Ochna integerrima is a medicinal and ornamental plant, is widely distributed in Southeast Asia areas. In Vietnam, it has been ranked as the rare and endangered species due to its high demand trade of the beautiful species. In this study, total 21 Ochna samples, collected from the northern and southern areas, were used to characterize the morphological traits using morphological analyses and molecular tool. The results have revealed that the morphological characterization of flower and its quality of Yen Tu Ochna samples showed differences in comparison with the common Ochna and southern Ochna samples. To accurately distinguish genetic traits of the samples, we have sequenced the internal transcribed spacer (ITS) region (including ITS1, 5.8S) of 21 species. The results have disclosed the genetic correlations of the samples ranging from 96.25% to 100% among the studied Ochna samples, of which 5 samples include B1, B2, B3, B6 and N3.1 were divided into the separate groups. The current work is the first report in constructing a molecular database of Ochna for further assessment of inter-and intra-specific molecular diversity of Ochna species in Vietnam
The document describes three experiments that tested the effects of plant growth hormones (IAA and BAP) and two potting media (coir dust/compost/sand and leaf mould/soil/sand) on the growth of the ornamental plant Ophiopogon sp.
In experiment 1, application of 100 mg/L IAA led to significantly increased fresh weight in the leaf mould potting medium and increased leaf length in the coir dust medium. Experiment 2 found that 75 mg/L BAP increased fresh weight in the leaf mould medium and all BAP treatments increased leaf length compared to the control. Experiment 3 showed that a combination of 100 mg/L IAA and 100 mg/L
MICROSCOPIC ILLUSTRATIONS OF PELARGONIUMVikrant Arya
This document describes a microscopic study of the plant Pelargonium x hortorum. Transverse sections of the leaf, petiole, stem, and root were examined under a microscope. Powder microscopy of the leaf was also performed. Quantitative parameters like stomatal number, stomatal index, vein islet number, vein termination number, and palisade ratio were determined. The microscopic features observed, such as trichome types, epidermal cell shape, stomata type, and tissue organization help standardize and identify P. x hortorum. The results provide a detailed microscopic profile of the plant parts that can authenticate P. x hortorum.
To evaluate the diversity and impact of insect pollinators on pod and seed yields of Phaseolus vulgaris (red bean with small seeds), its foraging and pollinating behavior were studied in Yaoundé, during the mild raining season (March-June) in 2016 and 2017. Treatments included unlimited floral access by all visitors and bagged flowers to avoid all insect pollinators. For each year of study, observations were made on 55 ± 38 flowers per treatment. The seasonal rhythm of insects activities, its foraging behavior, and its impact on pollination (fruiting rate, number of seeds/pod and percentage of normal seeds) were recorded. Fourteen insect species visited P. vulgaris flowers. Out of 667 visits, Xylocopa olivacea, Halictus sp., Chalicodoma sp. and Apis mellifera adansonii were the most frequent visitors with 21.43 %, 19.49 %, 12.44 % and 10.04 % visits respectively. These insects collected nectar and pollen intensely and regulatedly. The foraging activities of insect pollinators increased the fruiting rate by 23.56 %, the number of seeds/pod by 46.31 % and the normal seeds by 21.49 %. Therefore, conservation of nests and colonies of insect pollinators close to P. vulgaris crop fields should be recommended to improve pod and seed production in the region.
Anatomical and Palynological Studies on Napoleona imperialis P. Beauv. (Lecy...Scientific Review SR
This document summarizes an anatomical and palynological study of Napoleona imperialis. Key findings include:
1) Pollen morphology showed N. imperialis has tricolpate pollen that is oval in shape with a microspinulose type of exine ornamentation. Pollen fertility and viability was 84.66%.
2) Anatomical analysis of the leaf midrib found features typical of dicotyledons like collenchyma cells, vascular bundles, and bundle sheath sclerenchyma cells.
3) Stem anatomy displayed primary and secondary tissues like cork, cortex, phloem, cambium, xylem and pith. Periderm formation,
Ethnobotanical and traditional uses, phytochemical constituents and biologica...LucyPi1
Abstract Objective: Eryngium with the 274 accepted species, is the largest genus of Apiaceae family which are distributed all over the world and have been used in traditional remedies to manage various ailments in different nations. Ten species of Eryngium have been identified in Iran including E. caeruleum M.B. (syn: E. caucasicum Trautv.), E. creticum Lam., E. bungei Boiss., E. billardieri F. Delaroche. (syn: E. kotschyi Boiss.), E. glomeratum Lam. (syn: E. parviflorum Sm.), E. bornumulleri Nab., E. pyramidale Boiss. & Husson., E. noeanum Boiss., E. wanaturi Woron. (syn: E. woronowii Bordz.), and E. thyrsoideum Boiss. The aim of the present research is to review pharmacological activity, and phytochemical constituents as well as ethnobotany and traditional uses of Iranian species of Eryngium. Materials and methods: Electronic databases including PubMed, Scopus, Science Direct (ISI Web of Knowledge) and Embase library were comprehensively searched for research on Eryngium. The search period was from 1966 to October 2018. The related articles were selected according to the inclusion and exclusion criterias in our study. Results: A total of 57 papers were enrolled in analyses. The findings showed that Iranian species of Eryngium, had a noticeable diverse of traditional medicinal uses and also broad range of pharmacological activities as well as various phytochemical compounds. Some remarkable biological and pharmacological activities of these species have been demonstrated in present scientific studies, including antimicrobial, cytotoxic and anticancer, anti-inflammatory, analgesic and antinociceptive activities as well as antioxidant, antidiabetic, anti-snake and anti-scorpion venom effects. Conclusion: Iranian Eryngium species have enormous potential for prospective preparation of herbal medicinal products and are good candidates for discovering new drugs.
Medicinal properties of tinospora cordifolia (guduchi)IJARIIT
Tinospora cordifolia is one of the most important medicinal plant commonly known as Giloy belonging to the
menispermaceae family is a deciduous climbing shrub described known for its immense application in the treatment of various
diseases such as jaundice, fever, diabetes, and skin diseases etc. The chemical constituents of this shrub belong to different
classes such as alkaloid, lactones, steroids, phenolics, aliphatic compound, glycosides and polyscharide compounds having
medical importance.
IOSRPHR(www.iosrphr.org) IOSR Journal of Pharmacyiosrphr_editor
This document summarizes a study on the roots of the plant Ziziphus oenoplia Mill. Microscopic analysis of transverse root sections showed a circular outline with cork, epidermal, cortex, and xylem tissues. Medullary rays were biseriate and reddish-orange. Powder microscopy revealed cork cells, wood elements, and starch grains. Physical analysis determined ash values, extractive values, and moisture content to standardize the crude drug. The aim was to evaluate Z. oenoplia pharmacognostically to provide scientific validation for its traditional medicinal uses.
Antimicrobial and Phytochemical Screening of Phyllantus NiruriYogeshIJTSRD
Theorigin of Phyllanthus niruri is tropical America from there it spread as a weed to other tropic and sub tropics. It is a tropical annual herb shrub which grows as weed in moist humid waste land. Phyllanthus niruri is among more than 500 Phyllanthus species that are widely spread in temperate and tropical climates region Lizuka et al., 2007. It grows 30 40 cm in height, has small leaves and yellow flowers the stem has green capsule, and blooms with flowers with 5 white sepals and apical acute anther.38g of Mueller Hinton Agar was dissolved in 1000ml distilled water in a conical flask, the mouth of the conical flask was plugged with cotton woo wrapped in aluminium foil. This was sterilized in an autoclave at 121oC for 15mns. The media was removed and allowed to cool to 45oC, later poured into a sterilized plastic petri plates which were appropriately labeled. The present study revealed the antimicrobial activity and phytochemical screening of phyllanthus niruri. The antimicrobial activity of phyllanthus niruri shows great significant against pathogens which are responsible for common infections of skin, respiratory, urinary and gastrointestinal tracts. The phytochemical screening of oxalate, terpenoids, tannins, phenols, quinones, flavonoids, alkaloids, saponins and steroids were all found to be active within the plant. This bioactive phytochemicals present in P. niruri can be useful for further researches on the plant P. nururi since the phytochemicals have shown preclinical efficacies for treating human diseases’ which include hepatitis and HIV AIDS. This work has compiled the chemical constituents present and can be useful for further researches Dr. Mohammed Musa Lawan | Yusuf Sale Baba "Antimicrobial and Phytochemical Screening of Phyllantus Niruri" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-5 , August 2021, URL: https://www.ijtsrd.com/papers/ijtsrd44948.pdf Paper URL: https://www.ijtsrd.com/chemistry/other/44948/antimicrobial-and-phytochemical-screening-of-phyllantus-niruri/dr-mohammed-musa-lawan
The document describes three experiments that tested the effects of plant growth hormones (IAA and BAP) and two potting media (coir dust/compost/sand and leaf mould/soil/sand) on the growth of the ornamental plant Ophiopogon sp.
In experiment 1, application of 100 mg/L IAA led to significantly increased fresh weight in the leaf mould potting medium and increased leaf length in the coir dust medium. Experiment 2 found that 75 mg/L BAP increased fresh weight in the leaf mould medium and all BAP treatments increased leaf length compared to the control. Experiment 3 showed that a combination of 100 mg/L IAA and 100 mg/L
MICROSCOPIC ILLUSTRATIONS OF PELARGONIUMVikrant Arya
This document describes a microscopic study of the plant Pelargonium x hortorum. Transverse sections of the leaf, petiole, stem, and root were examined under a microscope. Powder microscopy of the leaf was also performed. Quantitative parameters like stomatal number, stomatal index, vein islet number, vein termination number, and palisade ratio were determined. The microscopic features observed, such as trichome types, epidermal cell shape, stomata type, and tissue organization help standardize and identify P. x hortorum. The results provide a detailed microscopic profile of the plant parts that can authenticate P. x hortorum.
To evaluate the diversity and impact of insect pollinators on pod and seed yields of Phaseolus vulgaris (red bean with small seeds), its foraging and pollinating behavior were studied in Yaoundé, during the mild raining season (March-June) in 2016 and 2017. Treatments included unlimited floral access by all visitors and bagged flowers to avoid all insect pollinators. For each year of study, observations were made on 55 ± 38 flowers per treatment. The seasonal rhythm of insects activities, its foraging behavior, and its impact on pollination (fruiting rate, number of seeds/pod and percentage of normal seeds) were recorded. Fourteen insect species visited P. vulgaris flowers. Out of 667 visits, Xylocopa olivacea, Halictus sp., Chalicodoma sp. and Apis mellifera adansonii were the most frequent visitors with 21.43 %, 19.49 %, 12.44 % and 10.04 % visits respectively. These insects collected nectar and pollen intensely and regulatedly. The foraging activities of insect pollinators increased the fruiting rate by 23.56 %, the number of seeds/pod by 46.31 % and the normal seeds by 21.49 %. Therefore, conservation of nests and colonies of insect pollinators close to P. vulgaris crop fields should be recommended to improve pod and seed production in the region.
