Recommended
More Related Content
Similar to Hong BIOL 360 Sp 2021 Genetics Pre-Exam 3 Questions
Similar to Hong BIOL 360 Sp 2021 Genetics Pre-Exam 3 Questions (20)
More from PazSilviapm
More from PazSilviapm (20)
Recently uploaded
Recently uploaded (20)
Hong BIOL 360 Sp 2021 Genetics Pre-Exam 3 Questions
- 1. Hong BIOL 360 Sp 2021 Genetics Pre-Exam 3 Questions Useful resources: https://web.expasy.org/translate/ https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSear ch&BLAST_SPEC=blast2seq& LINK_LOC=align2seq (BLAST2 to compare any two sequences) https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins (BLAST search DNA or protein against databases) www.benchling.com (DNA editor and restriction sites) https://web.expasy.org/translate/ https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSear ch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq
- 2. https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSear ch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins http://www.benchling.com/ Hatan Algow Hatan Algow Hong BIOL 360 Sp 2021 Exam 3 DNA problems: Work on these problems BEFORE the exam. DO NOT discuss these problems with anyone, as you are expected to work on them on your own. The actual exam questions will require you to have some of these tanswers on hand and document your work. 1. Predict a possible phenotype from the following mutations in the Lac Operon: a deletion in “GGAATTGTGAGCGGATAACAATTTCAC.” 2. Using the BLASTP search, find out which is the closest biological source for this protein? (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins). How is this protein related to one you have worked on before? How closely related are the new protein and the ‘old’ protein in percentage of identity?
- 5. 3. We will re-analyze our old sequence, the gene that can cause hemophilia in humans, coagulating factor VIII. The mRNA sequence (as DNA) is shown below. What is the longest open reading frame (ORF)? 4. What is the longest fragment from this gene you can clone using HindIII (A’AGCTT)? https://blast.ncbi.nlm.ni h.gov/Blast.cgi?PAGE=Proteins Hatan Algow Hong BIOL 360 Sp 2021 5. If you successfully cloned this longest fragment into pUC19, what are the two possible restriction patterns on a gel you can expect using XbaI (T’CTAGA)? >NM_000132.4|coagulating factor VIII GCTTAGTGCTGAGCACATCCAGTGGGTAAAGTTCCTTAAA ATGCTCTGCAAAGAAATTGGGACTTTTCAT
- 10. CTACTTCATCAAAAAACATGGAAATGGTCCAACAGAAAA AAGAGGGCCCCATTCCACCAGATGCACAAAA TCCAGATATGTCGTTCTTTAAGATGCTATTCTTGCCAGAA TCAGCAAGGTGGATACAAAGGACTCATGGA AAGAACTCTCTGAACTCTGGGCAAGGCCCCAGTCCAAAG CAATTAGTATCCTTAGGACCAGAAAAATCTG Hatan Algow Hong BIOL 360 Sp 2021 TGGAAGGTCAGAATTTCTTGTCTGAGAAAAACAAAGTGG TAGTAGGAAAGGGTGAATTTACAAAGGACGT AGGACTCAAAGAGATGGTTTTTCCAAGCAGCAGAAACCT ATTTCTTACTAACTTGGATAATTTACATGAA AATAATACACACAATCAAGAAAAAAAAATTCAGGAAGAA ATAGAAAAGAAGGAAACATTAATCCAAGAGA ATGTAGTTTTGCCTCAGATACATACAGTGACTGGCACTAA GAATTTCATGAAGAACCTTTTCTTACTGAG CACTAGGCAAAATGTAGAAGGTTCATATGACGGGGCATA TGCTCCAGTACTTCAAGATTTTAGGTCATTA AATGATTCAACAAATAGAACAAAGAAACACACAGCTCAT TTCTCAAAAAAAGGGGAGGAAGAAAACTTGG AAGGCTTGGGAAATCAAACCAAGCAAATTGTAGAGAAAT ATGCATGCACCACAAGGATATCTCCTAATAC
- 15. AGGAGAAACCTGCATGAAAGCATTCTTCCCTGAAAAGTT AGGCCTCTCAGAGTCACCACTTCCTCTGTTG TAGAAAAACTATGTGATGAAACTTTGAAAAAGATATTTAT GATGTTAACATTTCAGGTTAAGCCTCATAC Hatan Algow Hong BIOL 360 Sp 2021 GTTTAAAATAAAACTCTCAGTTGTTTATTATCCTGATCAA GCATGGAACAAAGCATGTTTCAGGATCAGA TCAATACAATCTTGGAGTCAAAAGGCAAATCATTTGGACA ATCTGCAAAATGGAGAGAATACAATAACTA CTACAGTAAAGTCTGTTTCTGCTTCCTTACACATAGATAT AATTATGTTATTTAGTCATTATGAGGGGCA CATTCTTATCTCCAAAACTAGCATTCTTAAACTGAGAATT ATAGATGGGGTTCAAGAATCCCTAAGTCCC CTGAAATTATATAAGGCATTCTGTATAAATGCAAATGTGC ATTTTTCTGACGAGTGTCCATAGATATAAA GCCATTTGGTCTTAATTCTGACCAATAAAAAAATAAGTCA GGAGGATGCAATTGTTGAAAGCTTTGAAAT AAAATAACAATGTCTTCTTGAAATTTGTGATGGCCAAGAA AGAAAATGATGATGACATTAGGCTTCTAAA GGACATACATTTAATATTTCTGTGGAAATATGAGGAAAAT CCATGGTTATCTGAGATAGGAGATACAAAC
- 17. AA Hatan Algow Hong BIOL 360 Sp 2021 Problems 6-10: Consider the following sequences from a gene for nematode olfaction. >odr-3 cDNA ATGGGATTGTGTCAGAGCAGCTCAGAAGTTGATAAGGAA CAACAGCAGCGAAATAAG GAAATCGAAAAGCAGATTAACTCGGACAAACGATCAGCA TCGAGTATCGTCAAACTT CTTTTGTTAGGAGCTGGAGAATGCGGAAAATCGACAGTTT TGAAGCAGATGCAAATTC TGCATTCCAATGGATTCACGGAAGAGGAAGTGAATGAGA AACGAGGAATCGTTTTCA ATAACACGGTCACATCAATGTGTTCCATACTCCGAGCAAT GGATGCTGTACTTCACAT TCAATTAGAGAACTCCGAATTGGAGCCCGAGAAAGCTAT GATTCTCAAGATTCAAGA GAAGGGAGAAGAATCGGAACAGATGACACCTGAAAAAC GAGATGCCCTGCTCGCATT
- 20. CATTACAGGTCACATCAATGTGTTCCATACTCCGAGCAAT GGATGCTGTACTTCACATT CAATTAGAGAACTCCGAATTGGAGGTCGGTTTATGATCTC CCTTTATCACACCTTCAA ATAGTGTATGAATTGTATTGCAATCAAGGAACTGTTCCAT GAACCTTTTTGTATCTCCC ATTAAATTCATTGGGATCCGTGTTGATAGTGAATCTCAAT CTCATGTGTATCGTGTAGT CAGGGGCAACTGAGAAGGGGGGAAAGAAACGACGGGGT ATTCATGAGATCCAGAAG GGGATTGAGAGGGGGACTGAGTAGGAGTGAGAAGGGAG AGGGGGGAGGGGACGGG Hatan Algow Hong BIOL 360 Sp 2021 GACGGCTGTAATGGGAAAGATATAGGACGATCGACGTCA ATAATCGTTGAAATTTGA ACATGGGACCGACTCTGAAAAGGAACGATTTCAGCCCGA GAAAGCTATGATTCTCAA GATTCAAGAGAAGGGAGAAGAATCGGAACAGATGACACC TGAAAAACGGTGAGTGA CGACGATCGATTGATGATTCACCCATAACTGTGATTGCAG AGATGCCCTGCTCGCATT
- 24. AAGGCAGGAATGATGTAGACACTTCTCCTTTCTTCTTCAG AGGAATCCAATGATTTTTC Hatan Algow Hong BIOL 360 Sp 2021 AAACGAGCTTTTCAAACTCAATATTGATCGATATTTGCTC ATTCACGTGTTCTCTTCTC TTCTTATTCATCTCGTCCATAATATTTTGATCTCACTAATC GATAGTGTAGTCACGTCA CTTACCGTACTACCGTTAGATCAAATTGAAATGTGATTTT GCTATATTTCGTGTACCCT TACAAAACTTCGATCTCGATCCTTCCAAAAAGGAACAAAT GTTCTCAATCCTCATGTA TCCCTCCAACATTCTCCCCATTTGTCAAATGCATCTTTCTT TATAATGCATTTCGACCCA TATCTCCATTCTCGATTGTTGTTTTTGCCTGCTAAATTCTG AATTCCCATCATAAATCTC ACGTAGGTTTGATACTCTCGTCACATCGATTGCTGCGCAT TCAGAGAAACCGAGTGAT AAACAATTTTTATGAGATTTGGAGAGTGCGAAAAGAGTA ACAATGAAATCAACAACG AGAACAATCAATGCAGTTTGAGGTCTATTGTGGGACTAAC TAACTGCTAACAATTAAT
- 26. 6. How many exons does this coding region contain? 7. How many potential polyA consensus sequence ‘AATAAA’ sites are there? 8. You found a mutation in this gene (see below). Which part of the gene is the mutation in (exon, intron, 5’ UTR, 3’ UTR)? AGATGCCCTGCTCGCATTGTGGCAGGATAAAGGA_TGAAG AAAGCATATGAAA TGAGGAGTGAATACCAACTCATCGACTCTGCTGCATTGTA CGTTTCCCCTCTTC ATACATCAAGATCTTCTATGATGCGTGCTATTCCCTCCCT ATCACTGCAGCCTA ATGAGTACTTCCCCTTCAGTTTCCTCGATAATGTTCAACG CATCGCTGAGCCTG GATTCCGACCGACTGAGCAAGATATTCTCTTCTCGCGAGT GGCCACAACCGGA GTCGTCGAAGTGAAATTCAAAATCAAGGAACTCGATTTCA G 9. How would this mutation affect the protein sequence?
