SlideShare a Scribd company logo
Rajeev K. Varshney and Abhishek Rathore
Email: r.k.varshney@cgiar.org
a.rathore@cgiar.org
Genome-Wide Selection Update
GCP General Research Meeting
Session IX
30th September 2013
ISMU 1.0
Challenges in SNP Detection
• Mostly Command-line based
Linux Tools
• Multiple steps involved
• Difficult pre-processing
& cleaning of raw data
• Specialized skills required to
process the job
• Developing genotyping assays
(GoldenGate and KASPar)
• Very few user-friendly
software
Solution: ISMU 1.0 Pipeline
Features:
– Multicore Architecture
– One stop shop for SNP detection
– Graphical User Interface
– Automated Cleaning of Data
– Integration of various popular alignment
tools
– Customized operation of tools for advanced users
– Available in Online and Standalone versions
– Easy Installation
– Works on CentOS, RHEL & Fedora
– Visualization of SNP and Alignment (TABLE/FLAPJACK)
Raw Reads
Reference
ISMU V1.0
Assemble& Align
Raw Reads
Mine SNPs
Generate Marker
Matrix
Visualizein TABLET
and FLAPJACK
Export in FLAT Files
• Assemble & Align Raw
Reads
• Mine SNPs
• Generate Marker Matrix
• Automated Visualize in
TABLET and FLAPJACK
• Developing genotyping
assays
• Export in FLAT Files
ISMU V1.0
ISMU 1.0 Standalone Edition
Selection of Alignment Tool & SNP Approach
ISMU 1.0 Standalone Edition
Results
Locus Forward Polymorphism Reverse
TC00001_1272 CGCTCAAGAGAACCAGTGTTGGAATGGTGGCGGCGATGGCTGTATTTCCA A/T GAAAAGTAAGGGACTAGAAG
TC00075_852 T GAGATGTTCCTATCACCAATGCAAATATCAGGGCAAATGCACTAACATA C/T TTGAGTAAATTTCCCATCTT
TC00118_13765 AATTAAGTTAGTAATGACTGGACGAAACCAAGAAATAACTACTTACGTGC T/G AAATTATAGAAGGTCTCCTG
TC00130_2668 GTTGTTGATCGAAAGAAAATTTAATTTCTTGTTCGACTGATCACCTTGCT G/A GGTTCCAACTATTCTAAAGT
TC00191_3430 TTAATGAATTTGCTTCATCGTCCAAGGTTTACCATTTAGGTGGGTAGAGC T/C ACAGAAATTAAGTATCTGGT
TC00212_866 CCCATGTCAATCATCCCAATTTTCTTGCATAAATTATCCTTAAATGGATA G/T CTTTACGTATGATGCTGATC
TC00295_2234 AGCCAGTGGAAGCTCCACCAGCAGCAGTAGCAGAAGTTCCAATTGAGACT C/T CTGAAGCTTAGACCAATGGA
TC00329_2112 GAGGCGTGAAAAGAAAAAGGCAAAGGAGGAGAGGGAGAAGCAAATAAGGG A/C TGCTGAGGAAAGACTACTGG
TC00336_3122 CTGAAATGGAGTGTTTTTATACAAGTTGTAAATAGTGATGTTTTGTACAT C/T TTTCTGGAAGATGATTCATG
[HEADING]
Customer_Name
Company_Name
Email_Address
Platform_Type GGGT
Format_Type Gene; Region; Sequence; Identity; ExistingDesign; or Score [select one]
Design_iteration prelim
Species
Number_of_Assays
[DATA]
Locus_name,Target_Type,Sequence,Chromosome,Coordinate,Genome_Build_Version,Source,Source_Version,Sequence_Orienta
TC00001_1272,SNP,TACTTCATCCCGCTCAAGAGAACCAGTGTTGGAATGGTGGCGGCGATGGCTGTATTTCCA[A/T]GAAAAGTAAGGGACTAGAAGGGCAGAGTGGA
72,0,0,0,Forward,Plus
TC00075_852,SNP,TTGTCGACATTGAGATGTTCCTATCACCAATGCAAATATCAGGGCAAATGCACTAACATA[C/T]TTGAGTAAATTTCCCATCTTCATTTGCACAAA
,0,0,0,Forward,Plus
TC00118_13765,SNP,ATCTAAAAATAATTAAGTTAGTAATGACTGGACGAAACCAAGAAATAACTACTTACGTGC[T/G]AAATTATAGAAGGTCTCCTGTAAGATCCAA
3765,0,0,0,Forward,Plus
TC00130_2668,SNP,TGCGGTCATTGTTGTTGATCGAAAGAAAATTTAATTTCTTGTTCGACTGATCACCTTGCT[G/A]GGTTCCAACTATTCTAAAGTAATACAGGCAT
68,0,0,0,Forward,Plus
KASPar
ILLUMINA
 MABC, MARS and GS
approaches seem to most
promising for crop
improvement
 Need to have genomic
resources and cost-
effective genotyping
platforms
 Breeders-friendly pipelines
and decision support tools
required for prediction of
phenotype
Novel breeding approaches for
developing countries
MBDT
MBDT
OptiMAS
GS
?
Breeding Cycle
Crossing