Anatomical and Palynological Studies on Napoleona imperialis P. Beauv. (Lecy...Scientific Review SR
This document summarizes an anatomical and palynological study of Napoleona imperialis. Key findings include:
1) Pollen morphology showed N. imperialis has tricolpate pollen that is oval in shape with a microspinulose type of exine ornamentation. Pollen fertility and viability was 84.66%.
2) Anatomical analysis of the leaf midrib found features typical of dicotyledons like collenchyma cells, vascular bundles, and bundle sheath sclerenchyma cells.
3) Stem anatomy displayed primary and secondary tissues like cork, cortex, phloem, cambium, xylem and pith. Periderm formation,
Ethnobotanical and traditional uses, phytochemical constituents and biologica...LucyPi1
Abstract Objective: Eryngium with the 274 accepted species, is the largest genus of Apiaceae family which are distributed all over the world and have been used in traditional remedies to manage various ailments in different nations. Ten species of Eryngium have been identified in Iran including E. caeruleum M.B. (syn: E. caucasicum Trautv.), E. creticum Lam., E. bungei Boiss., E. billardieri F. Delaroche. (syn: E. kotschyi Boiss.), E. glomeratum Lam. (syn: E. parviflorum Sm.), E. bornumulleri Nab., E. pyramidale Boiss. & Husson., E. noeanum Boiss., E. wanaturi Woron. (syn: E. woronowii Bordz.), and E. thyrsoideum Boiss. The aim of the present research is to review pharmacological activity, and phytochemical constituents as well as ethnobotany and traditional uses of Iranian species of Eryngium. Materials and methods: Electronic databases including PubMed, Scopus, Science Direct (ISI Web of Knowledge) and Embase library were comprehensively searched for research on Eryngium. The search period was from 1966 to October 2018. The related articles were selected according to the inclusion and exclusion criterias in our study. Results: A total of 57 papers were enrolled in analyses. The findings showed that Iranian species of Eryngium, had a noticeable diverse of traditional medicinal uses and also broad range of pharmacological activities as well as various phytochemical compounds. Some remarkable biological and pharmacological activities of these species have been demonstrated in present scientific studies, including antimicrobial, cytotoxic and anticancer, anti-inflammatory, analgesic and antinociceptive activities as well as antioxidant, antidiabetic, anti-snake and anti-scorpion venom effects. Conclusion: Iranian Eryngium species have enormous potential for prospective preparation of herbal medicinal products and are good candidates for discovering new drugs.
Medicinal properties of tinospora cordifolia (guduchi)IJARIIT
Tinospora cordifolia is one of the most important medicinal plant commonly known as Giloy belonging to the
menispermaceae family is a deciduous climbing shrub described known for its immense application in the treatment of various
diseases such as jaundice, fever, diabetes, and skin diseases etc. The chemical constituents of this shrub belong to different
classes such as alkaloid, lactones, steroids, phenolics, aliphatic compound, glycosides and polyscharide compounds having
medical importance.
IOSRPHR(www.iosrphr.org) IOSR Journal of Pharmacyiosrphr_editor
This document summarizes a study on the roots of the plant Ziziphus oenoplia Mill. Microscopic analysis of transverse root sections showed a circular outline with cork, epidermal, cortex, and xylem tissues. Medullary rays were biseriate and reddish-orange. Powder microscopy revealed cork cells, wood elements, and starch grains. Physical analysis determined ash values, extractive values, and moisture content to standardize the crude drug. The aim was to evaluate Z. oenoplia pharmacognostically to provide scientific validation for its traditional medicinal uses.
Antimicrobial and Phytochemical Screening of Phyllantus NiruriYogeshIJTSRD
Theorigin of Phyllanthus niruri is tropical America from there it spread as a weed to other tropic and sub tropics. It is a tropical annual herb shrub which grows as weed in moist humid waste land. Phyllanthus niruri is among more than 500 Phyllanthus species that are widely spread in temperate and tropical climates region Lizuka et al., 2007. It grows 30 40 cm in height, has small leaves and yellow flowers the stem has green capsule, and blooms with flowers with 5 white sepals and apical acute anther.38g of Mueller Hinton Agar was dissolved in 1000ml distilled water in a conical flask, the mouth of the conical flask was plugged with cotton woo wrapped in aluminium foil. This was sterilized in an autoclave at 121oC for 15mns. The media was removed and allowed to cool to 45oC, later poured into a sterilized plastic petri plates which were appropriately labeled. The present study revealed the antimicrobial activity and phytochemical screening of phyllanthus niruri. The antimicrobial activity of phyllanthus niruri shows great significant against pathogens which are responsible for common infections of skin, respiratory, urinary and gastrointestinal tracts. The phytochemical screening of oxalate, terpenoids, tannins, phenols, quinones, flavonoids, alkaloids, saponins and steroids were all found to be active within the plant. This bioactive phytochemicals present in P. niruri can be useful for further researches on the plant P. nururi since the phytochemicals have shown preclinical efficacies for treating human diseases’ which include hepatitis and HIV AIDS. This work has compiled the chemical constituents present and can be useful for further researches Dr. Mohammed Musa Lawan | Yusuf Sale Baba "Antimicrobial and Phytochemical Screening of Phyllantus Niruri" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-5 , August 2021, URL: https://www.ijtsrd.com/papers/ijtsrd44948.pdf Paper URL: https://www.ijtsrd.com/chemistry/other/44948/antimicrobial-and-phytochemical-screening-of-phyllantus-niruri/dr-mohammed-musa-lawan
The document summarizes a study that aimed to clarify the taxonomy of fungal pathogens causing apple ring rot in China. Researchers applied genealogical concordance phylogenetic species recognition to 24 fungal isolates from apple and pear with disease symptoms, along with reference isolates. Phylogenetic analysis of sequences from four nuclear loci revealed two distinct species - one including an isolate previously identified as Botryosphaeria berengeriana f. sp. piricola, and the other including an ex-epitype isolate of B. dothidea. While the two fungi induced different disease symptoms on apple and pear, the cryptic species showed sufficient genetic and biological differences from B. dothidea to be described as a new combination, Botryos
Standardization and Formulations of Calotropis ProceraYogeshIJTSRD
Plants growing in arid regions have elicited increased attention, because the hostile environment, in which these plants survive, forces them to develop chemical protective systems through adaptation which is rarely found in vegetation of other ecosystems. Furthermore, many of the plants grow in areas, where the dependence on traditional, plant based medicines over industrially produced pharmaceuticals persists to this day. The two plants, Calotopris Procera giant milkweed, also named C. Persica and Calotropis gigantea crown ower , have been used widely in traditional medicine in North Africa, the Middle East, and South and South East Asia. This has led to extensive research on the chemical constituents of the plants. Both plants are known to be sources of cardenolides, and newer research has yielded a number of interesting cancer active constituents. In addition, extracts of both plants have remarkable nematocidal, molluscidal and insecticidal activities. In many regions, the wood of Calotropis plants has been used as a building material and as a source of fuel. In addition, certain parts of the plants have been used as feed for livestock. In other regions, Calotropis plants are seen as invasive species that threaten local plant life and that due to their toxicity also pose a threat to grazing eld animals. Jaffar Khan | Pankaj Chasta | Dr. Gaurav Kumar Sharma | Dr. Kaushal Kishore Chandrul "Standardization and Formulations of Calotropis Procera" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-5 , August 2021, URL: https://www.ijtsrd.com/papers/ijtsrd45145.pdf Paper URL: https://www.ijtsrd.com/pharmacy/other/45145/standardization-and-formulations-of-calotropis-procera/jaffar-khan
The Botanical Survey of India was established in 1890 to survey, document, and conserve India's plant diversity. It has 15 regional centers and units across India and is headquartered in Kolkata. Its objectives include exploring and documenting plant diversity in ecosystems and protected areas, publishing floras, identifying threatened species, and conducting ex-situ conservation. It maintains herbarium collections of over 3 million specimens, some of which are type specimens, and living collections of over 175,000 plant accessions. Recent achievements include discovering new genera, species, and records for India as well as digitizing collections.
Isolation and Identification of Bacteria from Peeled and Ready to Eat Pineapp...YogeshIJTSRD
Pineapple Ananas comosus is an indispensible fruit that is cherished by many people due to its huge health benefits. It is peeled and sold in many markets and road sides for easy accessibility. The presence of bacteria in the peeled and ready to eat fruits was checked in this study. Peeled, sliced and cellophane packaged pineapple fruits were purchased from Eke Awka Market in Anambra State Nigeria. Nutrient agar was used to carry out bacterial isolation using pour plate technique. Results showed that colony count of the pineapple fruits ranged from 3.5 9.5 2cfu ml of the rinsed water. The isolates were identified on the basis of their colony and morphological features as well as biochemical and sugar fermentation tests. Gene sequencing was used to confirm the species of some of the isolates. A total of six bacteria species were isolated and identified with frequencies as Streptococcus spp 13.9 , Pseudomonas aeruginosa 22.2 , Staphylococcus aureus 25.0 , Micrococcus luteus 11.1 , Escherichia coli 19.5 and Staphylococcus epidermidis 8.3 . Staphylococcus aureus has the highest frequency followed by Pseudomonas aeruginosa. Staphylococcus epidermidis has the least frequency. Almost all the isolates are pathogenic in nature and their presence in the consumable fruits indicates possible health problems to the consumers. The presence of E. coli indicates direct or indirect fecal contamination. Proper handling of pineapple fruits, hygiene and proper storage will help reduce the risk of contamination by these organisms. Umeh S. O. | Okafor O. I. | Chidubem-Nwachinemere, N. O "Isolation and Identification of Bacteria from Peeled and Ready to Eat Pineapple (Ananas Comosus) Fruits Retailed at Eke Awka Market, Anambra State, Nigeria" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-5 , August 2021, URL: https://www.ijtsrd.com/papers/ijtsrd45050.pdf Paper URL: https://www.ijtsrd.com/biological-science/microbiology/45050/isolation-and-identification-of-bacteria-from-peeled-and-ready-to-eat-pineapple-ananas-comosus-fruits-retailed-at-eke-awka-market-anambra-state-nigeria/umeh-s-o
The Ornamental Plant Germplasm Center (OPGC) located at The Ohio State University preserves the genetic diversity of ornamental plants. It was established in 2001 through funding from the USDA. The OPGC maintains a collection of over 5,000 plant accessions in greenhouses and fields. It provides germplasm and research support to advance the floriculture industry. The center also offers undergraduate research and employment opportunities.