- 27. Hatan Algow Hong BIOL 360 Sp 2021 10. Using BamHI and PstI, what is the length of the odr-3 genomic DNA fragment will be that will be cut? Can the fragment be cloned into the MCS of pUC19? Hatan Algow Philosophical Review What Is It Like to Be a Bat? Author(s): Thomas Nagel Source: The Philosophical Review, Vol. 83, No. 4 (Oct., 1974), pp. 435-450 Published by: Duke University Press on behalf of Philosophical Review Stable URL: http://www.jstor.org/stable/2183914 . Accessed: 04/02/2014 15:52 Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .
- 28. http://www.jstor.org/page/info/about/policies/terms.jsp . JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact [email protected] . Duke University Press and Philosophical Review are collaborating with JSTOR to digitize, preserve and extend access to The Philosophical Review. http://www.jstor.org This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/action/showPublisher?publisherCode=duke http://www.jstor.org/action/showPublisher?publisherCode=philr eview http://www.jstor.org/stable/2183914?origin=JSTOR-pdf http://www.jstor.org/page/info/about/policies/terms.jsp http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? CONSCIOUSNESS is what makes the mind-body problem really intractable. Perhaps that is why current discussions
- 29. of the problem give it little attention or get it obviously wrong. The recent wave of reductionist euphoria has produced several analyses of mental phenomena and mental concepts designed to explain the possibility of some variety of materialism, psychophys- ical identification, or reduction.' But the problems dealt with are those common to this type of reduction and other types, and what makes the mind-body problem unique, and unlike the water-H20 problem or the Turing machine-IBM machine problem or the lightning-electrical discharge problem or the gene-DNA problem or the oak tree-hydrocarbon problem, is ignored. Every reductionist has his favorite analogy from modern science. It is most unlikely that any of these unrelated examples of successful reduction will shed light on the relation of mind to brain. But philosophers share the general human weakness for explanations of what is incomprehensible in terms suited for what is familiar and well understood, though entirely different. This has led to the acceptance of implausible accounts of the mental largely because they would permit familiar kinds of reduction. I shall try to explain why the usual examples do not 1 Examples are J. J. C. Smart, Philosophy and Scientific Realism (London, i963); David K. Lewis, "An Argument for the Identity Theory," Journal of Philosophy, LXIII (i966), reprinted with addenda in David M. Rosenthal, Materialism & the Mind-Body Problem (Englewood Cliffs, N. J., I971); Hilary Putnam, "Psychological Predicates" in Capitan and Merrill, Art, Mind, & Religion (Pittsburgh, i967), reprinted in Rosenthal, op. cit., as
- 30. "The Nature of Mental States"; D. M. Armstrong, A Materialist Theory of the Mind (London, i968); D. C. Dennett, Content and Consciousness (London, I969). I have ex- pressed earlier doubts in "Armstrong on the Mind," Philosophical Review, LXXIX (1970), 394-403; "Brain Bisection and the Unity of Consciousness," Synthese, 22 (I97I); and a review of Dennett, Journal of Philosophy, LXIX (1972). See also Saul Kripke, "Naming and Necessity" in Davidson and Harman, Semantics of Natural Language (Dordrecht, I972), esp. pp. 334-342; and M. T. Thornton, "Ostensive Terms and Materialism," The Monist, 56 (1972). 435 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL help us to understand the relation between mind and body- why, indeed, we have at present no conception of what an expla- nation of the physical nature of a mental phenomenon would be. Without consciousness the mind-body problem would be much less interesting. With consciousness it seems hopeless. The
- 31. most important and characteristic feature of conscious mental phe- nomena is very poorly understood. Most reductionist theories do not even try to explain it. And careful examination will show that no currently available concept of reduction is applicable to it. Perhaps a new theoretical form can be devised for the purpose, but such a solution, if it exists, lies in the distant intellectual future. Conscious experience is a widespread phenomenon. It occurs at many levels of animal life, though we cannot be sure of its presence in the simpler organisms, and it is very difficult to say in general what provides evidence of it. (Some extremists have been prepared to deny it even of mammals other than man.) No doubt it occurs in countless forms totally unimagi nable to us, on other planets in other solar systems throughout the universe. But no matter how the form may vary, the fact that an organism has conscious experience at all means, basically, that there is something it is like to be that organism. There may be further implications about the form of the experience; there may even (though I doubt it) be implications about the behavior of the organism. But fundamentally an organism has conscious mental states if and only if there is something that it is like to be that organism- something it is like for the organism. We may call this the subjective character of experience. It is not captured by any of the familiar, recently devised reductive analyses of the mental, for all of them are logically compatible with its absence. It is not analyzable in terms of any explanatory system of functional states, or intentional states, since these could
- 32. be ascribed to robots or automata that behaved like people though they experienced nothing.2 It is not analyzable in terms of the causal role of experiences in relation to typical human behavior - 2 Perhaps there could not actually be such robots. Perhaps anything complex enough to behave like a person would have experiences. But that, if true, is a fact which cannot be discovered merely by analyzing the concept of experience. 436 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? for similar reasonsA I do not deny that conscious mental states and events cause behavior, nor that they may be given functional. characterizations. I deny only that this kind of thing exhausts their analysis. Any reductionist program has to to be based on an analysis of what is to be reduced. If the analysis leaves something out, the problem will be falsely posed. It is useless to base the defense of materialism on any analysis of mental phenomena that. fails to deal explicitly with their subjective character. For there is no reason to suppose that a reduction which seems plausible
- 33. when no attempt is made to account for consciousness can be extended to include consciousness. Without some idea, therefore of what the subjective character of experience is, we cannot; know what is required of a physicalist theory. While an account of the physical basis of mind must explain many things, this appears to be the most difficult. It is impossible to exclude the phenomenological features of experience from a, reduction in the same way that one excludes the phenomenal features of an ordinary substance from a physical or chemical reduction of it-namely, by explaining them as effects on the minds of human observers.4 If physicalism is to be defended, the phenomenological features must themselves be given a physical account. But when we examine their subjective character it: seems that such a result is impossible. The reason is that every subjective phenomenon is essentially connected with a single point of view, and it seems inevitable that an objective, physical theory will abandon that point of view. Let me first try to state the issue somewhat more fully than by referring to the relation between the subjective and the objec, tive, or between the pour-soi and the en-soi. This is far from easy. Facts about what it is like to be an X are very peculiar, so peculiar that some may be inclined to doubt their reality, or the signifi. cance of claims about them. To illustrate the connection between 3 It is not equivalent to that about which we are incorrigible, both because we are not incorrigible about experience and because experience is present in
- 34. animals lacking language and thought, who have no beliefs at all about their experiences. 4Cf. Richard Rorty, "Mind-Body Identity, Privacy, and Categories," The Review of Metaphysics, XIX (i965), esp. 37-38. 437 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL subjectivity and a point of view, and to make evident the impor - tance of subjective features, it will help to explore the matter in relation to an example that brings out clearly the divergence between the two types of conception, subjective and objective. I assume we all believe that bats have experience. After all, they are mammals, and there is no more doubt that they have experience than that mice or pigeons or whales have experience. I have chosen bats instead of wasps or flounders because if one travels too far down the phylogenetic tree, people gradually shed their faith that there is experience there at all. Bats, although more closely related to us than those other species, nevertheless present a range of activity and a sensory apparatus so different from ours
- 35. that the problem I want to pose is exceptionally vivid (though it certainly could be raised with other species). Even without the benefit of philosophical reflection, anyone who has spent some time in an enclosed space with an excited bat knows what it is to encounter a fundamentally alien form of life. I have said that the essence of the belief that bats have expe - rience is that there is something that it is like to be a bat. Now we know that most bats (the microchiroptera, to be precise) perceive the external world primarily by sonar, or echolocation, detecting the reflections, from objects within range, of their own rapid, subtly modulated, high-frequency shrieks. Their brains are designed to correlate the outgoing impulses with the subsequent echoes, and the information thus acquired enables bats to make precise discriminations of distance, size, shape, motion, and texture comparable to those we make by vision. But bat sonar, though clearly a form of perception, is not similar in its operation to any sense that we possess, and there is no reason to suppose that it is subjectively like anything we can experience or imagine. This appears to create difficulties for the notion of what it is like to be a bat. We must consider whether any method will permit us to extrapolate to the inner life of the bat from our own case,5 and if not, what alternative methods there may be for under- standing the notion. 5 By "our own case" I do not mean just "my own case," but rather the mentalistic ideas that we apply unproblematically to ourselves and other human beings.