Field evaluation Line Selection
y
ir
R A
t
σ
=
genetic gain over time
years per cycle
selection intensity selection accuracy
genetic variance
NEW
cheaper to
genotype = larger
populations for
same $$
make selections in
‘off target’ years
maintain favorable
rare alleles
Select years
earlier on single
plant basis
Inbreeding
Multi-location, Multi-year
testing
Seed Increase
Based on discussions
with several colleagues
e.g. Jesse Poland,
J-L Jannink, Gary Atlin
GS-Models
• Usually involves relatively high
number of markers
• To meet the challenges,
statistical methods that can
handle high-dimensional data
have been developed
• However, their respective properties are
still not fully understood,
• Causing considerable uncertainty about
the choice of models for genomic
prediction
• Factors affecting GS are also not very clear
GS
ISMU V2
Raw Reads
Reference
Assemble& Align
Raw Reads
Mine SNPs
Generate Marker
Matrix
Visualizein TABLET
and FLAPJACK
Export in FLAT Files
GDMS
Genotypic Matrix
& QTLs
Lines selected
for further
crossing in
GS
External
Genotyping
Platforms
Called SNPs
ISMU V2.0
GS-Models
• To meet the challenges, statistical methods
that can handle high-dimensional data have
been developed
• However, their respective properties are
still not fully understood
• Causing considerable uncertainty about
the choice of models for genomic
prediction
• Factors affecting GS are also not very clear
Factors Affecting GS-Models
• Marker density, genome size and
structure
• Size of the training population
• Historical effective population size
• Trait heritability
• Relationship between training
population & selection candidates
• Number of genes and distribution of
their effects
• Method used for the estimation of
marker effects
• GxE
Validation Studies
• Fit available models
• Cross Validation
• Prepare a matrix of validation scores
• Compare over the multiple environments
• Select Final model
Training set Testing set
Cross Validation K(=5) - fold cross-validation
ISMU 2.0 Pipeline
Analysis Capabilities to ISMU 1.0
• GUI for Genomic Selection
• Multicore Support
• R and Fortran Libraries for GS
• Project Mode Development
• IDE Supports
• Multiple Method & Traits at once
• Platform Support
– Windows x64 and x32
– CentOS x64 and Ubuntu x64
– MAC (Under Testing…)
In collaboration with
J L Jannink, John Hickey and Aaron Lorenz
• Data Diagnostics
– Graphical Summary
– Tabular Summary
• Subset Data
– Missing %
– MAF
– PIC
• Genomic Selection
– RR-BLUP
– Kinship Gauss
– Bayesian LASSO
– BayesB and BayesCπ
– Random Forest Regression (RFR)
• HTML & PDF Output
ISMU 2.0 Pipeline
Analysis Capabilities to ISMU 2.0
ISMU 2.0
ISMU 2.0
Browse Data
Data in ISMU2.0
Calculation of Marker Summary
Summary Plots
Various Statistics
Export to MS-Excel (Windows)
GS Methods
GS Methods
GS Results
GS Results
Export to PDF
Export to High Quality Graphics 300DPI
Future Plans
• Customized Parameters for GS Scripts
• Integrating more Algorithms
• Implementation of Cross Validation
• Linking with IBWS
• Data Import/Export Module
• Online Version of ISMU 2.0
• Linking with Agricultural Genomics Network
• Making available on more OS
• Average GEBVs
• Multi-trait GS
• Capacity building in NARS Partners
– 4th International Workshop on Next Generation
Genomics and Integrated Breeding for Crop
Improvement, Feb 19th -21st 2014
Acknowledgements
Many Friends & Collaborators
Thanks…
Thanks…