Assessment of iba (indole butyric acid) levels and planting time for rootingAlexander Decker
This study assessed different levels of the plant hormone indole butyric acid (IBA) and planting times on rooting and growth of Alstonia cuttings. Cuttings were treated with 0%, 5%, 10%, 15%, or 20% IBA and planted on March 15th, March 30th, or April 14th. IBA at 10% resulted in the best leaf area, sprout length, stem diameter, number of roots, and root diameter, while 5% IBA resulted in the best number of leaves, root length, and survival rate. April 14th planting time generally resulted in better growth parameters than the earlier dates. The study concluded that treating Alstonia cuttings with 10% IBA
The herbarium & Botanical gardens are the temples of botanists. This PPT intends to explore these institutes and their role in nature studies for UG courses.
The reproductive biology of motherwort (Leonurus cardiaca L.)Innspub Net
Leonurus cardiaca (Lamiaceae) is an important medicinal plant, growing wildly in many parts of Iran. It has been used to cure cardiovascular diseases, stress, anxiety, and nervous irritability. There has been no report on the breeding system of this species. This experiment was accordingly conducted to investigate the flower biology, pollination system, pollinators, and breeding system. The results show protandry is the dominant form, and the stigma reaches its most receptivity 48 hours after anthesis, while the highest in-vitro pollen germination is observed within two hours after anthesis. The examination of different types of pollination in this plant indicates that the highest seed set percentage, seed weight, and seed viability can be obtained by open pollination, but the existence of pollinators improves the reproduction significantly. Based on our results, L. cardiaca, with 27.48 ± 1.45% autogamy, is a self-compatible plant, whose reproduction is improved by cross-pollination. Honey bees (Apis melleifera) were the most important and common pollinators.
This document describes a study on genetic improvement of Stevia rebaudiana genotypes through selection. Nineteen Stevia accessions were collected and evaluated over two seasons for morphological and chemical traits. High genetic diversity was found between genotypes for traits like plant height, branch number, leaf weight, and content of stevioside and rebaudioside A. Random amplified polymorphic DNA (RAPD) analysis also showed genetic polymorphisms between accessions. The results indicate potential for these genotypes in future breeding programs to develop superior Stevia varieties.
Journal of Pharmacognosy and PhytochemistryCesar Enoch
Maize plant is affected by as many as 61 diseases,
out of which 16 have been identified a major ones
which occur both in tropical and temperate
regions of India (Sharma and Payak, 1986).
Among these, banded leaf and sheath blight
(BLSB) incited by Rhizoctonia solani is gaining
economic importance. Grain yield loss,
depending on severity varies between 11 to 40
per cent (Singh and Sharma, 1976). Lal et al.
(1985) reported that the losses in grain yield may
vary to the extent of over 90.0 per cent. Now
BLSB is considered to be one of the most serious
problem threatening cultivation of maize in India.
It appears on plants before flowering, which is
highly favoured by warm humid weather, and it
causes severe damages to leaves, leaf sheaths as
well as cobs (Fig. 1). For an economic and
effective control of this disease, development of
resistant genotypes is of primary importance.
Hence, the present investigation was carried out
to study the inheritance of resistance of this
disease.
The document discusses herbariums, which are collections of dried plant specimens that are carefully pressed and mounted on archival paper with labels providing scientific names, collector information, and location details. Herbariums serve as permanent records of plant materials and distributions even as environments change. They aid in taxonomic research, identification, estimating biodiversity, and more. Important herbariums mentioned include the National Botanical Garden in Lucknow, India and the Royal Botanical Garden in Kolkata, India.
This document discusses herbariums, which are collections of preserved plant specimens. It outlines the aims of herbariums as preserving plants, contributing to scientific studies, and informing the public. There are three main types: national, regional, and local. The techniques for creating herbarium specimens involve collecting, pressing, drying, poisoning, mounting, labeling, and storing plants. Major steps are collection, pressing, drying, mounting, labeling, and storage in cabinets following a classification system. Herbariums play an important role in research, education, and conservation by preserving specimens and geographical distributions. Several important herbariums in India are highlighted.
Micropropagation is applied to multiply those species which are difficult to produce conventionally. The purpose of this study was to access in vitro propagation of Hoya kerrii, an important ornamental plant to explore its potential for micro-propagation. Microprogation of Hoya kerrii was initiated using leaf, petiole, root and inter-nodal segments of the selected plant as explants on MS medium containing 2,4-D at 1, 2, 3, 4 and 5 mg/L for callus induction. Leaf segments initiated callus earlier than inter-node, petiole and root. A significant amount of callus was produced in MS medium with 5.0 mg/L 2, 4-D and MS medium with 1.0 mg/L 2, 4-D gave the poorest callus.
Botanical gardens are gardens dedicated to collecting, cultivating, and displaying a wide variety of labeled plants. They contain different plant collections like tropical plants, herbs, cacti, and greenhouses. Botanical gardens are often run by universities or research organizations and serve purposes like education, scientific research, conservation, and addressing climate change by sequestering carbon and increasing cloud cover. Some examples of botanical gardens in India include the Empress Garden in Pune, Lalbagh Garden in Bangalore, and the largest in Asia, the Jawaharlal Nehru Tropical Botanical Garden in Kerala.
This document summarizes a study of the external and pollen morphological structures of four Terminalia species found in West Bengal, India. Key findings include:
1) The four species (T. arjuna, T. bellirica, T. chebula, T. catappa) showed distinct differences in bark structure, lamina (leaf) shape, and fruit type that allow for identification.
2) Pollen morphology was generally uniform across species but differences were seen in exine sculpturing, ranging from microrugulate in T. catappa to perforate-microrugulate in T. bellirica and T. chebula.
3) Two identification keys were provided based on
This document provides an overview of herbarium collection management, including the basics of taxonomy, identification, and documentation of plant collections. It discusses collecting plants through fieldwork and plant pressing, as well as documenting locality details, collection numbers, and morphological notes. It describes the roles of a herbarium in preserving plant biodiversity records and serving as a research center. It outlines typical herbarium operations like curation, accessioning specimens, storage and classification, usage rules, and insect control. It also discusses setting up a data information system through digitizing specimens, attaching barcode indexes, and photographing specimens to create an online digital repository of herbarium collections.
A herbarium is a collection of dried plant specimens mounted on archival paper where the plants are pressed, mounted, labeled with their scientific names, collector, and locality. It involves techniques like collection, pressing, drying, poisoning, mounting, stitching, labeling, filing, and depositing plants. A botanical garden is an educational institution for scientific workers and the public that displays a wide range of labeled plants for cultivation and collection.
Performance of Native Pennsylvania Wildflowers and Dianthus armeria (Caryophy...gtickerhoof
This study examined the growth of native Pennsylvania wildflowers on potential green roofs. 3 field sites near Curwensville, PA were monitored from June to August 2011. 5 plants (Erigeron annuus, Solidago juncea, Fragaria virginiana, Achillea millefolium, and Dianthus armeria) are good green roof candidates based on flexible roots <10cm, ability to grow in sun and rocky soil, and not outcompeting other plants. 4 additional plants (Asclepias tuberosa, Fragaria vesca, Aquilegia canadensis, and Linaria canadensis) showed potential but lacked full data due to low numbers. Measurements
Multivariate Analysis of Tea (Camellia sinensis (L.) O. Kuntze) Clones on Mor...Premier Publishers
Information on genetic variability for biochemical characters is a prerequisite for improvement of tea quality. Thirteen introduced tea clones characterized with objective; assessing tea clones based on morphological characters at Melko and Gera research stations. The study was conducted during 2017/18 cropping season on experimental plots in RCBD with three replications. Data recorded on morphological traits like days from pruning to harvest, height to first branch, stem diameter, leaf serration density, leaf length, leaf width, leaf size, petiole length, leaf ratio, internode length, shoot length, number of shoot, canopy diameter, hundred shoot weight, fresh leaf yield per tree. Cluster analysis of morphological trait grouped into four clusters indicated, the existence of divergence among the tested clones. The maximum inter-cluster distance was between clusters I and IV (35.27) while the minimum inter cluster distance was observed between clusters I and II (7.8).Principal components analysis showed that the first five principal components with eigenvalues greater than one accounted 86.45% for 15 morphological traits. Generally, the study indicated presence of variability for several morphological traits. However, high morphological variation between clones is not a guarantee for a high genetic variation; therefore, molecular studies need to be considered as complementary to biochemical studies.
Genetic characterization of morphological and yield traits in ten genotypes of Celosia argentea L. was evaluated
at the Research Farm of the Department of Botany, University of Ibadan, Nigeria. The experiment was laid out
in a randomized complete block design with four replicates. The results of analysis of variance carried out on
early morphological characters of C. argentea L. at 3, 4, and 5weeks after sowing showed significant
(p<0.05 /><0.01) effects except for number of leaves per plant and leaf width at 3 and 5 weeks after sowing,
respectively. The replicates in blocks produced varying observable effects on the genotypes while genotype x
replicate showed significant variation on morpho-agronomic and yield traits except number of days to flowering
at 50 days and fruit length at maturity. Also, from the result of the mean separation, it is shown that
NG/MAY/09/015 performed the best for plant height at flowering, leaf length at flowering, leaf width at
flowering, and root biomass. NG/SA/07/213 produced the highest mean values of number of flowers per plant,
leaf biomass and pod weight at maturity. The highest values of number of primary branches and fruit length at
maturity (FLM) were observed for NG/TO/MAY/09/015, while NG/AO/MAY/09/015 had the highest for pod
weight at maturity. The result of principal component axis also showed that Prin 1 accounted for highest Eigen
Vector of 38.62% from the total variation. NG/MAY/09/015 (R2) genotype produced the highest Eigen Vector
of 6.705 from Prin 1. The correlation result showed that plant height had a significant positive association with
seed weight at maturity, pod weight at maturity, number of primary branches and fruit length at maturity, while
similar association existed between leaf biomass, number of primary branches and pod weight at maturity, as
well as between plant height at flowering and pod weight at maturity. Again, the number of primary branches is
also positive and significantly correlated with plant height, root biomass and leaf length. Furthermore, the
results of dendrogram and minimum spanning tree revealed variations in genetic relatedness and distance,
respectively, which exist among the population of the C. argentea L.
