-7 - 100bp
100bp - 103 102 10-4 10-5 10-6 10-7 - 100bp
484bp
400bp

31. Rating of tests

32. Control and Treatment
▪ Avoiding exposure to the virus
▪ Good hygiene and biosecurity practices
Vaccination
▪ Safe and effective vaccine is not currently widely available
▪ However, live attenuated virus has been used to vaccinate
carp
▪ The vaccine used induced antibody against virus atleast after 8
months
▪ Widely used in Isreal
▪ Another liposome based vaccine containing inactivated KHV is
used in Japan

33. References
▪ Bergmann, S.M., Kempter, J., Sadowski, J. and Fichtner, D., 2006. First detection, confirmation
and isolation of koi herpesvirus (KHV) in cultured common carp (Cyprinus carpio L.) in Poland.
BULLETIN-EUROPEAN ASSOCIATION OF FISH PATHOLOGISTS, 26(2), p.97.
▪ Donohoe, O., 2013. An investigation into the existence of Cyprinid Herpesvirus 3 encoded
microRNAs (Doctoral dissertation, Dublin City University).
▪ Hartman, K.H., Yanong, R.P., Pouder, D.B., Petty, B.D., Francis-Floyd, R., Riggs, A.C. and Waltzek,
T.B., 2013. Koi Herpesvirus Disease (KHVD). University of florida, IFAS Extension Factsheet VM-
149.
▪ Le Deuff, R.M., Way, K., Ecclestone, L., Dixon, P.F., Betts, A.M., Stone, D.M., Gilad, O. and Hedrick,
R.P., 2001, September. Development and comparison of techniques for the diagnosis of koi
herpesvirus (KHV). In Abstract of 10th International Conference of the European Association of
Fish Pathologists (p. 257).
▪ OIE-Manual of Diagnostic Tests for Aquatic Animals (7th Edition, 2016) CHAPTER 2.3.7.
▪ Rakus, K., Ouyang, P., Boutier, M., Ronsmans, M., Reschner, A., Vancsok, C., Jazowiecka-Rakus, J.
and Vanderplasschen, A., 2013. Cyprinid herpesvirus 3: an interesting virus for applied and
fundamental research. Veterinary research, 44(1), p.85.
▪ Rathore, G., Kumar, G., Swaminathan, T.R. and Swain, P., 2012. Koi herpes virus: a review and risk
assessment of Indian aquaculture. Indian Journal of Virology, 23(2), pp.124-133.
▪ McColl, K.A., Cooke, B.D. and Sunarto, A., 2014. Viral biocontrol of invasive vertebrates: Lessons
from the past applied to cyprinid herpesvirus-3 and carp (Cyprinus carpio) control in Australia.
Biological Control, 72, pp.109-117.