More Related Content

Viewers also liked

Lecture 7 gwas full
Lecture 7 gwas fullLecture 7 gwas full
Lecture 7 gwas full
Lekki Frazier-Wood
 
Genomic selection on rice
Genomic selection on riceGenomic selection on rice
Genomic selection on rice
CIAT
 
Introduction to association mapping and tutorial using tassel
Introduction to association mapping and tutorial using tasselIntroduction to association mapping and tutorial using tassel
Introduction to association mapping and tutorial using tassel
Awais Khan
 
Whole Genome Selection
Whole Genome SelectionWhole Genome Selection
Whole Genome Selection
Raghav N.R
 
Genomic Selection & Precision Phenotyping
Genomic Selection & Precision PhenotypingGenomic Selection & Precision Phenotyping
Genomic Selection & Precision Phenotyping
CIMMYT
 
Heritability , genetic advance
Heritability , genetic advanceHeritability , genetic advance
Heritability , genetic advance
Pawan Nagar
 
Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...
Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...
Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...
CGIAR Research Program on Roots, Tubers and Bananas
 
Genome wide association studies seminar
Genome wide association studies seminarGenome wide association studies seminar
Genome wide association studies seminar
Varsha Gayatonde
 
Genetics of animal breeding 9
Genetics of animal breeding 9Genetics of animal breeding 9
Genetics of animal breeding 9
zerdon
 
Selection
SelectionSelection
Breeding methods in cross pollinated crops
Breeding methods in cross pollinated cropsBreeding methods in cross pollinated crops
Breeding methods in cross pollinated crops
Dev Hingra
 
Method of breeding
Method of breedingMethod of breeding
Method of breeding
nehavik
 
Power and Authority
 Power and Authority Power and Authority
Power and Authority
NaimAlmashoori
 
Association mapping in plants
Association mapping in plantsAssociation mapping in plants
Association mapping in plants
Waseem Hussain
 
PPT - Powerful Presentation Techniques
PPT - Powerful Presentation TechniquesPPT - Powerful Presentation Techniques
PPT - Powerful Presentation Techniques
University of Wisconsin Milwaukee
 
Slideshare ppt
Slideshare pptSlideshare ppt
Slideshare ppt
Mandy Suzanne
 

Viewers also liked (16)

Lecture 7 gwas full
Lecture 7 gwas fullLecture 7 gwas full
Lecture 7 gwas full
 
Genomic selection on rice
Genomic selection on riceGenomic selection on rice
Genomic selection on rice
 
Introduction to association mapping and tutorial using tassel
Introduction to association mapping and tutorial using tasselIntroduction to association mapping and tutorial using tassel
Introduction to association mapping and tutorial using tassel
 
Whole Genome Selection
Whole Genome SelectionWhole Genome Selection
Whole Genome Selection
 
Genomic Selection & Precision Phenotyping
Genomic Selection & Precision PhenotypingGenomic Selection & Precision Phenotyping
Genomic Selection & Precision Phenotyping
 
Heritability , genetic advance
Heritability , genetic advanceHeritability , genetic advance
Heritability , genetic advance
 
Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...
Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...
Application of Genome-Wide Association Study (GWAS) and transcriptomics to st...
 
Genome wide association studies seminar
Genome wide association studies seminarGenome wide association studies seminar
Genome wide association studies seminar
 
Genetics of animal breeding 9
Genetics of animal breeding 9Genetics of animal breeding 9
Genetics of animal breeding 9
 
Selection
SelectionSelection
Selection
 
Breeding methods in cross pollinated crops
Breeding methods in cross pollinated cropsBreeding methods in cross pollinated crops
Breeding methods in cross pollinated crops
 
Method of breeding
Method of breedingMethod of breeding
Method of breeding
 
Power and Authority
 Power and Authority Power and Authority
Power and Authority
 
Association mapping in plants
Association mapping in plantsAssociation mapping in plants
Association mapping in plants
 
PPT - Powerful Presentation Techniques
PPT - Powerful Presentation TechniquesPPT - Powerful Presentation Techniques
PPT - Powerful Presentation Techniques
 
Slideshare ppt
Slideshare pptSlideshare ppt
Slideshare ppt
 

Similar to GRM 2013: Genome-Wide Selection Update -- RK Varshney and A Rathore

2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...
2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...
2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...
FOODCROPS
 
GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...
GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...
GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...
CGIAR Generation Challenge Programme
 
Mar2013 Performance Metrics Working Group
Mar2013 Performance Metrics Working GroupMar2013 Performance Metrics Working Group
Mar2013 Performance Metrics Working Group
GenomeInABottle
 
Whole exome sequencing data analysis.pptx
Whole exome sequencing data analysis.pptxWhole exome sequencing data analysis.pptx
Whole exome sequencing data analysis.pptx
Haibo Liu
 
Making powerful science: an introduction to NGS data analysis
Making powerful science: an introduction to NGS data analysisMaking powerful science: an introduction to NGS data analysis
Making powerful science: an introduction to NGS data analysis
AdamCribbs1
 
eRum2016 -RevoScaleR - Performance and Scalability R
eRum2016 -RevoScaleR - Performance and Scalability ReRum2016 -RevoScaleR - Performance and Scalability R
eRum2016 -RevoScaleR - Performance and Scalability R
Łukasz Grala
 
2012 sept 18_thug_biotech
2012 sept 18_thug_biotech2012 sept 18_thug_biotech
2012 sept 18_thug_biotech
Adam Muise
 
Building a scalable data science platform with R
Building a scalable data science platform with RBuilding a scalable data science platform with R
Building a scalable data science platform with R
Revolution Analytics
 
GRM 2011: The Integrated Breeding Platform tools and services
GRM 2011: The Integrated Breeding Platform tools and servicesGRM 2011: The Integrated Breeding Platform tools and services
GRM 2011: The Integrated Breeding Platform tools and services
CGIAR Generation Challenge Programme
 
Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習
Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習 Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習
Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習
Herman Wu
 
Taking R Analytics to SQL and the Cloud
Taking R Analytics to SQL and the CloudTaking R Analytics to SQL and the Cloud
Taking R Analytics to SQL and the Cloud
Revolution Analytics
 
Folker Meyer: Metagenomic Data Annotation
Folker Meyer: Metagenomic Data AnnotationFolker Meyer: Metagenomic Data Annotation
Folker Meyer: Metagenomic Data Annotation
GigaScience, BGI Hong Kong
 
Automating biostatistics workflows using R-based webtools
Automating biostatistics workflows using R-based webtoolsAutomating biostatistics workflows using R-based webtools
Automating biostatistics workflows using R-based webtools
Bioinformatics and Computational Biosciences Branch
 
XSEDE15_PhastaGateway
XSEDE15_PhastaGatewayXSEDE15_PhastaGateway
XSEDE15_PhastaGateway
Raminder Singh
 
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Prof. Wim Van Criekinge
 
QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...
QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...
QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...
QuantUniversity
 
2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...
2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...
2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...
The Statistical and Applied Mathematical Sciences Institute
 
microsoft r server for distributed computing
microsoft r server for distributed computingmicrosoft r server for distributed computing
microsoft r server for distributed computing
BAINIDA
 
Building a Scalable Data Science Platform with R
Building a Scalable Data Science Platform with RBuilding a Scalable Data Science Platform with R
Building a Scalable Data Science Platform with R
DataWorks Summit/Hadoop Summit
 
Decision trees in hadoop
Decision trees in hadoopDecision trees in hadoop
Decision trees in hadoop
Revolution Analytics
 

Similar to GRM 2013: Genome-Wide Selection Update -- RK Varshney and A Rathore (20)

2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...
2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...
2015. abhishek rathore. ismu 2.0 a multi algorithm pipeline for genomic selec...
 
GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...
GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...
GRM 2011: ISMU pipeline for NGS data analysis and facilitating molecular bree...
 
Mar2013 Performance Metrics Working Group
Mar2013 Performance Metrics Working GroupMar2013 Performance Metrics Working Group
Mar2013 Performance Metrics Working Group
 
Whole exome sequencing data analysis.pptx
Whole exome sequencing data analysis.pptxWhole exome sequencing data analysis.pptx
Whole exome sequencing data analysis.pptx
 
Making powerful science: an introduction to NGS data analysis
Making powerful science: an introduction to NGS data analysisMaking powerful science: an introduction to NGS data analysis
Making powerful science: an introduction to NGS data analysis
 
eRum2016 -RevoScaleR - Performance and Scalability R
eRum2016 -RevoScaleR - Performance and Scalability ReRum2016 -RevoScaleR - Performance and Scalability R
eRum2016 -RevoScaleR - Performance and Scalability R
 