The document summarizes a study that aimed to clarify the taxonomy of fungal pathogens causing apple ring rot in China. Researchers applied genealogical concordance phylogenetic species recognition to 24 fungal isolates from apple and pear with disease symptoms, along with reference isolates. Phylogenetic analysis of sequences from four nuclear loci revealed two distinct species - one including an isolate previously identified as Botryosphaeria berengeriana f. sp. piricola, and the other including an ex-epitype isolate of B. dothidea. While the two fungi induced different disease symptoms on apple and pear, the cryptic species showed sufficient genetic and biological differences from B. dothidea to be described as a new combination, Botryos
Standardization and Formulations of Calotropis ProceraYogeshIJTSRD
Plants growing in arid regions have elicited increased attention, because the hostile environment, in which these plants survive, forces them to develop chemical protective systems through adaptation which is rarely found in vegetation of other ecosystems. Furthermore, many of the plants grow in areas, where the dependence on traditional, plant based medicines over industrially produced pharmaceuticals persists to this day. The two plants, Calotopris Procera giant milkweed, also named C. Persica and Calotropis gigantea crown ower , have been used widely in traditional medicine in North Africa, the Middle East, and South and South East Asia. This has led to extensive research on the chemical constituents of the plants. Both plants are known to be sources of cardenolides, and newer research has yielded a number of interesting cancer active constituents. In addition, extracts of both plants have remarkable nematocidal, molluscidal and insecticidal activities. In many regions, the wood of Calotropis plants has been used as a building material and as a source of fuel. In addition, certain parts of the plants have been used as feed for livestock. In other regions, Calotropis plants are seen as invasive species that threaten local plant life and that due to their toxicity also pose a threat to grazing eld animals. Jaffar Khan | Pankaj Chasta | Dr. Gaurav Kumar Sharma | Dr. Kaushal Kishore Chandrul "Standardization and Formulations of Calotropis Procera" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-5 , August 2021, URL: https://www.ijtsrd.com/papers/ijtsrd45145.pdf Paper URL: https://www.ijtsrd.com/pharmacy/other/45145/standardization-and-formulations-of-calotropis-procera/jaffar-khan
The Botanical Survey of India was established in 1890 to survey, document, and conserve India's plant diversity. It has 15 regional centers and units across India and is headquartered in Kolkata. Its objectives include exploring and documenting plant diversity in ecosystems and protected areas, publishing floras, identifying threatened species, and conducting ex-situ conservation. It maintains herbarium collections of over 3 million specimens, some of which are type specimens, and living collections of over 175,000 plant accessions. Recent achievements include discovering new genera, species, and records for India as well as digitizing collections.
Isolation and Identification of Bacteria from Peeled and Ready to Eat Pineapp...YogeshIJTSRD
Pineapple Ananas comosus is an indispensible fruit that is cherished by many people due to its huge health benefits. It is peeled and sold in many markets and road sides for easy accessibility. The presence of bacteria in the peeled and ready to eat fruits was checked in this study. Peeled, sliced and cellophane packaged pineapple fruits were purchased from Eke Awka Market in Anambra State Nigeria. Nutrient agar was used to carry out bacterial isolation using pour plate technique. Results showed that colony count of the pineapple fruits ranged from 3.5 9.5 2cfu ml of the rinsed water. The isolates were identified on the basis of their colony and morphological features as well as biochemical and sugar fermentation tests. Gene sequencing was used to confirm the species of some of the isolates. A total of six bacteria species were isolated and identified with frequencies as Streptococcus spp 13.9 , Pseudomonas aeruginosa 22.2 , Staphylococcus aureus 25.0 , Micrococcus luteus 11.1 , Escherichia coli 19.5 and Staphylococcus epidermidis 8.3 . Staphylococcus aureus has the highest frequency followed by Pseudomonas aeruginosa. Staphylococcus epidermidis has the least frequency. Almost all the isolates are pathogenic in nature and their presence in the consumable fruits indicates possible health problems to the consumers. The presence of E. coli indicates direct or indirect fecal contamination. Proper handling of pineapple fruits, hygiene and proper storage will help reduce the risk of contamination by these organisms. Umeh S. O. | Okafor O. I. | Chidubem-Nwachinemere, N. O "Isolation and Identification of Bacteria from Peeled and Ready to Eat Pineapple (Ananas Comosus) Fruits Retailed at Eke Awka Market, Anambra State, Nigeria" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-5 | Issue-5 , August 2021, URL: https://www.ijtsrd.com/papers/ijtsrd45050.pdf Paper URL: https://www.ijtsrd.com/biological-science/microbiology/45050/isolation-and-identification-of-bacteria-from-peeled-and-ready-to-eat-pineapple-ananas-comosus-fruits-retailed-at-eke-awka-market-anambra-state-nigeria/umeh-s-o
The Ornamental Plant Germplasm Center (OPGC) located at The Ohio State University preserves the genetic diversity of ornamental plants. It was established in 2001 through funding from the USDA. The OPGC maintains a collection of over 5,000 plant accessions in greenhouses and fields. It provides germplasm and research support to advance the floriculture industry. The center also offers undergraduate research and employment opportunities.
Assessment of iba (indole butyric acid) levels and planting time for rootingAlexander Decker
This study assessed different levels of the plant hormone indole butyric acid (IBA) and planting times on rooting and growth of Alstonia cuttings. Cuttings were treated with 0%, 5%, 10%, 15%, or 20% IBA and planted on March 15th, March 30th, or April 14th. IBA at 10% resulted in the best leaf area, sprout length, stem diameter, number of roots, and root diameter, while 5% IBA resulted in the best number of leaves, root length, and survival rate. April 14th planting time generally resulted in better growth parameters than the earlier dates. The study concluded that treating Alstonia cuttings with 10% IBA
The herbarium & Botanical gardens are the temples of botanists. This PPT intends to explore these institutes and their role in nature studies for UG courses.
The reproductive biology of motherwort (Leonurus cardiaca L.)Innspub Net
Leonurus cardiaca (Lamiaceae) is an important medicinal plant, growing wildly in many parts of Iran. It has been used to cure cardiovascular diseases, stress, anxiety, and nervous irritability. There has been no report on the breeding system of this species. This experiment was accordingly conducted to investigate the flower biology, pollination system, pollinators, and breeding system. The results show protandry is the dominant form, and the stigma reaches its most receptivity 48 hours after anthesis, while the highest in-vitro pollen germination is observed within two hours after anthesis. The examination of different types of pollination in this plant indicates that the highest seed set percentage, seed weight, and seed viability can be obtained by open pollination, but the existence of pollinators improves the reproduction significantly. Based on our results, L. cardiaca, with 27.48 ± 1.45% autogamy, is a self-compatible plant, whose reproduction is improved by cross-pollination. Honey bees (Apis melleifera) were the most important and common pollinators.
This document describes a study on genetic improvement of Stevia rebaudiana genotypes through selection. Nineteen Stevia accessions were collected and evaluated over two seasons for morphological and chemical traits. High genetic diversity was found between genotypes for traits like plant height, branch number, leaf weight, and content of stevioside and rebaudioside A. Random amplified polymorphic DNA (RAPD) analysis also showed genetic polymorphisms between accessions. The results indicate potential for these genotypes in future breeding programs to develop superior Stevia varieties.
Journal of Pharmacognosy and PhytochemistryCesar Enoch
Maize plant is affected by as many as 61 diseases,
out of which 16 have been identified a major ones
which occur both in tropical and temperate
regions of India (Sharma and Payak, 1986).
Among these, banded leaf and sheath blight
(BLSB) incited by Rhizoctonia solani is gaining
economic importance. Grain yield loss,
depending on severity varies between 11 to 40
per cent (Singh and Sharma, 1976). Lal et al.
(1985) reported that the losses in grain yield may
vary to the extent of over 90.0 per cent. Now
BLSB is considered to be one of the most serious
problem threatening cultivation of maize in India.
It appears on plants before flowering, which is
highly favoured by warm humid weather, and it
causes severe damages to leaves, leaf sheaths as
well as cobs (Fig. 1). For an economic and
effective control of this disease, development of
resistant genotypes is of primary importance.
Hence, the present investigation was carried out
to study the inheritance of resistance of this
disease.
The document discusses herbariums, which are collections of dried plant specimens that are carefully pressed and mounted on archival paper with labels providing scientific names, collector information, and location details. Herbariums serve as permanent records of plant materials and distributions even as environments change. They aid in taxonomic research, identification, estimating biodiversity, and more. Important herbariums mentioned include the National Botanical Garden in Lucknow, India and the Royal Botanical Garden in Kolkata, India.
This document discusses herbariums, which are collections of preserved plant specimens. It outlines the aims of herbariums as preserving plants, contributing to scientific studies, and informing the public. There are three main types: national, regional, and local. The techniques for creating herbarium specimens involve collecting, pressing, drying, poisoning, mounting, labeling, and storing plants. Major steps are collection, pressing, drying, mounting, labeling, and storage in cabinets following a classification system. Herbariums play an important role in research, education, and conservation by preserving specimens and geographical distributions. Several important herbariums in India are highlighted.
Micropropagation is applied to multiply those species which are difficult to produce conventionally. The purpose of this study was to access in vitro propagation of Hoya kerrii, an important ornamental plant to explore its potential for micro-propagation. Microprogation of Hoya kerrii was initiated using leaf, petiole, root and inter-nodal segments of the selected plant as explants on MS medium containing 2,4-D at 1, 2, 3, 4 and 5 mg/L for callus induction. Leaf segments initiated callus earlier than inter-node, petiole and root. A significant amount of callus was produced in MS medium with 5.0 mg/L 2, 4-D and MS medium with 1.0 mg/L 2, 4-D gave the poorest callus.
Botanical gardens are gardens dedicated to collecting, cultivating, and displaying a wide variety of labeled plants. They contain different plant collections like tropical plants, herbs, cacti, and greenhouses. Botanical gardens are often run by universities or research organizations and serve purposes like education, scientific research, conservation, and addressing climate change by sequestering carbon and increasing cloud cover. Some examples of botanical gardens in India include the Empress Garden in Pune, Lalbagh Garden in Bangalore, and the largest in Asia, the Jawaharlal Nehru Tropical Botanical Garden in Kerala.
This document summarizes a study of the external and pollen morphological structures of four Terminalia species found in West Bengal, India. Key findings include:
1) The four species (T. arjuna, T. bellirica, T. chebula, T. catappa) showed distinct differences in bark structure, lamina (leaf) shape, and fruit type that allow for identification.
2) Pollen morphology was generally uniform across species but differences were seen in exine sculpturing, ranging from microrugulate in T. catappa to perforate-microrugulate in T. bellirica and T. chebula.
3) Two identification keys were provided based on
This document provides an overview of herbarium collection management, including the basics of taxonomy, identification, and documentation of plant collections. It discusses collecting plants through fieldwork and plant pressing, as well as documenting locality details, collection numbers, and morphological notes. It describes the roles of a herbarium in preserving plant biodiversity records and serving as a research center. It outlines typical herbarium operations like curation, accessioning specimens, storage and classification, usage rules, and insect control. It also discusses setting up a data information system through digitizing specimens, attaching barcode indexes, and photographing specimens to create an online digital repository of herbarium collections.
A herbarium is a collection of dried plant specimens mounted on archival paper where the plants are pressed, mounted, labeled with their scientific names, collector, and locality. It involves techniques like collection, pressing, drying, poisoning, mounting, stitching, labeling, filing, and depositing plants. A botanical garden is an educational institution for scientific workers and the public that displays a wide range of labeled plants for cultivation and collection.