- 36. 438 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? Our own experience provides the basic material for our imag- ination, whose range is therefore limited. It will not help to try to imagine that one has webbing on one's arms, which enables one to fly around at dusk and dawn catching insects in one's mouth; that one has very poor vision, and perceives the sur - rounding world by a system of reflected high-frequency sound signals; and that one spends the day hanging upside down by one's feet in an attic. In so far as I can imagine this (which is not very far), it tells me only what it would be like for me to behave as a bat behaves. But that is not the question. I want to know what it is like for a bat to be a bat. Yet if I try to imagine this, I am restricted to the resources of my own mind, and those re- sources are inadequate to the task. I cannot perform it either by imagining additions to my present experience, or by imagining segments gradually subtracted from it, or by imagining some combination of additions, subtractions, and modifications. To the extent that I could look and behave like a wasp or a bat without changing my fundamental structure, my experiences would not be anything like the experiences of those animals. On the other hand, it is doubtful that any meaning can be attached to the supposition that I should possess the internal neurophysio-
- 37. logical constitution of a bat. Even if I could by gradual degrees be transformed into a bat, nothing in my present constitution enables me to imagine what the experiences of such a future stage of myself thus metamorphosed would be like. The best evidence would come from the experiences of bats, if we only knew what they were like. So if extrapolation from our own case is involved in the idea of what it is like to be a bat, the extrapolation must be incomple- table. We cannot form more than a schematic conception of what it is like. For example, we may ascribe general types of experience on the basis of the animal's structure and behavior. Thus we describe bat sonar as a form of three-dimensional forward per- ception; we believe that bats feel some versions of pain, fear, hunger, and lust, and that they have other, more familiar types of perception besides sonar. But we believe that these experiences also have in each case a specific subjective character, which it is beyond our ability to conceive. And if there is conscious life else- 439 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL
- 38. where in the universe, it is likely that some of it will not be de- scribable even in the most general experiential terms available to us.6 (The problem is not confined to exotic cases, however, for it exists between one person and another. The subjective character of the experience of a person deaf and blind from birth is not accessible to me, for example, nor presumably is mine to him. This does not prevent us each from believing that the other's experience has such a subjective character.) If anyone is inclined to deny that we can believe in the exis- tence of facts like this whose exact nature we cannot possibly conceive, he should reflect that in contemplating the bats we are in much the same position that intelligent bats or Martians7 would occupy if they tried to form a conception of what it was like to be us. The structure of their own minds might make it impossible for them to succeed, but we know they would be wrong to conclude that there is not anything precise that it is like to be us: that only certain general types of mental state could be ,ascribed to us (perhaps perception and appetite would be concepts common to us both; perhaps not). We know they would be wrong to draw such a skeptical conclusion because we know what it is like to be us. And we know that while it includes an enormous amount of variation and complexity, and while we do not possess the vocabulary to describe it adequately, its subjective charater is highly specific, and in some respects describable in terms that can be understood only by creatures like us. The fact that we cannot expect ever to accommodate in our language a detailed descrip- tion of Martian or bat phenomenology should not lead us to
- 39. dismiss as meaningless the claim that bats and Martians have experiences fully comparable in richness of detail to our own. It would be fine if someone were to develop concepts and a theory that enabled us to think about those things; but such an under- standing may be permanently denied to us by the limits of our nature. And to deny the reality or logical significance of what 6 Therefore the analogical form of the English expression "what it is like" is misleading. It does not mean "what (in our experience) it resembles," but rather "how it is for the subject himself." Any intelligent extraterrestrial beings totally different from us. 440 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? we can never describe or understand is the crudest form of cogni- tive dissonance. This brings us to the edge of a topic that requires much more discussion than I can give it here: namely, the relation between facts on the one hand and conceptual schemes or systems of repre- sentation on the other. My realism about the subjective domain in all its forms implies a belief in the existence of facts beyond
- 40. the reach of human concepts. Certainly it is possible for a human being to believe that there are facts which humans never will possess the requisite concepts to represent or comprehend. Indeed, it would be foolish to doubt this, given the finiteness of humanity's expectations. After all, there would have been transfinite numbers even if everyone had been wiped out by the Black Death before Cantor discovered them. But one might also believe that there are facts which could not ever be represented or comprehended by human beings, even if the species lasted forever-simply because our structure does not permit us to operate with concepts of the requisite type. This impossibility might even be observed by other beings, but it is not clear that the existence of such beings, or the possibility of their existence, is a precondition of the significance of the hypothesis that there are humanly inaccessible facts. (After all, the nature of beings with access to humanly inaccessible facts is presumably itself a humanly inaccessible fact.) Reflection on what it is like to be a bat seems to lead us, therefore, to the conclusion that there are facts that do not consist in the truth of propositions expressible in a human language. We can be compelled to recognize the existence of such facts without being able to state or comprehend them. I shall not pursue this subject, however. Its bearing on the topic before us (namely, the mind-body problem) is that it enables us to make a general observation about the subjective character
- 41. of experience. Whatever may be the status of facts about what it is like to be a human being, or a bat, or a Martian, these appear to be facts that embody a particular point of view. I am not adverting here to the alleged privacy of experience to its possessor. The point of view in question is not one accessi- ble only to a single individual. Rather it is a type. It is often possible to take up a point of view other than one's own, so the 44I This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL comprehension of such facts is not limited to one's own case. There is a sense in which phenomenological facts are perfectly objective: one person can know or say of another w hat the quality of the other's experience is. They are subjective, however, in the sense that even this objective ascription of experience is possible only for someone sufficiently similar to the object of ascription to be able to adopt his point of view-to understand the ascrip- tion in the first person as well as in the third, so to speak. The more different from oneself the other experiencer is, the less success one can expect with this enterprise. In our own case we occupy the relevant point of view, but we will have as much
- 42. difficulty understanding our own experience properly if we approach it from another point of view as we would if we tried to understand the experience of another species without taking up its point of view.8 This bears directly on the mind-body problem. For if the facts of experience-facts about what it is like for the experiencing organism-are accessible only from one point of view, then it is a mystery how the true character of experiences could be revealed in the physical operation of that organism. The latter is a domain of objective facts par excellence-the kind that can be observed and understood from many points of view and by individuals with differing perceptual systems. There are no comparable imaginative obstacles to the acquisition of knowledge about bat neurophysiol- ogy by human scientists, and intelligent bats or Martians might learn more about the human brain than we ever will. 8 It may be easier than I suppose to transcend inter-species barriers with the aid of the imagination. For example, blind people are able to detect objects near them by a form of sonar, using vocal clicks or taps of a cane. Perhaps if one knew what that was like, one could by extension imagine roughly what it was like to possess the much more refined sonar of a bat. The distance between oneself and other persons and other species can fall anywhere on a continuum. Even for other persons the understanding of what it is like to be them is only
- 43. partial, and when one moves to species very different from oneself, a lesser degree of partial understanding may still be available. The imagination is remarkably flexible. My point, however, is not that we cannot know what it is like to be a bat. I am not raising that epistemological problem. My point is rather that even to form a conception of what it is like to be a bat (and a fortiori to know what it is like to be a bat) one must take up the bat's point of view. If one can take it up roughly, or partially, then one's conception will also be rough or partial. Or so it seems in our present state of understanding. 442 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? This is not by itself an argument against reduction. A Martian scientist with no understanding of visual perception could under- stand the rainbow, or lightning, or clouds as physical phenomena, though he would never be able to understand the human con- cepts of rainbow, lightning, or cloud, or the place these things occupy in our phenomenal world. The objective nature of the