2012 sept 18_thug_biotech
2012 sept 18_thug_biotech2012 sept 18_thug_biotech
2012 sept 18_thug_biotech
 
Building a scalable data science platform with R
Building a scalable data science platform with RBuilding a scalable data science platform with R
Building a scalable data science platform with R
 
GRM 2011: The Integrated Breeding Platform tools and services
GRM 2011: The Integrated Breeding Platform tools and servicesGRM 2011: The Integrated Breeding Platform tools and services
GRM 2011: The Integrated Breeding Platform tools and services
 
Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習
Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習 Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習
Azure 機器學習 - 使用Python, R, Spark, CNTK 深度學習
 
Taking R Analytics to SQL and the Cloud
Taking R Analytics to SQL and the CloudTaking R Analytics to SQL and the Cloud
Taking R Analytics to SQL and the Cloud
 
Folker Meyer: Metagenomic Data Annotation
Folker Meyer: Metagenomic Data AnnotationFolker Meyer: Metagenomic Data Annotation
Folker Meyer: Metagenomic Data Annotation
 
Automating biostatistics workflows using R-based webtools
Automating biostatistics workflows using R-based webtoolsAutomating biostatistics workflows using R-based webtools
Automating biostatistics workflows using R-based webtools
 
XSEDE15_PhastaGateway
XSEDE15_PhastaGatewayXSEDE15_PhastaGateway
XSEDE15_PhastaGateway
 
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
 
QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...
QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...
QuTrack: Model Life Cycle Management for AI and ML models using a Blockchain ...
 
2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...
2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...
2019 GDRR: Blockchain Data Analytics - QuTrack: Model Life Cycle Management f...
 
microsoft r server for distributed computing
microsoft r server for distributed computingmicrosoft r server for distributed computing
microsoft r server for distributed computing
 
Building a Scalable Data Science Platform with R
Building a Scalable Data Science Platform with RBuilding a Scalable Data Science Platform with R
Building a Scalable Data Science Platform with R
 
Decision trees in hadoop
Decision trees in hadoopDecision trees in hadoop
Decision trees in hadoop
 

More from CGIAR Generation Challenge Programme

Capacity Building: Gain or Drain? J-M Ribaut, F Okono and NN Diop
Capacity Building: Gain or Drain? J-M Ribaut, F Okono and NN DiopCapacity Building: Gain or Drain? J-M Ribaut, F Okono and NN Diop
Capacity Building: Gain or Drain? J-M Ribaut, F Okono and NN Diop
CGIAR Generation Challenge Programme
 
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
CGIAR Generation Challenge Programme
 
ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...
CGIAR Generation Challenge Programme
 
The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...
The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...
The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...
CGIAR Generation Challenge Programme
 
Lessons learnt from the GCP experience – J-M Ribaut
Lessons learnt from the GCP experience – J-M RibautLessons learnt from the GCP experience – J-M Ribaut
Lessons learnt from the GCP experience – J-M Ribaut
CGIAR Generation Challenge Programme
 
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
CGIAR Generation Challenge Programme
 
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
CGIAR Generation Challenge Programme
 
TLM III: : Improve common bean productivity for marginal environments in su...
TLM III: :   Improve common bean productivity for marginal environments in su...TLM III: :   Improve common bean productivity for marginal environments in su...
TLM III: : Improve common bean productivity for marginal environments in su...
CGIAR Generation Challenge Programme
 
TLM III: Improve groundnut productivity for marginal environments from sub-Sa...
TLM III: Improve groundnut productivity for marginal environments from sub-Sa...TLM III: Improve groundnut productivity for marginal environments from sub-Sa...
TLM III: Improve groundnut productivity for marginal environments from sub-Sa...
CGIAR Generation Challenge Programme
 
TLM III: Improve cowpea productivity for marginal environments in sub-Sahara...
TLM III: Improve cowpea productivity for marginal  environments in sub-Sahara...TLM III: Improve cowpea productivity for marginal  environments in sub-Sahara...
TLM III: Improve cowpea productivity for marginal environments in sub-Sahara...
CGIAR Generation Challenge Programme
 
TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...
TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...
TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...
CGIAR Generation Challenge Programme
 
TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...
TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...
TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...
CGIAR Generation Challenge Programme
 