Performance of Native Pennsylvania Wildflowers and Dianthus armeria (Caryophy...gtickerhoof
This study examined the growth of native Pennsylvania wildflowers on potential green roofs. 3 field sites near Curwensville, PA were monitored from June to August 2011. 5 plants (Erigeron annuus, Solidago juncea, Fragaria virginiana, Achillea millefolium, and Dianthus armeria) are good green roof candidates based on flexible roots <10cm, ability to grow in sun and rocky soil, and not outcompeting other plants. 4 additional plants (Asclepias tuberosa, Fragaria vesca, Aquilegia canadensis, and Linaria canadensis) showed potential but lacked full data due to low numbers. Measurements
Multivariate Analysis of Tea (Camellia sinensis (L.) O. Kuntze) Clones on Mor...Premier Publishers
Information on genetic variability for biochemical characters is a prerequisite for improvement of tea quality. Thirteen introduced tea clones characterized with objective; assessing tea clones based on morphological characters at Melko and Gera research stations. The study was conducted during 2017/18 cropping season on experimental plots in RCBD with three replications. Data recorded on morphological traits like days from pruning to harvest, height to first branch, stem diameter, leaf serration density, leaf length, leaf width, leaf size, petiole length, leaf ratio, internode length, shoot length, number of shoot, canopy diameter, hundred shoot weight, fresh leaf yield per tree. Cluster analysis of morphological trait grouped into four clusters indicated, the existence of divergence among the tested clones. The maximum inter-cluster distance was between clusters I and IV (35.27) while the minimum inter cluster distance was observed between clusters I and II (7.8).Principal components analysis showed that the first five principal components with eigenvalues greater than one accounted 86.45% for 15 morphological traits. Generally, the study indicated presence of variability for several morphological traits. However, high morphological variation between clones is not a guarantee for a high genetic variation; therefore, molecular studies need to be considered as complementary to biochemical studies.
Genetic characterization of morphological and yield traits in ten genotypes of Celosia argentea L. was evaluated
at the Research Farm of the Department of Botany, University of Ibadan, Nigeria. The experiment was laid out
in a randomized complete block design with four replicates. The results of analysis of variance carried out on
early morphological characters of C. argentea L. at 3, 4, and 5weeks after sowing showed significant
(p<0.05 /><0.01) effects except for number of leaves per plant and leaf width at 3 and 5 weeks after sowing,
respectively. The replicates in blocks produced varying observable effects on the genotypes while genotype x
replicate showed significant variation on morpho-agronomic and yield traits except number of days to flowering
at 50 days and fruit length at maturity. Also, from the result of the mean separation, it is shown that
NG/MAY/09/015 performed the best for plant height at flowering, leaf length at flowering, leaf width at
flowering, and root biomass. NG/SA/07/213 produced the highest mean values of number of flowers per plant,
leaf biomass and pod weight at maturity. The highest values of number of primary branches and fruit length at
maturity (FLM) were observed for NG/TO/MAY/09/015, while NG/AO/MAY/09/015 had the highest for pod
weight at maturity. The result of principal component axis also showed that Prin 1 accounted for highest Eigen
Vector of 38.62% from the total variation. NG/MAY/09/015 (R2) genotype produced the highest Eigen Vector
of 6.705 from Prin 1. The correlation result showed that plant height had a significant positive association with
seed weight at maturity, pod weight at maturity, number of primary branches and fruit length at maturity, while
similar association existed between leaf biomass, number of primary branches and pod weight at maturity, as
well as between plant height at flowering and pod weight at maturity. Again, the number of primary branches is
also positive and significantly correlated with plant height, root biomass and leaf length. Furthermore, the
results of dendrogram and minimum spanning tree revealed variations in genetic relatedness and distance,
respectively, which exist among the population of the C. argentea L.
1. Aonla is a tropical fruit native to Southeast Asia, with the botanical name Emblica officinalis. It is rich in vitamin C and is widely cultivated in parts of India.
2. There is significant variability in aonla for traits like fruit size and yield. Breeding objectives include developing varieties with higher yield, frost resistance, and color variation for new markets.
3. Breeding methods that can be used include selection, hybridization, induced polyploidy, mutation breeding, and new biotechnologies. While selection has had some successes, hybridization is challenging due to the long generation time and self-incompatibility of aonla.
Agronomic evaluation of eight genotypes of hot pepper (capsicum spp l.) in a ...Alexander Decker
This document evaluates the agronomic performance of eight pepper genotypes, including six exotic and two local varieties, under rain-fed conditions in Ghana. The study found that exotic hybrid varieties matured earlier and had better fruit weight, length, and yield compared to the local varieties. However, the two local varieties, Anloga and Legon 18, produced the highest number of undamaged fruits. The results identify pepper genotypes suitable for cultivation in the local environment and provide information to plant breeders for developing new varieties adapted to local conditions.
Agronomic evaluation of eight genotypes of hot pepper (capsicum spp l.) in a ...Alexander Decker
This document evaluates the agronomic performance of eight pepper genotypes, including six exotic and two local varieties, under rain-fed conditions in Ghana. The study found that exotic hybrid varieties matured earlier and had better fruit weight, length, and yield compared to the local varieties. However, the two local varieties, Anloga and Legon 18, produced the highest number of undamaged fruits. In general, fruit weight and diameter decreased from the green mature to ripe stage for most varieties. The study aims to identify pepper genotypes suitable for local cultivation conditions that have desirable growth and yield traits.
IOSRPHR(www.iosrphr.org) IOSR Journal of Pharmacyiosrphr_editor
This document summarizes a study on the roots of the plant Ziziphus oenoplia Mill. Microscopic analysis of transverse root sections showed a circular outline with cork, epidermal, cortex, and xylem tissues. Medullary rays were biseriate and reddish-orange. Powder microscopy revealed cork cells, wood elements, and starch grains. Physical analysis determined ash values, extractive values, and moisture content to establish standards for quality control. The aim was to validate the pharmacological properties of Ziziphus oenoplia roots through pharmacognostic characterization.
Aroideana43(3&4) le et al. - arisaema menglaense (1)DothiNongthon
This document reports the discovery of Arisaema menglaense, a species of herb previously known only from China, in northern Vietnam. Researchers from Vietnam and the UK found a population of A. menglaense during a field expedition in Ha Giang province. This extends the known range of the species and increases the number of Arisaema species in Vietnam belonging to section Anomala to 12. The document provides descriptions and photographs of A. menglaense, updates its formal taxonomic description based on the new Vietnamese specimens, and includes a key distinguishing the 12 species of section Anomala found in Vietnam.
Effect of environmental pollution on the quality of an edible plant Alternant...Premier Publishers
The present study is the comparative analysis of phytochemical constituents and microbial load of an edible plant Alternanthera philoxeroides (Mart.) Griseb collected from unpolluted and polluted site. Preliminary phytochemical analysis was performed with acetone, aqueous, chloroform, ethanol and petroleum ether extracts (unpolluted and polluted site) of A philoxeroides that showed the presence of alkaloids, carbohydrates, saponins, phenols, flavonoids, aminoacids, diterpenes, tannin, terpenoids, protein, steroid, oxalate, coumarin and quinones. The ethanol extract showed higher number of phytochemical constituents when compared to the other extract of unpolluted site. The microbial load is also enumerated in the unpolluted and polluted site. In conclusion, phytochemical analysis revealed the presence of many phytoconstituents in ethanol extract and the microbial load is less in the unpolluted site when compared to the polluted site.
This document summarizes a study that detected and identified the presence of Tomato ring spot virus (ToRSV) in ornamental plants in North Khorasan Province, Iran. 400 ornamental plant samples showing viral symptoms were collected from parks and gardens in two cities. Tests were done to detect the presence of ToRSV including DAS-ELISA, mechanical inoculation of infected samples onto test plants, and RT-PCR molecular identification. The results confirmed the presence of ToRSV in ornamental plants in North Khorasan Province.
An Investigation and Analysis of Features of (Codonopsis javanica (Blume) Hoo...AI Publications
Codonopsis Javanica (Blume) Hook.F & Thoms is called with Scientific name: Codonopsis javanica (Blume) Hook.f. & Thomson, Campanulaceae (the bellflower family).Plant description: Herbaceous, perennial, creeping by winding stems. Body pale green or purple. Leaves opposite, rarely staggered, heart-shaped at base, pointed at tip; edges are wavy or slightly notched. Roots cylindrical long, diameter can reach 1.5-2 cm, branched, root tips enlarged, with many keloid scars. Flowers grow individually in the interstitium, bell-shaped, white or yellowish, with purple veins in the throat. Fruit capsule, globose with 5 translucent edges, purple or red-purple when ripe, many seeds. The whole plant has white latex. Harvest in winter, wash the soil, cut off the roots and rootlets, dry in the sun or dry at low temperature to slightly dry, roll until soft, then gently dry again. In the paper authors also mentuiond its uses and usage: Ginseng is used to treat depression, anorexia, fatigue, anemia; also used in uterine prolapse, haemorrhage, haemorrhage, jaundice, leukocytosis, nephritis, albumin urine... Used alone or in combination with other drugs.. Codonopsis Javanica (Blume) Hook.F & Thoms root is a product in Son La (mainly the Thai community, the H'Mong people). On the other hand, Codonopsis Javanica (Blume) Hook.F & Thoms also are discovered at many other areas of Vietnam such as Lao cai, Lam Dong, etc.
The document summarizes a research study on the pharmacognosy and phytochemistry of Tephrosia uniflora leaves. Key findings include:
- Morphological, powder microscopic, physicochemical, preliminary phytochemical, and fluorescence analysis were conducted on T. uniflora leaf extracts.
- Physicochemical evaluation found the loss on drying was 0.14% w/w and total ash value was 6.94% w/w. Extractive values of petroleum ether, chloroform, ethanol, and aqueous extracts were reported.
- Preliminary phytochemical screening indicated the presence of carbohydrates, phenols, flavonoids, alkalo
Assessment of Endophytic Fungal Flora Responsible for Plant Growth Promotion...Sryahwa Publications
The present paper discusses the highest colonization of fungal endophytes as Alternaria speciesin comparison with Colletotrichumspecies and Fusarium species in all three plants Pongamia pinnata, Securinega leucopyrus and Rhus mysorensis. These endophytic fungi protect these plants from various
environmental factors such as temperature, moisture and other environmental factors.
This document reports the first record of Oenothera laciniata in Libya. Specimens were collected from the Ain Zarar region near Tripoli. O. laciniata is native to eastern North America and is considered invasive in Mediterranean ecosystems. A detailed morphological description is provided to facilitate identification and monitoring of this new species in Libya. This represents a new generic record of Oenothera for the flora of Libya. The identification was confirmed using literature references.
This grant proposal requests $772.35 to fund an undergraduate research project investigating the allelopathic effects of hayscented ferns. The student hypothesizes that the ferns suppress competing plants either through chemicals released from roots/leaves or as leaf litter leachate, and aims to determine if suppression occurs at the seed germination or seedling growth stages. The project will expose seeds and seedlings of sugar maple, red maple, red oak, and black cherry to aqueous extracts and a leachate treatment from ferns. Effects on germination and growth will be measured over several months. The budget details supplies, equipment, and a timeline to complete the work by April 2015.