- 44. things picked out by these concepts could be apprehended by him because, although the concepts themselves are connected with a particular point of view and a particular visual phenome- nology, the things apprehended from that point of view are not: they are observable from the point of view but external to it; hence they can be comprehended from other points of view also, either by the same organisms or by others. Lightning has an objective character that is not exhausted by its visual appearance, and this can be investigated by a Martian without vision. To be precise, it has a more objective character than is revealed in its visual appearance. In speaking of the move from subjective to objective characterization, I wish to remain noncommittal about the existence of an end point, the completely objective intrinsic nature of the thing, which one might or might not be able to reach. It may be more accurate to think of objectivity as a direc - tion in which the understanding can travel. And in understanding a phenomenon like lightning, it is legitimate to go as far away as one can from a strictly human viewpoint.9 In the case of experience, on the other hand, the connection with a particular point of view seems much closer. It is difficult to understand what could be meant by the objective character of an experience, apart from the particular point of view from which its subject apprehends it. After all, what would be left of what it was like to be a bat if one removed the viewpoint of the bat? But if experience does not have, in addition to its subjective character, an objective nature that can be apprehended from I The problem I am going to raise can therefore be posed even if the distinc- tion between more subjective and more objective descriptions or viewpoints
- 45. can itself be made only within a larger human point of view. I do not accept this kind of conceptual relativism, but it need not be refuted to make the point that psychophysical reduction cannot be accommodated by the subjective-to- objective model familiar from other cases. 443 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL many different points of view, then how can it be supposed that a Martian investigating my brain might be observing physical processes which were my mental processes (as he might observe physical processes which were bolts of lightning), only from a different point of view? How, for that matter, could a human physiologist observe them from another point of view?1o We appear to be faced with a general difficulty about psycho- physical reduction. In other areas the process of reduction is a move in the direction of greater objectivity, toward a more accu- rate view of the real nature of things. This is accomplished by reducing our dependence on individual or species-specific points of view toward the object of investigation. We describe it not in terms of the impressions it makes on our senses, but in terms of its more general effects and of properties detectable by means
- 46. other than the human senses. The less it depends on a specifically human viewpoint, the more objective is our description. It is possible to follow this path because although the concepts and ideas we employ in thinking about the external world are initially applied from a point of view that involves our perceptual appa - ratus, they are used by us to refer to things beyond themselves- toward which we have the phenomenal point of view. Therefore we can abandon it in favor of another, and still be thinking about the same things. Experience itself, however, does not seem to fit the pattern. The idea of moving from appearance to reality seems to make no sense here. What is the analogue in this case to pursuing a more objective understanding of the same phenomena by abandoning the initial subjective viewpoint toward them in favor of another that is more objective but concerns the same thing? Certainly it appears unlikely that we will get closer to the real nature of human experience by leaving behind the particularity of our human point of view and striving for a description in terms accessible to beings that could not imagine what it was like to be us. If the subjective character of experience is fully comprehensible only from one 10 The problem is not just that when I look at the "Mona Lisa," my visual experience has a certain quality, no trace of which is to be found by someone looking into my brain. For even if he did observe there a tiny image of the
- 47. "Mona Lisa," he would have no reason to identify it with the experience. 444 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? point of view, then any shift to greater objectivity -that is, less attachment to a specific viewpoint-does not take us nearer to the real nature of the phenomenon: it takes us farther away from it. In a sense, the seeds of this objection to the reducibility of experience are already detectable in successful cases of reduction; for in discovering sound to be, in reality, a wave phenomenon in air or other media, we leave behind one viewpoint to take up another, and the auditory, human or animal viewpoint that we leave behind remains unreduced. Members of radically different species may both understand the same physical events in objec- tive terms, and this does not require that they understand the phenomenal forms in which those events appear to the senses of members of the other species. Thus it is a condition of their refer- ring to a common reality that their more particular viewpoints are not part of the common reality that they both apprehend. The reduction can succeed only if the species-specific viewpoint is omitted from what is to be reduced.
- 48. But while we are right to leave this point of view aside in seeking a fuller understanding of the external world, we cannot ignore it permanently, since it is the essence of the internal world, and not merely a point of view on it. Most of the neobehaviorism of recent philosophical psychology results from the effort to sub- stitute an objective concept of mind for the real thing, in order to have nothing left over which cannot be reduced. If we acknowl- edge that a physical theory of mind must account for the sub- jective character of experience, we must admit that no presently available conception gives us a clue how this could be done. The problem is unique. If mental processes are indeed physical processes, then there is something it is like, intrinsically," to 11 The relation would therefore not be a contingent one, like that of a cause and its distinct effect. It would be necessarily true that a certain physical state felt a certain way. Saul Kripke (op. cit.) argues that causal behaviorist and related analyses of the mental fail because they construe, e.g., "pain" as a merely contingent name of pains. The subjective character of an experience ("its immediate phenomenological quality" Kripke calls it [p. 340]) is the essential property left out by such analyses, and the one in virtue of which it is, necessarily, the experience it is. My view is closely related to his. Like Kripke, I find the hypothesis that a certain brain state should necessarily have
- 49. 445 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL undergo certain physical processes. What it is for such a thing to be the case remains a mystery. What moral should be drawn from these reflections, and what should be done next? It would be a mistake to conclude that physicalism must be false. Nothing is proved by the inadequacy of physicalist hypotheses that assume a faulty objective analysis of mind. It would be truer to say that physicalism is a position we cannot understand because we do not at present have any conception of how it might be true. Perhaps it will be thought unreasonable to require such a conception as a condition of understanding. After all, it might be said, the meaning of physicalism is clear enough: mental states are states of the body; mental events are physical events. We do not know which physical states and events they are, but that should not prevent us from a certain subjective character incomprehensible without further explanation. No such explanation emerges from theories which view the mind-brain relation as contingent, but perhaps there are other alternatives,
- 50. not yet discovered. A theory that explained how the mind-brain relation was necessary would still leave us with Kripke's problem of explaining why it nevertheless appears contingent. That difficulty seems to me surmountable, in the following way. We may imagine something by representing it to ourselves either perceptually, sympathetically, or symbolically. I shall not try to say how symbolic imagina- tion works, but part of what happens in the other two cases is this. To imagine something perceptually, we put ourselves in a conscious state resembling the state we would be in if we perceived it. To imagine something sympathetically, we put ourselves in a conscious state resembling the thing itself. (This method can be used only to imagine mental events and states-our own or another's.) When we try to imagine a mental state occurring without its associated brain state, we first sympathetically imagine the occurrence of the mental state: that is, we put ourselves into a state that resembles it mentally. At the same time, we attempt to perceptually imagine the non-occurrence of the associated physical state, by putting ourselves into another state unconnected with the first: one resembling that which we would be in if we perceived the non- occurrence of the physical state. Where the imagination of
- 51. physical features is perceptual and the imagination of mental features is sympathetic, it appears to us that we can imagine any experience occurring without its associated brain state, and vice versa. The relation between them will appear contingent even if it is necessary, because of the independence of the disparate types of imagination. (Solipsism, incidentally, results if one misinterprets sympathetic imagination as if it worked like perceptual imagination: it then seems impossible to imagine any experience that is not one's own.) 446 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? understanding the hypothesis. What could be clearer than the words "is" and "are"? But I believe it is precisely this apparent clarity of the word "is" that is deceptive. Usually, when we are told that X is r we know how it is supposed to be true, but that depends on a concep- tual or theoretical background and is not conveyed by the "is"
- 52. alone. We know how both "X" and "r" refer, and the kinds of things to which they refer, and we have a rough idea how the two referential paths might converge on a single thing, be it an object, a person, a process, an event, or whatever. But when the two terms of the identification are very disparate it may not be so clear how it could be true. We may not have even a rough idea of how the two referential paths could converge, or what kind of things they might converge on, and a theoretical framework may have to be supplied to enable us to understand this. Without the framework, an air of mysticism surrounds the identification. This explains the magical flavor of popular presentations of fundamental scientific discoveries, given out as propositions to which one must subscribe without really understanding them. For example, people are now told at an early age that all matter is really energy. But despite the fact that they know what "is" means, most of them never form a conception of what makes this claim true, because they lack the theoretical background. At the present time the status of physicalism is similar to that which the hypothesis that matter is energy would have had if uttered by a pre-Socratic philosopher. We do not have the be- ginnings of a conception of how it might be true. In order to understand the hypothesis that a mental event is a physical event, we require more than an understanding of the word "is." The idea of how a mental and a physical term might refer to the same thing is lacking, and the usual analogies with theoretical iden-