1 pollen morphology and pollen elemental composition of selected philippine n...BIOLOGICAL FORUM
ABSTRACT: The pollen morphology and pollen elemental composition of the selected Philippine native gingers in tribe Alpinieae (Alpinioideae: Zingiberaceae) viz., Amomum muricarpum Elm., Etlingera dalican (Elmer) A.D.Poulsen, E. philippinensis (Ridl.) R.M.Sm. and Hornstedtia conoidea Ridl. are not completely determined as well as their impacts in the pollen germination and pollen tube growth. In this study, the analyses were performed by light microscopy (LM), scanning electron microscopy (SEM) and energy dispersive x-ray (EDX) spectrometry to better understand their pollen surfaces and pollen elemental composition. Data revealed that the pollen sizes of A. muricarpum measured 45-80µm, E. dalican measured 65-75µm, E. philippinensis measured 60-65µm while H. conoidea measured 50-90µm. The four native species possess spheroidal shape and inaperturate pollen. However, pollen color of A. muricarpum and H. conoidea were yellowish-brown, while green to greenish-yellow for E. dalican and greenish for E. philippinensis. Ornamentation or exine sculpture of A. muricarpum is echinate, E. dalican is gemmate while E. philippinensis and H. conoidea is psilate. A greater proportion of potassium (K+) and sulfur (S2-) were observed in the pollen of the four native gingers amongst other detected elements by EDX. Hence, studies on pollen characterization are important to perceive and reveal their morphological features, elemental composition and are useful for future studies on in vitro germination of the selected species.
“Advances in breeding of aonla ”
“Advances in breeding of aonla , breeding method of aonla ppt, new breeding method of aonla by gangaram rana, “Advances in breeding of aonla igkv , mutation breeding of aonla
This document provides information on the plant Justicia adhatoda, including its classification, biological sources, habitat, cultivation, macroscopic and microscopic characteristics, chemical constituents, pharmacological activities, ethnomedical uses, pharmacopeial standards, and formulations. It discusses how the leaves, flowers, and stems of J. adhatoda are used medicinally and contains vasicine and vasicinone alkaloids, which have antitussive, bronchodilatory, cardioprotective, abortifacient, and antimicrobial effects. The document also outlines standards and traditional preparations like juices, decoctions, and extracts using parts of the J. adhatoda plant.
The document discusses several leafy vegetable crops grown in India, including amaranth, spinach beet, spinach, New Zealand spinach, and Malabar spinach. It provides details on the botanical classification and origin of each crop. For amaranth and spinach beet, it describes breeding objectives such as disease resistance and yield improvement. It also lists improved varieties that have been developed for some of the crops.
This document provides information on various leafy vegetable crops grown in India, including their botanical classification and origins. It discusses amaranth, spinach beet, spinach, New Zealand spinach, poi/Basella, and fenugreek. For each crop, it outlines key details such as the genus and species, origin, cytology/chromosome number, breeding systems and objectives. It also provides information on improved varieties that have been developed for many of these crops. The document emphasizes the importance of these leafy vegetables in Indian agriculture and cuisine.
This study was carried out on the mycoflora associated with seeds of different citrus species. Citrus seed material was collected from districts of Punjab, i.e. Multan, Sargodha and Khanpur. Standard methods were applied for the isolation and identification of fungi. A total of 11 fungi including Aspergillus fumigatus, Aspergillus flavus, Dreschslera tetramera, Alternaria alternata, Curvularia lunata, Macrophomina phaseolina, Aspergillus niger, Fusarium solani, Fusarium moniliforme, Rhizopus and Penicillium spp were isolated from the seeds of citrus. For control of isolated seed-born fungi, 3 recommended fungicides such as Ridomil Gold, Bavistin, Score and two chemical Salicylic acid and Boric acid, were used at 20, 30, 40 mg/10 mL and 5, 6, 7 μL/10 mL, respectively and chemical with 20, 30, 40 mg/10 mL. All these fungicide and chemicals significantly reuced with population of all fungi present in naturally infected seed samples. Ridomil Gold and Salicylic acid were found to be the best for the control of se d-born fungi of citrus seed at 40 mg/10 mL. The isolation and identification of different mycotoxins is essential to study health status of the citrus consumers and to safeguard the standards of WTO.
Similar to Identification of Vietnamese Ochna integerrima (Lour.) Merr Species Based on Ribosomal DNA Internal Transcribed Spacer Sequence (20)
Bridging the Digital Gap Brad Spiegel Macon, GA Initiative.pptxBrad Spiegel Macon GA
Brad Spiegel Macon GA’s journey exemplifies the profound impact that one individual can have on their community. Through his unwavering dedication to digital inclusion, he’s not only bridging the gap in Macon but also setting an example for others to follow.
Understanding User Behavior with Google Analytics.pdfSEO Article Boost
Unlocking the full potential of Google Analytics is crucial for understanding and optimizing your website’s performance. This guide dives deep into the essential aspects of Google Analytics, from analyzing traffic sources to understanding user demographics and tracking user engagement.
Traffic Sources Analysis:
Discover where your website traffic originates. By examining the Acquisition section, you can identify whether visitors come from organic search, paid campaigns, direct visits, social media, or referral links. This knowledge helps in refining marketing strategies and optimizing resource allocation.
User Demographics Insights:
Gain a comprehensive view of your audience by exploring demographic data in the Audience section. Understand age, gender, and interests to tailor your marketing strategies effectively. Leverage this information to create personalized content and improve user engagement and conversion rates.
Tracking User Engagement:
Learn how to measure user interaction with your site through key metrics like bounce rate, average session duration, and pages per session. Enhance user experience by analyzing engagement metrics and implementing strategies to keep visitors engaged.
Conversion Rate Optimization:
Understand the importance of conversion rates and how to track them using Google Analytics. Set up Goals, analyze conversion funnels, segment your audience, and employ A/B testing to optimize your website for higher conversions. Utilize ecommerce tracking and multi-channel funnels for a detailed view of your sales performance and marketing channel contributions.
Custom Reports and Dashboards:
Create custom reports and dashboards to visualize and interpret data relevant to your business goals. Use advanced filters, segments, and visualization options to gain deeper insights. Incorporate custom dimensions and metrics for tailored data analysis. Integrate external data sources to enrich your analytics and make well-informed decisions.
This guide is designed to help you harness the power of Google Analytics for making data-driven decisions that enhance website performance and achieve your digital marketing objectives. Whether you are looking to improve SEO, refine your social media strategy, or boost conversion rates, understanding and utilizing Google Analytics is essential for your success.
Discover the benefits of outsourcing SEO to Indiadavidjhones387
"Discover the benefits of outsourcing SEO to India! From cost-effective services and expert professionals to round-the-clock work advantages, learn how your business can achieve digital success with Indian SEO solutions.
Ready to Unlock the Power of Blockchain!Toptal Tech
Imagine a world where data flows freely, yet remains secure. A world where trust is built into the fabric of every transaction. This is the promise of blockchain, a revolutionary technology poised to reshape our digital landscape.
Toptal Tech is at the forefront of this innovation, connecting you with the brightest minds in blockchain development. Together, we can unlock the potential of this transformative technology, building a future of transparency, security, and endless possibilities.
Meet up Milano 14 _ Axpo Italia_ Migration from Mule3 (On-prem) to.pdfFlorence Consulting
Quattordicesimo Meetup di Milano, tenutosi a Milano il 23 Maggio 2024 dalle ore 17:00 alle ore 18:30 in presenza e da remoto.
Abbiamo parlato di come Axpo Italia S.p.A. ha ridotto il technical debt migrando le proprie APIs da Mule 3.9 a Mule 4.4 passando anche da on-premises a CloudHub 1.0.
Gen Z and the marketplaces - let's translate their needsLaura Szabó
The product workshop focused on exploring the requirements of Generation Z in relation to marketplace dynamics. We delved into their specific needs, examined the specifics in their shopping preferences, and analyzed their preferred methods for accessing information and making purchases within a marketplace. Through the study of real-life cases , we tried to gain valuable insights into enhancing the marketplace experience for Generation Z.
The workshop was held on the DMA Conference in Vienna June 2024.
2. average height is over 1 m for 5-year-old-tree. The blight yellow flowers are symbolized for
happiness, health and prosperity [6]. This genus is rich in some medicinal compounds such as
bioflavonoids, anthranoids and oavonoids [7, 8]. The leaves have long been used in traditional
medicine for treatment of various ailments included: asthma, dysentery, epilepsy, gastric disorders,
menstrual, lumbago, ulcers, and also used as an abortifacient, or antidote against snakebite [5]. The
plant bark and roots are often used in traditional medicine as a digestive tonic and a cathartic for
worms and a medicine for lymphatic disorder [6].
In northern of Vietnam, O. integerrima plant was discovered in a long time ago at Yen Tu
mountainous areas. Due to its typical colourful flower, this plant has been paid much attention to be
adopted for decoration. According to the historical documents, the yellow flowers plant was called
“golden age” which derived from over 800 years ago (1285-1288 generation). However, the
questions have emerged that whether Yen Tu Ochna and the southern Ochna are the same or
different species. Some reports have stated that that Yen Tu Ochna and the southern plant may
derive from the same origin. Some views have debated that they are different species [9].
In Vietnam, there are currently sporadical studies on O. integerrima species. Some initial
reports focused only on conservation, storage and classification at geographic level of its
distribution [9]. Many of O. integerrima species are complicated to separate without their flowers
and phenotypic characteristics. Traditionally, the Vietnamese botanists have identified and
classified the relationship of Ochna species depending on its habitats, morphological and
cytological characteristics. However, these methods are curbed by the adverse impacts of climate
change and diagnostic resolution.
Recently, molecular markers have been widely applied to distinguish the related plants and
shown to be feasible methods. The internal transcribed spacer (ITS) is one of the most extensively
applied molecular markers for angiosperm. Therefore, the objectives of the current study were to
characterize the morphological traits of 21 Ochna species as well as investigate genetic variability
and relationships among the studied species by sequencing the internal transcribed spacer (ITS)
region.
Materials and Methods
Plant materials
A total of 21 O. integerrima varieties were kindly provided by the Fruit and Vegetable
Research Institute in 2016. They were collected from some different areas in both northern and
southern areas of Vietnam. The native name and origin as well as collected areas are shown in the
Table 1.
10 Volume 68
3. Table 1. List of the varieties used in analyses in this study.
No Native name Code Origin/province Collected area
1 Mai YenTu 1 B1 Yen Tu (Quang Ninh) Gia Lam (Hanoi)
2 Mai YenTu 2 B2 Yen Tu (Quang Ninh) Gia Lam (Hanoi)
3 Mai YenTu 3 B3 Yen Tu (Quang Ninh) Gia Lam (Hanoi)
4 Mai Hue B4 Hue Gia Lam (Hanoi)
5 Mai vang B5 Hanoi Gia Lam (Hanoi)
6 Mai YenTu 4 B6 Yen Tu (Quang Ninh) Quang Ninh
7 Mai xoan B7 Hanoi Gia Lam (Hanoi)
8 Cucmai1 N1.1 Southern of Vietnam Binh Dinh
9 Cucmai2 N1.2 Southern of Vietnam Binh Dinh
10 Cucmai3 N1.3 Southern of Vietnam Binh Dinh
11 Cuc mai Thuong Hai N1.5 China Binh Dinh
12 Mai giao1 N2.1 Southern of Vietnam Binh Dinh
13 Mai giao2 N2.2 Southern of Vietnam Binh Dinh
14 Mai giao3 N2.3 Southern of Vietnam Binh Dinh
15 Hong mai N2.4 Southern of Vietnam Binh Dinh
16 Mai giao4 N2.5 Southern of Vietnam Binh Dinh
17 Mai huong 5 canh N3.1 Southern of Vietnam Binh Dinh
18 Mai vang 5 canh N3.2 Southern of Vietnam Binh Dinh
19 Mai rung 5 canh N3.3 Southern of Vietnam Binh Dinh
20 Mai Singapore N4 Southern of Vietnam Binh Dinh
21 Mai dại doa N5 Southern of Vietnam Binh Dinh
Morphological analysis
Morphological traits, both qualitative and quantitative ones, were observed on flowers
(collected in March, when the flowers are fully developed) and leaves (collected in March for young
leaves and in July for mature leaves).
Qualitative traits include the shape of petals and sepals, aestivation of corolla (involving
number of sepals and petals), flower fragrance, colour of young leaves, colour of mature leaves, and
leaf shape. These characters were described based on the standard quantitative comparison of
phenotypes and expression patterns of flowering plants, particularly Ochnacea family [10, 11].
Quantitative traits include corolla diameter and flower longevity (the number of days from
blooming to falling off), which were measured with 3-time replication on 5 random individuals of
each variety. The results were statistically recorded with ANOVA and t-test by MS EXCEL 2013.
DNA isolation, PCR and sequencing
Genomic DNA was isolated from leaves of all samples using the CTAB method [12] with
some minor modifications. The yielded DNA products were then recorded by using a
spectrophotometer [13].
Amplifications were carried out in 15 µl volumes with 0.5 U of MyTaq DNA polymerase
(Promega, Madison, WI), 2.5 mM MgCl2, 1 mM of dNTPs, 1 µM of each primer, and undetermined
quantities of genomic DNA template in a Mastercycler S. The pair of primers ITS1/ITS8 were used
with nucleotide sequence: GGAAGGAGAAGTCGTAACAAGG/ CACGCTTCTCCAGACTACA
[14]. After initial denaturation (5 min at 94°C), polymerase chain reaction (PCR) was performed for
35 cycles of denaturation (45 s at 94°C), primer annealing (45 s at 59°C), and primer extension
(55 s at 72°C). The reactions ended with an elongation period of 4 min at 72°C.
PCR products were electrophoresed on 1% agarose gels in Tris-borate-EDTA buffer and
stained with ethidium bromide. Afterwards, amplified double-stranded DNA fragments (750bp)
were purified using the “Wizard” DNA cleanup system (Promega, Madison, WI) and directly
sequenced on an ABI 373A automated sequencer using the standard dye-terminator chemistry
following to manufacture’s protocol (Applied Biosystems Inc.).
International Letters of Natural Sciences Vol. 68 11
4. Sequence analyses
The purified PCR products were directly sequenced by an ABI PRISMTM
310 Genetic
Analyzer (Applied Biosystem). The primers ITS1 and ITS8 were used for the sequence reaction.
The ITS region of each individual was then sequenced in both 5’ and 3’ directions at least twice to
avoid mutation introduced by Taq polymerase. The boundaries of the ITS1 and ITS8 were
determined by comparing them with the published sequences based on the similarity sequence on
the NCBI.
Statistical Analysis
The sequences were aligned and analyzed using the MEGA v5.1 program to generate the
phylogeny.
Results and Discussion
Morphological characterizations
The total 21 samples of Ochna species were collected in some areas from Vietnam and divided
into two main groups: samples from the northern region and samples from the southern region, of
which the samples from the northern region were included in two sub-groups: Yen Tu Ochna and
common Ochna. In this study, the flower morphology and their quality were evaluated based on the
flower diameter, number of sepals, number of petals, shape of petals and sepals, aestivation of
corolla, fragrance, flower longevity and duration of flower season (Table 2).
As the observation, the samples reveals variable in diameter of flowers, of which Yen Tu and
common Ochna showed negligible different of the flower size from 3.4 to 3.7 cm, respectively.
Among them, B1 and B2 samples disclosed the highest by 3.7 cm, while B5 and B7 were 3.6 cm,
respectively. Contrarily, the samples collected from southern regions exhibited to be higher than
that both samples of Yen Tu and common Ochna. The samples N5 showed the highest by 7.2 cm,
followed by N4 (5.4 cm). Also, 7 samples N1.1, N1.2, N1.3, N1.5, and N2.4 were 4.5 cm. The
number of sepals of all samples was 5 sepals except the samples N2.3 (Table 2). It notes that the
number of petals of the samples collected from southern region was shown significantly higher than
both of Yen Tu and common Ochna. Specifically, 9 Ochna samples included N1.1, N1.2, N1.3,
N1.5, N2.1, N2.2, N2.3, N2.5 and N5 were ranged from 9 to 48 petals, respectively (Table 2).
Figure 1. Morphological characteristics of flower samples; A: B1; B: B2; C: B4; D: N2.2; E: N2.3;
F: N3.1.
It was monitored that there were only 2 kinds of round and oval shapes of petals and sepals in
both samples from northern and southern regions. For the aestivation of the corolla, all samples of
northern region were demonstrated the aestivation only, while 9 samples collected from southern
12 Volume 68
5. region were revealed the imbrication with the exception of the 4 samples showed the valvation
including N2.4, N3.1, N3.2, N3.3 and N4. It was worthily to mention that Yen Tu Ochna samples
have had the fragrance, which contradicted the samples of common Ochna and the samples from
the southern region, not including the sample N3.1 (Table 2). To further evaluate the flower
longevity and duration of flower season between the Ochna samples from northern and southern
regions, the results have shown that the flower of Ochna samples of Yen Tu demonstrated the most
longevity by 5.4 to 6.2 days, followed by southern Ochna and the lowest samples were found in the
common Ochna. Similarly, the duration of flower season of the samples of Yen Tu Ochna was
shown to be highest by 4 to 5 weeks, followed by the southern Ochna which displayed wide range
duration of flower season by 3.2 to 4.5 weeks, and the lowest duration was observed in the common
Ochna (Table 2).
Figure 2. Panorama of Yen Tu Ochna trees in nature [14].
For characterization of leaf morphology amongst the samples, the colors of young leaves of
Yen Tu and common Ochna were remarkably different by two major colour of light green and light
red. It notes that the samples from southern region exhibited the intense green, which was dissimilar
with the samples of Yen Tu and common Ochna samples. However, the leaf blade of all samples
showed wide variation amongst the sample. For instance, B1, N1.1, N1.3, N2.1, N2.5 and N4
samples disclosed the elliptical shape. The obovate-lanceolate leaf blade was found in B2, B3, B6
and N3.1, while the obovate-oblong of leaf blade was demonstrated in 11 samples of both groups
(Table 3). The leaf base and leaf margin of all samples showed the similarity with cuneate and
serrate, but the leaf tip was variable among the group with acute and obtuse of the leaf tip,
respectively (Figs. 1, 2).
Some studies reported that Yen Tu Ochna was unique with differences from the other Ochna
species based on their branch, bark, leaf, fragrance [15]. According to the recent preliminary
investigation on the current distribution of Yen Tu Ochna in nature, the results have shown that
most Yen Tu Ochna trees have been 60 years old or older with large trunks, the average perimeter
reached 40 cm with 5 to 7 meter plant height. Most plants have widely adapted on the cliffs with
400 to 900 meters above sea level [16].
Generally, the morphological characterization of the Yen Tu Ochna species including flower
and leaf morphology, quality showed typical unique differences to compare with both common and
southern Ochna samples.
Molecular markers application to identify Ochna species based on ITS region sequences
By using ITS1/ITS8 primer pairs, the ITS region was successfully amplified by PCR. The
product was then checked on agarose gel (1.5%). The obtained results were shown to be high
quality with the appearance of only one band with size, which ranged approximately 800 bp. Our
result was agreed with some previous reports who amplified the ITS region of the plant samples
[17, 18]. To emphasize that the obtained bands were clear and correct size, which are enough
quality to use for sequencing.
International Letters of Natural Sciences Vol. 68 13
6. Sequencing ITS-rDNA of the Ochna samples
A total 21 PCR products of 21 Ochna samples was sequenced, then analyzed by the software
MEGA v6. The results showed that the 4 different colour peaks appeared, which directly correlated
with 4 nucleotides and nucleotide sequences of each sample.
ITS analysis showed that the sequence of nucleotides among Ochna samples has been
different. In general, the ration of Guanine and Cytosine were greater than those of Adenine and
Thymine. In the other hand, the percentage of GC was found higher than the percentage of AT.
Specifically, N2.2 sample revealed the highest GC content by 65.7%), while TA content was
34.3%, respectively. The average percentage of GC in all 21 samples was reached 65.3%, and their
AT component averaged by 43.7%.
Table 2. Morphological characterization of the Flower and quality of the Ochna samples.