- 53. tification in other fields fail to supply it. They fail because if we construe the reference of mental terms to physical events on the usual model, we either get a reappearance of separate subjective events as the effects through which mental reference to physical events is secured, or else we get a false account of how mental terms refer (for example, a causal behaviorist one). Strangely enough, we may have evidence for the truth of some- 447 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL thing we cannot really understand. Suppose a caterpillar is locked in a sterile safe by someone unfamiliar with insect metamorphosis, and weeks later the safe is reopened, revealing a butterfly. If the person knows that the safe has been shut the whole time, he has reason to believe that the butterfly is or was once the caterpillar, without having any idea in what sense this might be so. (One possibility is that the caterpillar contained a tiny winged parasite that devoured it and grew into the butterfly.) It is conceivable that we are in such a position with regard to
- 54. physicalism. Donald Davidson has argued that if mental events have physical causes and effects, they must have physical de- scriptions. He holds that we have reason to believe this even though we do not-and in fact could not-have a general psychophysical theory.12 His argument applies to intentional mental events, but I think we also have some reason to believe that sensations are physical processes, without being in a position to understand how. Davidson's position is that certain physical events have irreduc- ibly mental properties, and perhaps some view describable in this way is correct. But nothing of which we can now form a con- ception corresponds to it; nor have we any idea what a theory would be like that enabled us to conceive of it.13 Very little work has been done on the basic question (from which mention of the brain can be entirely omitted) whether any sense can be made of experiences' having an objective character at all. Does it make sense, in other words, to ask what my experi- ences are really like, as opposed to how they appear to me? We cannot genuinely understand the hypothesis that their nature is captured in a physical description unless we understand the more fundamental idea that they have an objective nature (or that ob- jective processes can have a subjective nature).14 12 See "Mental Events" in Foster and Swanson, Experience and Theory (Amherst, 1970); though I don't understand the argument against psychophysical laws. 13 Similar remarks apply to my paper "Physicalism," Philosophical Review LXXIV (i965), 339-356, reprinted with postscript in John
- 55. O'Connor, Modern Materialism (New York, I969). 14 This question also lies at the heart of the problem of other minds, whose close connection with the mind-body problem is often overlooked. If one understood how subjective experience could have an objective nature, one would understand the existence of subjects other than oneself. 448 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp WHAT IS IT LIKE TO BE A BAT? I should like to close with a speculative proposal. It may be possible to approach the gap between subjective and obj ective from another direction. Setting aside temporarily the relation between the mind and the brain, we can pursue a more objective understanding of the mental in its own right. At present we are completely unequipped to think about the subjective character of experience without relying on the imagination-without taking up the point of view of the experiential subject. This should be regarded as a challenge to form new concepts and devise a new method-an objective phenomenology not dependent on em- pathy or the imagination. Though presumably it would not cap- ture everything, its goal would be to describe, at least in part, the subjective character of experiences in a form comprehensible to
- 56. beings incapable of having those experiences. We would have to develop such a phenomenology to describe the sonar experiences of bats; but it would also be possible to begin with humans. One might try, for example, to develop con- cepts that could be used to explain to a person blind from birth what it was like to see. One would reach a blank wall eventually, but it should be possible to devise a method of expressing in ob- jective terms much more than we can at present, and with much greater precision. The loose intermodal analogies-for example, "Red is like the sound of a trumpet"-which crop up in dis- cussions of this subject are of little use. That should be clear to anyone who has both heard a trumpet and seen red. But struc- tural features of perception might be more accessible to objective description, even though something would be left out. And con- cepts alternative to those we learn in the first person may enable us to arrive at a kind of understanding even of our own experience which is denied us by the very ease of description and lack of distance that subjective concepts afford. Apart from its own interest, a phenomenology that is in this sense objective may permit questions about the physical15 basis 15 I have not defined the term "physical." Obviously it does not apply just to what can be described by the concepts of contemporary physics, since we expect further developments. Some may think there is nothing to prevent mental phenomena from eventually being recognized as physical in their own right. But whatever else may be said of the physical, it has to be objective. So
- 57. 449 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jsp THOMAS NAGEL of experience to assume a more intelligible form. Aspects of sub- jective experience that admitted this kind of objective description might be better candidates for objective explanations of a more familiar sort. But whether or not this guess is correct, it seems unlikely that any physical theory of mind can be contemplated until more thought has been given to the general problem of sub- jective and objective. Otherwise we cannot even pose the mind- body problem without sidestepping it.16 THOMAS NAGEL Princeton University if our idea of the physical ever expands to include mental phenomena, it will have to assign them an objective character-whether or not this is done by analyzing them in terms of other phenomena already regarded as physical. It seems to me more likely, however, that mental-physical relations will
- 58. eventually be expressed in a theory whose fundamental terms cannot be placed clearly in either category. 16 I have read versions of this paper to a number of audiences, and am indebted to many people for their comments. 450 This content downloaded from 137.205.50.42 on Tue, 4 Feb 2014 15:52:33 PM All use subject to JSTOR Terms and Conditions http://www.jstor.org/page/info/about/policies/terms.jspArticle Contentsp. 435p. 436p. 437p. 438p. 439p. 440p. 441p. 442p. 443p. 444p. 445p. 446p. 447p. 448p. 449p. 450Issue Table of ContentsThe Philosophical Review, Vol. 83, No. 4 (Oct., 1974), pp. 433-569Front Matter [pp. 433-434]What Is It Like to Be a Bat? [pp. 435-450]Volition and Basic Action [pp. 451- 473]Aristotle's Introduction of Matter [pp. 474- 500]DiscussionA Note on Wittgenstein and Heidegger [pp. 501- 503]More Light on the Later Mill [pp. 504-527]Book ReviewsReview: untitled [pp. 528-533]Review: untitled [pp. 533-536]Review: untitled [pp. 536-540]Review: untitled [pp. 540-544]Review: untitled [pp. 544-547]Review: untitled [pp. 547-548]Review: untitled [pp. 548-551]Review: untitled [pp. 551-553]Review: untitled [pp. 553-555]Review: untitled [pp. 556-560]Books Received [pp. 561-569]Back Matter Where Am I? Daniel C. Dennett
- 59. Now that I’ve won my suit under the Freedom of Information Act, I am at liberty to reveal for the first time a curious episode in my life that may be of interest not only to those engaged in research in the philosophy of mind, artificial intelligence, and neuroscience but also to the general public. Several years ago I was approached by Pentagon officials who asked me to volunteer for a highly dangerous and secret mission. In collaboration with NASA and Howard Hughes, the Department of Defense was spending billions to develop a Supersonic Tunneling Underground Device, or STUD. It was supposed to tunnel through the earth’s core at great speed and deliver a specially designed atomic warhead “right up the Red’s missile silos,” as one of the Pentagon brass put it. The problem was that in an early test they had succeeded in lodging a warhead about a mile deep under Tulsa, Oklahoma, and they wanted me to retrieve it for them. “Why me?” I asked. Well, the mission involved some pioneering applications of current brain research, and they had heard of my interest in brains and of course my Faustian curiosity and great courage and so forth … . Well,
- 60. how could I refuse? The difficulty that brought the Pentagon to my door was that the device I’d been asked to recover was fiercely radioactive, in a new way. According to monitoring instruments, something about the nature of the device and its complex interactions with pockets of material deep in the earth had produced radiation that could cause severe abnormalities in certain tissues of the brain. No way had been found to shield the brain from these deadly rays, which were apparently harmless to other tissues and organs of the body. So it had been decided that the person sent to recover the device should leave his brain behind. It would be kept in a safe place as there it could execute its normal control functions by elaborate radio links. Would I submit to a surgical procedure that would completely remove my brain, which would then be placed in a life-support system at the Manned Spacecraft Center in Houston? Each input and output pathway, as it was severed, would be restored by a pair of microminiaturized radio transceivers, one attached precisely to the brain, the other to the nerve stumps in the empty cranium. No information would be lost, all
- 61. the connectivity would be preserved. At first I was a bit reluctant. Would it really work? The Houston brain surgeons encouraged me. “Think of it,” they said, “as a mere stretching of the nerves. If your brain were just moved over an inch in your skull, that would not alter or impair your mind. We’re simply going to make the nerves indefinitely elastic by splicing radio links into them.” I was shown around the life-support lab in Houston and saw the sparkling new vat in which my brain would be placed, were I to agree. I met the large and brilliant support team of neurologists, hematologists, biophysicists, and electrical engineers, and after several days of discussions and demonstrations I agreed to give it a try. I was subjected to an enormous array of blood tests, brain scans, experiments, interviews, and the like. They took down my autobiography at great length, recorded tedious lists of my beliefs, hopes, fears, and tastes. They even listed my favorite stereo recordings and gave me a crash session of psychoanalysis. The day for surgery arrived at last and of course I was anesthetized and remember nothing of the operation itself. When I came out of anesthesia, I opened my
- 62. eyes, looked around, and asked the inevitable, the traditional, the lamentably hackneyed postoperative question: “Where am l?” The nurse smiled down at me. “You’re in Houston,” she said, and I reflected that this still had a good chance of being the truth one way or another. She handed me a mirror. Sure enough, there were the tiny antennae poling up through their titanium ports cemented into my skull. “I gather the operation was a success,” I said. “I want to go see my brain.” They led me (I was a bit dizzy and unsteady) down a long corridor and into the life- support lab. A cheer went up from the assembled support team, and I responded with what I hoped was a jaunty salute. Still feeling lightheaded, I was helped over to the life-support vat. I peered through the glass. There, floating in what looked like ginger ale, was undeniably a human brain, though it was almost covered with printed circuit chips, plastic tubules, electrodes, and other paraphernalia. “Is that mine?” I asked. “Hit the output transmitter switch there on the side of the vat and see for yourself,” the project 1
- 63. director replied. I moved the switch to OFF, and immediately slumped, groggy and nauseated, into the arms of the technicians, one of whom kindly restored the switch to its ON position. While I recovered my equilibrium and composure, I thought to myself: “Well, here I am sitting on a folding chair, staring through a piece of plate glass at my own brain … But wait,” I said to myself, “shouldn’t I have thought, ‘Here I am, suspended in a bubbling fluid, being stared at by my own eyes’?” I tried to think this latter thought. I tried to project it into the tank, offering it hopefully to my brain, but I failed to carry off the exercise with any conviction. I tried again. “Here am I, Daniel Dennett, suspended in a bubbling fluid, being stared at by my own eyes.” No, it just didn’t work. Most puzzling and confusing. Being a philosopher of firm physicalist conviction, I believed un- swervingly that the tokening of my thoughts was occurring somewhere in my brain: yet, when I thought “Here I am,” where the thought occurred to me was here, outside the vat, where I, Dennett,
- 64. was standing staring at my brain. I tried and tried to think myself into the vat, but to no avail. I tried to build up to the task by doing mental exercises. I thought to myself, “The sun is shining over there,” five times in rapid succession, each time mentally ostending a different place: in order, the sunlit corner of the lab, the visible front lawn of the hospital, Houston, Mars, and Jupiter. I found I had little difficulty in getting my “there”s to hop all over the celestial map with their proper references. I could loft a “there” in an instant through the farthest reaches of space, and then aim the next “there” with pinpoint accuracy at the upper left quadrant of a freckle on my arm. Why was I having such trouble with “here”? “Here in Houston” worked well enough, and so did “here in the lab,” and even “here in this part of the lab,” but “here in the vat” always seemed merely an unmeant mental mouthing. I tried closing my eyes while thinking it. This seemed to help, but still I couldn’t manage to pull it off, except perhaps for a fleeting instant. I couldn’t be sure. The discovery that I couldn’t be sure was also unsettling. How did I know where I meant by “here” when I
- 65. thought “here”? Could I think I meant one place when in fact I meant another? I didn’t see how that could be admitted without untying the few bonds of intimacy between a person and his own mental life that had survived the onslaught of the brain scientists and philosophers, the physicalists and behaviorists. Perhaps I was incorrigible about where I meant when I said “here.” But in my present circumstances it seemed that either I was doomed by sheer force of mental habit to thinking systematically false indexical thoughts, or where a person is (and hence where his thoughts are tokened for purposes of semantic analysis) is not necessarily where his brain, the physical seat of his soul, resides. Nagged by confusion, I attempted to orient myself by falling back on a favorite philosopher’s ploy. I began naming things. “Yorick,” I said aloud to my brain, “you are my brain. The rest of my body, seated in this chair, I dub ‘Hamlet.’” So here we all are: Yorick’s my brain, Hamlet’s my body, and I am Dennett. Now, where am I? And when I think “where am I?”, where’s that thought tokened? Is it tokened in my
- 66. brain, lounging about in the vat, or right here between my ears where it seems to be tokened? Or nowhere? Its temporal coordinates give me no trouble; must it not have spatial coordinates as well? I began making a list of the alternatives. 1. Where Hamlet goes there goes Dennett. This principle was easily refuted by appeal to the familiar brain-transplant thought experiments so enjoyed by philosophers. If Tom and Dick switch brains, Tom is the fellow with Dick’s former body—just ask him; he’ll claim to be Tom and tell you the most intimate details of Tom’s autobiography. It was clear enough, then, that my current body and I could part company, but not likely that I could be separated from my brain. The rule of thumb that emerged so plainly from the thought experiments was that in a brain-transplant operation, one wanted to be the donor not the recipient. Better to call such an operation a body transplant, in fact. So perhaps the truth was, 2. Where Yorick goes there goes Dennett. This was not at all appealing, however. How could I be in the vat and not about to go anywhere, when I was so
- 67. obviously outside the vat looking in and beginning to make guilty plans to return to my room for a substantial lunch? This begged the 2 question I realized, but it still seemed to be getting at something important. Casting about for some support for my intuition, I hit upon a legalistic sort of argument that might have appealed to Locke. Suppose, I argued to myself, I were now to fly to California, rob a bank, and be apprehended. In which state would I be tried: in California, where the robbery took place, or in Texas, where the brains of the outfit were located? Would I be a California felon with an out-of-state brain, or a Texas felon remotely controlling an accomplice of sorts in California? It seemed possible that I might beat such a rap just on the undecidability of that jurisdictional question, though perhaps it would be deemed an interstate, and hence Federal, offense. In any event, suppose I were convicted. Was it likely that California would be satisfied to throw Hamlet into the brig, knowing that Yorick was
- 68. living the good life and luxuriously taking the waters in Texas? Would Texas incarcerate Yorick, leaving Hamlet free to take the next boat to Rio? This alternative appealed to me. Barring capital punishment or other cruel and unusual punishment, the state would be obliged to maintain the life- support system for Yorick though they might move him from Houston to Leavenworth, and aside from the unpleasantness of the opprobrium, I, for one, would not mind at all and would consider myself a free man under those circumstances. If the state has an interest in forcibly relocating persons in institutions, it would fail to relocate me in any institution by locating Yorick there. If this were true, it suggested a third alternative. 3. Dennett is wherever he thinks he is. Generalized, the claim was as follows: At any given time a person has a point of view and the location of the point of view (which is determined internally by the content of the point of view) is also the location of the person. Such a proposition is not without its perplexities, but to me it seemed a step in the right direction. The only trouble was that it seemed to place one in a
- 69. heads-I-win/tails-you-lose situation of unlikely infallibility as regards location. Hadn’t I myself often been wrong about where I was, and at least as often uncertain? Couldn’t one get lost? Of course, but getting lost geographically is not the only way one might get lost. If one were lost in the woods one could attempt to reassure oneself with the consolation that at least one knew where one was: one was right here in the familiar surroundings of one’s own body. Perhaps in this case one would not have drawn one’s attention to much to be thankful for. Still, there were worse plights imaginable, and I wasn’t sure I wasn’t in such a plight right now. Point of view clearly had something to do with personal location, but it was itself an unclear notion. It was obvious that the content of one’s point of view was not the same as or determined by the content of one’s beliefs or thoughts. For example, what should we say about the point of view of the Cinerama viewer who shrieks and twists in his seat as the roller-coaster footage overcomes his psychic distancing? Has he forgotten that he is safely seated in the theater? Here I was inclined to
- 70. say that the person is experiencing an illusory shift in point of view. In other cases, my inclination to call such shifts illusory was less strong. The workers in laboratories and plants who handle dangerous materials by operating feedback-controlled mechanical arms and hands undergo a shift in point of view that is crisper and more pronounced than anything Cinerama can provoke. They can feel the heft and slipperiness of the containers they manipulate with their metal fingers. They know perfectly well where they are and are not fooled into false beliefs by the experience, yet it is as if they were inside the isolation chamber they are peering into. With mental effort, they can manage to shift their point of view back and forth, rather like making a transparent Necker cube or an Escher drawing change orientation before one’s eyes. It does seem extravagant to suppose that in per- forming this bit of mental gymnastics, they are transporting themselves back and forth. Still their example gave me hope. If I was in fact in the vat in spite of my intuitions, I might be able to train myself to adopt that point of view even as a matter of habit. I should dwell on images
- 71. of myself comfortably floating in my vat, beaming volitions to that familiar body out there. I reflected that the ease or difficulty of this task was presumably independent of the truth about the location of one’s brain. Had I been practicing before the operation, I might now be finding it second nature. You might now yourself try such a trompe l’oeil. Imagine you have written an inflam- matory letter which has been published in the Times, the result of which is that the government has 3 chosen to impound your brain for a probationary period of three years in its Dangerous Brain Clinic in Bethesda, Maryland. Your body of course is allowed freedom to earn a salary and thus to continue its function of laying up income to be taxed. At this moment, however, your body is seated in an auditorium listening to a peculiar account by Daniel Dennett of his own similar experience. Try it. Think yourself to Bethesda, and then hark back longingly to your body, far away, and yet seeming so near. It is only with long-distance restraint (yours?