Group No Sample
Diameter
(cm)
Number
of sepals
Number
of petals
Shape of
petals and
sepals
Aestivation
of corolla
Fragrance
Flower
longevity
(days)
Samples
from
Northern
region
Yen Tu
Ochna
1 B1 3.7a
5 5 Round Valvate Yes 5.4a
2 B2 3.7a
5 5 Round Valvate Yes 5.8a
3 B3 3.4a
5 5 Round Valvate Yes 6.2b
4 B6 3.5a
5 5 Oval Valvate Yes 5.4a
Common
Ochna
5 B4 3.5a
5 5 Round Valvate No 3.1c
6 B5 3.6a
5 5 Oval Valvate No 3.5c
7 B7 3.6a
5 5 Round Valvate No 3.1c
Samples from
Southern region
8 N1.1 4.5b
5 24 Oval Imbricate No 3.9d
9 N1.2 4.5b
5 48 Round Imbricate No 3.9d
10 N1.3 4.5b
5 48 Round Imbricate No 4.0d
11 N1.5 4.5b
5 24 Oval Imbricate No 3.2c
12 N2.1 3.7a
5 10 Round Imbricate No 3.8e
13 N2.2 3.5a
5 9 Round Imbricate No 3.8e
14 N2.3 3.7a
6 12 Round Imbricate No 4.2f
15 N2.4 4.4b
5 5 Round Valvate No 4.5f
16 N2.5 3.6a
5 10 Round Imbricate No 4.2f
17 N3.1 3.2c
5 5 Round Valvate Yes 3.2c
18 N3.2 4.1d
5 5 Oval Valvate No 3.4c
19 N3.3 4.0d
5 5 Oval Valvate No 3.9e
20 N4 5.4e
5 5 Round Valvate No 3.5c
21 N5 7.2f
5 10 Round Imbricate No 3.5c
Note: a,b,c,d,e on the same column indicated statistically significant difference of the means with P<0,05
14 Volume 68
7. Table 3. Leaf morphology of the used samples.
Group No Sample
Colour of
young
leaf
Colour of
mature
leaves
Leaf blade Leaf base Leaf tip
Leaf
margin
Samples
from
Northern
region
Yen Tu
Ochna
1 B1
Light
green
Intense
green
Elliptical Cuneate Acute Serrate
2 B2
Light
green
Intense
green
Obovate-
lanceolate
Cuneate Obtuse Serrate
3 B3
Light
green
Intense
green
Obovate-
lanceolate
Cuneate Obtuse Serrate
4 B6
Light
green
Intense
green
Obovate-
lanceolate
Cuneate Obtuse Serrate
Common
Ochna
5 B4 Light red
Intense
green
Obovate-oblong Cuneate Acute Serrate
6 B5 Light red
Intense
green
Obovate-oblong Cuneate Obtuse Serrate
7 B7 Light red
Intense
green
Obovate-oblong Cuneate Acute Serrate
Samples from
Southern region
8 N1.1 Light red
Intense
green
Elliptical Cuneate Cuneate Serrate
9 N1.2 Light red
Light
green
Obovate-oblong Cuneate Cuneate Serrate
10 N1.3 Light red
Light
green
Elliptical Cuneate Cuneate Serrate
11 N1.5 Light red
Light
green
Obovate-oblong Cuneate Cuneate Serrate
12 N2.1 Light red
Light
green
Elliptical Cuneate Cuneate Serrate
13 N2.2 Light red
Intense
green
Obovate-oblong Cuneate Cuneate Serrate
14 N2.3 Light red
Intense
green
Obovate-oblong Cuneate Cuneate Serrate
15 N2.4 Light red
Intense
green
Obovate-oblong Cuneate Cuneate Serrate
16 N2.5 Light red
Intense
green
Elliptical Cuneate Cuneate Serrate
17 N3.1 Light red
Intense
green
Obovate-
lanceolate
Cuneate Obtuse Serrate
18 N3.2 Light red
Intense
green
Obovate-oblong Cuneate Acute Serrate
19 N3.3 Light red
Intense
green
Obovate-oblong Cuneate Acute Serrate
20 N4 Light red
Light
green
Elliptical Cuneate Acute Serrate
21 N5 Light red
Light
green
Obovate-oblong Cuneate Obtuse Serrate
Comparison of ITS-rDNA nucleotide sequence of the Ochna samples
The segments ITS-rDNA nucleotide sequences of the total 21 Ochna samples were identified
and compared. Based on the results of analysis of the diversity of the ITS-rDNA sequences and
alignment of the sequences by Mega v6.0 and CLCv8.0 software, it has been revealed that the
differences between the major sequences were single polymorphisms (SNPs), in which one
nucleotide was replaced by another nucleotide. In general, approximately 100 nucleotides changed
their position. Specifically, the sequences ranged from 80 to 120 observed the deletion of segments,
for example, the B1, B2, B3, B6 and N3.1 samples showed nucleotide sequence 80 to 85 and 108 to
112, respectively (Fig. 3). Moreover, other positions of nucleotide sequence revealed either
nucleotide deletion or insertion. In the other words, this indicated the difference between the
nucleotides which caused distinction among these DNA segments.
International Letters of Natural Sciences Vol. 68 15
8. Figure 3. Aligned sequence of ITS regions of the Ochna samples.
We have made the comparison of each pair by BLAST tool to attain the ITS-rDNA region
sequence correlation coefficient between the 21 Ochna models. The results of the sequence of
identification matrix are shown in Fig. 4. It demonstrated that there was a high correlation between
the sequences of 21 Ochna samples, of which the highest correlation coefficient was 100% and the
lowest was 96.25%, while the nearest genetic distance was 0.00 and the furthest was found by 0.02.
Figure 4. Correlation coefficient and genetic distance of ITS-rDNA of 21 Ochna samples.
16 Volume 68
9. The phylogenetic trees based on ITS-rDNA of 21 Ochna samples
After identifying the region of nucleotide sequences of ITS-rDNA, the phylogenetic trees were
generated as shown in Fig. 5. Based on the taxonomic tree, the regions of ITS-rDNA sequence of 21
samples species were divided into 2 main groups:
Group I: included ITS-rDNA region of the samples B1, B2, B3, B6 and N3.1.
Figure 5. The phylogenetic trees of 21 Ochna samples.
The group II: consisted of the ITS-rDNA region sequence of the 16 samples: B4, B5, B7, N1.1,
N1.2, N1.3, N1.5, N2.1, N2.2, N2.3, N2.4, N2.5, N3.2, N3.3, N4 and N5
Group II was divided into 2 subgroups: Subgroup I (P1): N1.2 and subgroup II (P2): B4, B5,
B7, N1.1, N1.3, N1.5, N2.1, N2.2, N2.3, N2.4, N2.5, N3.2, N3.3, N4 and N5.
The ITS-rDNA region sequences of the 21 Ochna samples were identified. Amongst them, the
size of ITS was ranged from 666bp to 721bp; the percentage of (G+C) fluctuated from 64.6% to
65.7%, and the average of ratio percentage was 65.3%. Generally, 21 Ochna samples have attained
similar size and (G+C) content ratio of the ITS region of many angiosperm species as published. In
fact, ITS sequences were previously used to generate the first phylogeny of Rubus, which generally
corresponded to their biogeography and polyploid, but not to their conventionally important
morphological characters [19]. Our study has been congruent with the previous reports of Yuan et
al. [20] and Trung et al. [14], who documented the relationship of Dendrobium species based on
sequences characterization of the rDNA ITS region.
Conclusions
In this study, we have successfully identified the nucleotide sequences by use of ITS-rDNA
and made the comparison among the samples in order to find out the evolutionary relationships
among species or the genetic diversity of individual in the same species. It is the first report on
identification of 21 Ochna samples by use of ITS1-5.8S-ITS2 gene sequences. The genetic
correlations of the samples ranged from 96.25% to 100%. Based on the difference in the ITS1-5.8S-
ITS2 gene sequences, it has shown accurately determination of the 21 genetic resource of Ochna
samples, of which, 5 samples include B1, B2, B3, B6 and N3.1 were divided into their own groups.
N2.5
N5
N3.2
N3.3
N2.1
N2.4
N1.3
N1.5
N1.1
B4
N4
B5
N2.2
B7
N2.3
N1.2
B1
B2
B3
B6
N3.1
95
71
65
0.001
International Letters of Natural Sciences Vol. 68 17
10. References
[1] N.K.B. Robson, The author and typification of the genus Ochna, Taxon. 11(2) (1962) 48–52.
[2] A.B. Rendle, The classification of flowering plants, vol. 2, Cambridge University Press,
Cambridge, 1952.
[3] N.D. Hoe, Explanation of ancient plant clusters, in: Yen Tu Environmental Forum,
Association of Nature and Environment Protection (VACNE). 2011. Available:
http://vacne.org.vn/tai-sao-yen-tu-4-giai-gia-manganese-carbonate-power-co-generation-yen-
tu/25594.html. Retrieved: July 7, 2017.
[4] T. Hop, Bonsai and flower plants in Vietnam, Youth Publisher, Hanoi Vietnam, 1993. (in
Vietnamese)
[5] A.K.R. Bandi et al., Phytochemical and biological studies of Ochna species, Chem.
Biodiversity. 9(2) (2012) 251–271.
[6] G. Ma et al., Shoot organogenesis and somatic embryogeneisis from leaf and shoot explants
of Ocha integerrima (Lour), Plant Cell Tissue Organ Cult. 104(2) (2011) 157–162.
[7] L. Kittisak et al., Flavonoids from Ochna integerrima, Phytochem. 56(4) (2001) 353–357.
[8] C.A. Williams, R. Grayer, Anthocyanins and other flavonoids, Nat. Prod. Reps. 21(4) (2004)
539–573.
[9] D.V. Dong, Golden age plant – precious germplasm with endanger. Report on investigation of
Yen Tu – yellow flower plant, Fruit and Vegetable Research Institute, 2008.
[10] K. Ilic et al., The plant structure ontology, a unified vocabulary of anatomy and morphology
of a flowering plant, Plant Physiol. 143(2) (2007) 587–599.
[11] The Angiosperm Phylogeny Group, An update of the Angiosperm Phylogeny Group
classification for the orders and families of flowering plants: APG II, Bot. J. Linnean Soc.
141(4) (2003) 399–436.
[12] J.J. Hoyle, J.L. Doyle, A rapid DNA isolation procedure for small qualities of fresh leaf
tissue, Phytochem. Bull. 19 (1987) 11–15.
[13] J. Sambrook, D.W. Russell, Molecular cloning, Third edition, Vol. 1, Cold Spring Harbor
Laboratory Press, New York, 2001.
[14] K.H. Trung et al., Molecular phylogeny of the endangered Vietnamese Paphiopedilum species
based on the internal transcribed spacer of the nuclear ribosomal DNA, Adv. Biol. Studies.
5(7) (2013) 337–346.
[15] P. Thao, H. Trang, The morphological characteristics of Yen Tu Ochna. Available:
https://www.baomoi.com/dac-diem-nhan-dang-giong-mai-vang-yen-tu/c/22416504.epi, 2017.
Retrieved: October 2, 2017. (in Vietnamese)
[16] T. Khoi, Yen Tu Ochna flower, 2014. Available: https://thuvienhoasen.org/a22043/hoa-mai-
vang-yen-tu. Retrieved: October 2, 2017. (in Vietnamese)
[17] T.H. Dung et al., Application of DNA technology to classify and identify Dendrobium
parishii and Dendrobium anosmum in Vietnam, J. Agri. Rural Dev. 18 (2012) 3–9.
[18] Y.T. Liu et al, Analysis of sequence diversity through internal transcribed spacers and simple
sequence repeats to identify Dendrobium species, Gen. Mol. Res. 13(2) (2014) 2709–2717.
[19] L.A. Alice et al., Hybridization and gene flow between distantly related species of Rubus
(Rosaceae): evidence from nuclear ribosomal DNA internal transcribed spacer region
sequences, Systematic Botany. 26(4) (2001) 769–778.
[20] Q. Yuan, J.Y. Zhang, T. Liu, Phylogenetic relationship of China Dendrobium species based
on the sequence of the internal transcribed spacer of ribosomal DNA, Biologia plantarum.
53(1) (2009) 155–158.
18 Volume 68