- 72. the government’s?) that you can control your impulse to get those hands clapping in polite applause before navigating the old body to the rest room and a well-deserved glass of evening sherry in the lounge. The task of imagination is certainly difficult, but if you achieve your goal the results might be consoling. Anyway, there I was in Houston, lost in thought as one might say, but not for long. My specu- lations were soon interrupted by the Houston doctors, who wished to test out my new prosthetic nervous system before sending me off on my hazardous mission. As I mentioned before, I was a bit dizzy at first, and not surprisingly, although I soon habituated myself to my new circumstances (which were, after all, well nigh indistinguishable from my old circumstances). My accommodation was not perfect, however, and to this day I continue to be plagued by minor coordination difficul- ties. The speed of light is fast, but finite, and as my brain and body move farther and farther apart, the delicate interaction of my feedback systems is thrown into disarray by the time lags. Just as one is rendered close to speechless by a delayed or echoic hearing
- 73. of one’s speaking voice so, for instance, I am virtually unable to track a moving object with my eyes whenever my brain and my body are more than a few miles apart. In most matters my impairment is scarcely detectable, though I can no longer hit a slow curve ball with the authority of yore. There are some compensations of course. Though liquor tastes as good as ever, and warms my gullet while corroding my liver, I can drink it in any quantity I please, without becoming the slightest bit inebriated, a curiosity some of my close friends may have noticed (though I occasionally have feigned inebriation, so as not to draw attention to my unusual circumstances). For similar reasons, I take aspirin orally for a sprained wrist, but if the pain persists I ask Houston to administer codeine to me in vitro. In times of illness the phone bill can be staggering. But to return to my adventure. At length, both the doctors and I were satisfied that I was ready to undertake my subterranean mission. And so I left my brain in Houston and headed by helicopter for Tulsa. Well, in any case, that’s the way it seemed to me. That’s how I would put it, just off the
- 74. top of my head as it were. On the trip I reflected further about my earlier anxieties and decided that my first postoperative speculations had been tinged with panic. The matter was not nearly as strange or metaphysical as I had been supposing. Where was I? In two places, clearly: both inside the vat and outside it. Just as one can stand with one foot in Connecticut and the other in Rhode Island, I was in two places at once. I had become one of those scattered individuals we used to hear so much about. The more I considered this answer, the more obviously true it appeared. But, strange to say, the more true it appeared, the less important the question to which it could be the true answer seemed. A sad, but not unprecedented, fate for a philosophical question to suffer. This answer did not completely satisfy me, of course. There lingered some question to which I should have liked an answer, which was neither “Where are all my various and sundry parts?” nor “What is my current point of view?” Or at least there seemed to be such a question. For it did seem undeniable that in some sense I and not merely most of me was descending into the earth under Tulsa in search of an
- 75. atomic warhead. When I found the warhead, I was certainly glad I had left my brain behind, for the pointer on the specially built Geiger counter I had brought with me was off the dial. I called Houston on my ordinary radio and told the operation control center of my position and my progress. In return, they gave me instructions for dismantling the vehicle, based upon my on-site observations. I had set to work with my cutting torch when all of a sudden a terrible thing happened. I went stone deaf. At first I thought it was only my radio earphones that had broken, but when I tapped on my helmet, I heard nothing. Apparently the auditory transceivers had gone on the fritz. I could no longer hear Houston or my own voice, but I could speak, so I started telling them what had happened. In 4 midsentence, I knew something else had gone wrong. My vocal apparatus had become paralyzed. Then my right hand went limp—another transceiver had gone. I was truly in deep trouble. But
- 76. worse was to follow. After a few more minutes, I went blind. I cursed my luck, and then I cursed the scientists who had led me into this grave peril. There I was, deaf, dumb, and blind, in a radioactive hole more than a mile under Tulsa. Then the last of my cerebral radio links broke, and suddenly I was faced with a new and even more shocking problem: whereas an instant before I had been buried alive in Oklahoma, now I was disembodied in Houston. My recognition of my new status was not immediate. It took me several very anxious minutes before it dawned on me that my poor body lay several hundred miles away, with heart pulsing and lungs respirating, but otherwise as dead as the body of any heart-transplant donor, its skull packed with useless, broken electronic gear. The shift in perspective I had earlier found well nigh impossible now seemed quite natural. Though I could think myself back into my body in the tunnel under Tulsa, it took some effort to sustain the illusion. For surely it was an illusion to suppose I was still in Oklahoma: I had lost all contact with that body.
- 77. It occurred to me then, with one of those rushes of revelation of which we should be suspicious, that I had stumbled upon an impressive demonstration of the immateriality of the soul based upon physicalist principles and premises. For as the last radio signal between Tulsa and Houston died away, had I not changed location from Tulsa to Houston at the speed of light? And had I not accomplished this without any increase in mass? What moved from A to B at such speed was surely myself, or at any rate my soul or mind—the massless center of my being and home of my consciousness. My point of view had lagged somewhat behind, but I had already noted the indirect bearing of point of view on personal location. I could not see how a physicalist philosopher could quarrel with this except by taking the dire and counterintuitive route of banishing all talk of persons. Yet the notion of personhood was so well entrenched in everyone’s world view, or so it seemed to me, that any denial would be as curiously unconvincing, as systematically disingenuous, as the Cartesian negation, “non sum.” The joy of philosophic discovery thus tided me over some very
- 78. bad minutes or perhaps hours as the helplessness and hopelessness or my situation became more apparent to me. Waves of panic and even nausea swept over me, made all the more horrible by the absence of their normal body- dependent phenomenology. No adrenaline rush of tingles in the arms, no pounding heart, no premonitory salivation. I did feel a dread sinking feeling in my bowels at one point, and this tricked me momentarily into the false hope that I was undergoing a reversal of the process that landed me in this fix—a gradual undisembodiment. But the isolation and uniqueness of that twinge soon convinced me that it was simply the first of a plague of phantom body hallucinations that I, like any other amputee, would be all too likely to suffer. My mood then was chaotic. On the one hand, I was fired up with elation of my philosophic discovery and was wracking my brain (one of the few familiar things I could still do), trying to figure out how to communicate my discovery to the journals; while on the other, I was bitter, lonely, and filled with dread and uncertainty. Fortunately, this did not last long, for my technical support
- 79. team sedated me into a dreamless sleep from which I awoke, hearing with magnificent fidelity the familiar opening strains of my favorite Brahms piano trio. So that was why they had wanted a list of my favorite recordings! It did not take me long to realize that I was hearing the music without ears. The output from the stereo stylus was being fed through some fancy rectification circuitry directly into my auditory nerve. I was mainlining Brahms, an unforgettable experience for any stereo buff. At the end of the record it did not surprise me to hear the reassuring voice of the project director speaking into a microphone that was now my prosthetic ear. He confirmed my analysis of what had gone wrong and assured me that steps were being taken to re- embody me. He did not elaborate, and after a few more recordings, I found myself drifting off to sleep. My sleep lasted, I later learned, for the better part of a year, and when I awoke, it was to find myself fully restored to my senses. When I looked into the mirror, though, I was a bit startled to see an unfamiliar face. Bearded and a bit heavier, bearing no doubt a family resemblance to my former face, and with the same look of
- 80. 5 spritely intelligence and resolute character, but definitely a new face. Further self-explorations of an intimate nature left me no doubt that this was a new body, and the project director confirmed my conclusions. He did not volunteer any information on the past history of my new body and I decided (wisely, I think in retrospect) not to pry. As many philosophers unfamiliar with my ordeal have more recently speculated, the acquisition of a new body leaves one’s person intact. And after a period of adjustment to a new voice, new muscular strengths and weaknesses, and so forth, one’s personality is by and large also preserved. More dramatic changes in personality have been routinely observed in people who have undergone extensive plastic surgery, to say nothing of sex-change operations, and I think no one contests the survival of the person in such cases. In any event I soon accommodated to my new body, to the point of being unable to recover any of its novelties to my consciousness or even memory. The view in the mirror soon
- 81. became utterly familiar. That view, by the way, still revealed antennae, and so l was not surprised to learn that my brain had not been moved from its haven in the life-support lab. I decided that good old Yorick deserved a visit. I and my new body, whom we might as well call Fortinbras, strode into the familiar lab to another round of applause from the technicians, who were of course congratulating themselves, not me. Once more I stood before the vat and contemplated poor Yorick, and on a whim I once again cavalierly flicked off the output transmitter switch. Imagine my surprise when nothing unusual happened. No fainting spell, no nausea, no noticeable change. A technician hurried to restore the switch to ON, but still I felt nothing. I demanded an explanation, which the project director hastened to provide. It seems that before they had even operated on the first occasion, they had constructed a computer duplicate of my brain, reproducing both the complete information-processing structure and the computational speed of my brain in a giant computer program. After the operation, but before they had dared to send me off on my
- 82. mission to Oklahoma, they had run this computer system and Yorick side by side. The incoming signals from Hamlet were sent simultaneously to Yorick’s transceivers and to the computer’s array of inputs. And the outputs from Yorick were not only beamed back to Hamlet, my body; they were recorded and checked against the simultaneous output of the computer program, which was called “Hubert” for reasons obscure to me. Over days and even weeks, the outputs were identical and synchronous, which of course did not prove that they had succeeded in copying the brain’s functional structure, but the empirical support was greatly encouraging. Hubert’s input, and hence activity, had been kept parallel with Yorick’s during my disembodied days. And now, to demonstrate this, they had actually thrown the master switch that put Hubert for the first time in on-line control of my body—not Hamlet, of course, but Fortinbras. (Hamlet, I learned, had never been recovered from its underground tomb and could be assumed by this time to have largely returned to the dust. At the head of my grave still lay the magnificent bulk of the
- 83. abandoned device, with the word STUD emblazoned on its side in large letters—a circumstance which may provide archeologists of the next century with a curious insight into the burial rites of their ancestors.) The laboratory technicians now showed me the master switch, which had two positions, labeled B, for Brain (they didn’t know my brain’s name was Yorick), and H, for Hubert. The switch did indeed point to H, and they explained to me that if I wi shed, I could switch it back to B. With my heart in my mouth (and my brain in its vat), I did this. Nothing happened. A click, that was all. To test their claim, and with the master switch now set at B. I hit Yorick’s output transmitter switch on the vat and sure enough, I began to faint. Once the output switch was turned back on and I had recovered my wits, so to speak, I continued to play with the master switch, flipping it back and forth. I found that with the exception of the transitional click, I could detect no trace of a difference. I could switch in mid-utterance, and the sentence I had begun speaking under the
- 84. control of Yorick was finished without a pause or hitch of any kind under the control of Hubert. I had a spare brain, a prosthetic device which might some day stand me in very good stead, were some mishap to befall Yorick. Or alternatively, I could keep Yorick as a spare and use Hubert. It didn’t seem to make any difference which I chose, for the wear and tear and fatigue on my body did 6 not have any debilitating effect on either brain, whether or not it was actually causing the motions of my body, or merely spilling its output into thin air. The one truly unsettling aspect of this new development was the prospect, which was not long in dawning on me, of someone detaching the spare—Hubert or Yorick, as the case might be—from Fortinbras and hitching it to yet another body—some Johnny- come-lately Rosencrantz or Guilden- stern. Then (if not before) there would be two people, that much was clear. One would be me, and the other would be a sort of super-twin brother. If there were two bodies, one under the control of
- 85. Hubert and the other being controlled by Yorick, then which would the world recognize as the true Dennett? And whatever the rest of the world decided, which one would be me? Would I be the Yorick- brained one, in virtue of Yorick’s causal priority and former intimate relationship with the original Dennett body, Hamlet? That seemed a bit legalistic, a bit too redolent of the arbitrariness of consanguinity and legal possession, to be convincing at the metaphysical level. For suppose that before the arrival of the second body on the scene, I had been keeping Yorick as the spare for years, and letting Hubert’s output drive my body—that is, Fortinbras—all that time. The Hubert- Fortinbras couple would seem then by squatter’s rights (to combat one legal intuition with another) to be the true Dennett and the lawful inheritor of everything that was Dennett’s. This was an interesting question, certainly, but not nearly so pressing as another question that bothered me. My strongest intuition was that in such an eventuality I would survive so long as either brain-body couple remained intact, but I had mixed emotions about whether I should want both to survive.
- 86. I discussed my worries with the technicians and the project director. The prospect of two Dennetts was abhorrent to me, I explained, largely for social reasons. I didn’t want to be my own rival for the affections of my wife, nor did I like the prospect of the two Dennetts sharing my modest professor’s salary. Still more vertiginous and distasteful, though, was the idea of knowing that much about another person, while he had the very same goods on me. How could we ever face each other? My colleagues in the lab argued that I was ignoring the bright side of the matter. Weren’t there many things I wanted to do but, being only one person, had been unable to do? Now one Dennett could stay at home and be the professor and family man while the other could strike out on a life of travel and adventure—missing the family of course, but happy in the knowledge that the other Dennett was keeping the home fires burning. I could be faithful and adulterous at the same time. I could even cuckold myself—to say nothing of other more lurid possibilities my colleagues were all too ready to force upon my overtaxed imagination. But my ordeal in Oklahoma
- 87. (or was it Houston?) had made me less adventurous, and I shrank from this opportunity that was being offered (though of course I was never quite sure it was being offered to me in the first place). There was another prospect even more disagreeable: that the spare, Hubert or Yorick as the case might be, would be detached from any input from Fortinbras and just left detached. Then, as in the other case, there would be two Dennetts, or at least two claimants to my name and possessions, one embodied in Fortinbras, and the other sadly, miserably disembodied. Both selfishness and altruism bade me take steps to prevent this from happening. So I asked that measures be taken to ensure that no one could ever tamper with the transceiver connections or the master switch without my (our? no, my) knowledge and consent. Since I had no desire to spend my life guarding the equipment in Houston, it was mutually decided that all the electronic connections in the lab would be carefully locked. Both those that controlled the life-support system for Yorick and those that controlled the power supply for Hubert would be guarded with fail-safe devices, and I would take the only master
- 88. switch, outfitted for radio remote control, with me wherever I went. I carry it strapped around my waist and—wait a moment—here it is. Every few months I reconnoiter the situation by switching channels. I do this only in the presence of friends, of course, for if the other channel were, heaven forbid, either dead or otherwise occupied, there would have to be somebody who had my interests at heart to switch it back, to bring me back from the void. For while I could feel, see, hear, and otherwise sense whatever befell my body, subsequent to such a switch, I’d be unable to control it. By the way, the two positions on the switch are intentionally unmarked, so I never have the faintest idea whether I am switching from Hubert to Yorick or vice versa. (Some of you may think that in 7 this case I really don’t know who I am, let alone where I am. But such reflections no longer make much of a dent on my essential Dennettness, on my own sense of who I am. If it is true that in one sense I don’t know who I am then that’s another one of your philosophical truths of underwhelming
- 89. significance.) In any case, every time I’ve flipped the switch so far, nothing has happened. So let’s give it a try … “THANK GOD! I THOUGHT YOU’D NEVER FLIP THAT SWITCH! You can’t imagine how horrible it’s been these last two weeks—but now you know; it’s your turn in purgatory. How I’ve longed for this moment! You see, about two weeks ago— excuse me, ladies and gentlemen, but I’ve got to explain this to my … um, brother, I guess you could say, but he’s just told you the facts, so you’ll understand—about two weeks ago our two brains drifted just a bit out of synch. I don’t know whether my brain is now Hubert or Yorick, any more than you do, but in any case, the two brains drifted apart, and of course once the process started, it snowballed, for I was in a slightly different receptive state for the input we both received, a difference that was soon magnified. In no time at all the illusion that I was in control of my body—our body—was completely dissipated. There was nothing I could do—no way to call you. YOU DIDN’T EVEN KNOW I EXISTED!