Adoption of modern breeding tools in developing countries: challenges and opp...
Adoption of modern breeding tools in developing countries: challenges and opp...Adoption of modern breeding tools in developing countries: challenges and opp...
Adoption of modern breeding tools in developing countries: challenges and opp...
CGIAR Generation Challenge Programme
 
PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...
PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...
PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...
CGIAR Generation Challenge Programme
 
PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...
PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...
PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...
CGIAR Generation Challenge Programme
 
PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...
PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...
PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...
CGIAR Generation Challenge Programme
 
2011: Introduction to the CGIAR Generation Challenge Programme (GCP)
2011: Introduction to the CGIAR Generation Challenge Programme (GCP)2011: Introduction to the CGIAR Generation Challenge Programme (GCP)
2011: Introduction to the CGIAR Generation Challenge Programme (GCP)
CGIAR Generation Challenge Programme
 
Working with diversity in international partnerships -- The GCP experience --...
Working with diversity in international partnerships -- The GCP experience --...Working with diversity in international partnerships -- The GCP experience --...
Working with diversity in international partnerships -- The GCP experience --...
CGIAR Generation Challenge Programme
 
GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...
GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...
GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...
CGIAR Generation Challenge Programme
 
GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...
GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...
GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...
CGIAR Generation Challenge Programme
 

More from CGIAR Generation Challenge Programme (20)

Capacity Building: Gain or Drain? J-M Ribaut, F Okono and NN Diop
Capacity Building: Gain or Drain? J-M Ribaut, F Okono and NN DiopCapacity Building: Gain or Drain? J-M Ribaut, F Okono and NN Diop
Capacity Building: Gain or Drain? J-M Ribaut, F Okono and NN Diop
 
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2008: Dissection, characterisation and utilisation of disease QTL -- R Ne...
 
ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...
ARM 2007: Dissection, characterisation and utilisation of disease QTL -- R Ne...
 
The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...
The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...
The Generation Challenge Programme: Lessons learnt relevant to CRPs, and the ...
 
Lessons learnt from the GCP experience – J-M Ribaut
Lessons learnt from the GCP experience – J-M RibautLessons learnt from the GCP experience – J-M Ribaut
Lessons learnt from the GCP experience – J-M Ribaut
 
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
 
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
Integrated Breeding Platform (IBP): A user-friendly platform to implement the...
 
TLM III: : Improve common bean productivity for marginal environments in su...
TLM III: :   Improve common bean productivity for marginal environments in su...TLM III: :   Improve common bean productivity for marginal environments in su...
TLM III: : Improve common bean productivity for marginal environments in su...
 
TLM III: Improve groundnut productivity for marginal environments from sub-Sa...
TLM III: Improve groundnut productivity for marginal environments from sub-Sa...TLM III: Improve groundnut productivity for marginal environments from sub-Sa...
TLM III: Improve groundnut productivity for marginal environments from sub-Sa...
 
TLM III: Improve cowpea productivity for marginal environments in sub-Sahara...
TLM III: Improve cowpea productivity for marginal  environments in sub-Sahara...TLM III: Improve cowpea productivity for marginal  environments in sub-Sahara...
TLM III: Improve cowpea productivity for marginal environments in sub-Sahara...
 
TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...
TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...
TLIII: Overview of TLII achievements, lessons and challenges for Phase III – ...
 
TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...
TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...
TLIII: Tropical Legumes I – Improving Tropical Legume Productivity for Margin...
 
Adoption of modern breeding tools in developing countries: challenges and opp...
Adoption of modern breeding tools in developing countries: challenges and opp...Adoption of modern breeding tools in developing countries: challenges and opp...
Adoption of modern breeding tools in developing countries: challenges and opp...
 
PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...
PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...
PAG XXII 2014 – The Breeding Management System (BMS) of the Integrated Breedi...
 
PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...
PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...
PAG XXII 2014 – The Crop Ontology: A resource for enabling access to breeders...
 
PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...
PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...
PAG XXII 2014 – Genomic resources applied to marker-assisted breeding in cowp...
 
2011: Introduction to the CGIAR Generation Challenge Programme (GCP)
2011: Introduction to the CGIAR Generation Challenge Programme (GCP)2011: Introduction to the CGIAR Generation Challenge Programme (GCP)
2011: Introduction to the CGIAR Generation Challenge Programme (GCP)
 
Working with diversity in international partnerships -- The GCP experience --...
Working with diversity in international partnerships -- The GCP experience --...Working with diversity in international partnerships -- The GCP experience --...
Working with diversity in international partnerships -- The GCP experience --...
 
GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...
GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...
GRM 2013: Improving rice productivity in lowland ecosystems of Burkina Faso, ...
 
GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...
GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...
GRM 2013: Improving sorghum productivity in semi-arid environments of Mali th...
 

Recently uploaded

GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge GraphGraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
Neo4j
 
Dandelion Hashtable: beyond billion requests per second on a commodity server
Dandelion Hashtable: beyond billion requests per second on a commodity serverDandelion Hashtable: beyond billion requests per second on a commodity server
Dandelion Hashtable: beyond billion requests per second on a commodity server
Antonios Katsarakis
 
Fueling AI with Great Data with Airbyte Webinar
Fueling AI with Great Data with Airbyte WebinarFueling AI with Great Data with Airbyte Webinar
Fueling AI with Great Data with Airbyte Webinar
Zilliz
 
June Patch Tuesday
June Patch TuesdayJune Patch Tuesday
June Patch Tuesday
Ivanti
 
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...
Alex Pruden
 
Choosing The Best AWS Service For Your Website + API.pptx
Choosing The Best AWS Service For Your Website + API.pptxChoosing The Best AWS Service For Your Website + API.pptx
Choosing The Best AWS Service For Your Website + API.pptx
Brandon Minnick, MBA
 
What is an RPA CoE? Session 1 – CoE Vision
What is an RPA CoE?  Session 1 – CoE VisionWhat is an RPA CoE?  Session 1 – CoE Vision
What is an RPA CoE? Session 1 – CoE Vision
DianaGray10
 
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development ProvidersYour One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
akankshawande
 
Y-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PPY-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PP
c5vrf27qcz
 
Energy Efficient Video Encoding for Cloud and Edge Computing Instances
Energy Efficient Video Encoding for Cloud and Edge Computing InstancesEnergy Efficient Video Encoding for Cloud and Edge Computing Instances
Energy Efficient Video Encoding for Cloud and Edge Computing Instances
Alpen-Adria-Universität
 
AppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSFAppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSF
Ajin Abraham
 
Harnessing the Power of NLP and Knowledge Graphs for Opioid Research
Harnessing the Power of NLP and Knowledge Graphs for Opioid ResearchHarnessing the Power of NLP and Knowledge Graphs for Opioid Research
Harnessing the Power of NLP and Knowledge Graphs for Opioid Research
Neo4j
 
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
saastr
 
Generating privacy-protected synthetic data using Secludy and Milvus
Generating privacy-protected synthetic data using Secludy and MilvusGenerating privacy-protected synthetic data using Secludy and Milvus
Generating privacy-protected synthetic data using Secludy and Milvus
Zilliz
 
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Driving Business Innovation: Latest Generative AI Advancements & Success StoryDriving Business Innovation: Latest Generative AI Advancements & Success Story
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Safe Software
 
5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides
DanBrown980551
 
Skybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoptionSkybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoption
Tatiana Kojar
 
Mutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented ChatbotsMutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented Chatbots
Pablo Gómez Abajo
 
Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving
 

Recently uploaded (20)

GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge GraphGraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
GraphRAG for LifeSciences Hands-On with the Clinical Knowledge Graph
 
Dandelion Hashtable: beyond billion requests per second on a commodity server
Dandelion Hashtable: beyond billion requests per second on a commodity serverDandelion Hashtable: beyond billion requests per second on a commodity server
Dandelion Hashtable: beyond billion requests per second on a commodity server
 
Fueling AI with Great Data with Airbyte Webinar
Fueling AI with Great Data with Airbyte WebinarFueling AI with Great Data with Airbyte Webinar
Fueling AI with Great Data with Airbyte Webinar
 
June Patch Tuesday
June Patch TuesdayJune Patch Tuesday
June Patch Tuesday
 
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...
zkStudyClub - LatticeFold: A Lattice-based Folding Scheme and its Application...
 
Choosing The Best AWS Service For Your Website + API.pptx
Choosing The Best AWS Service For Your Website + API.pptxChoosing The Best AWS Service For Your Website + API.pptx
Choosing The Best AWS Service For Your Website + API.pptx
 
What is an RPA CoE? Session 1 – CoE Vision
What is an RPA CoE?  Session 1 – CoE VisionWhat is an RPA CoE?  Session 1 – CoE Vision
What is an RPA CoE? Session 1 – CoE Vision
 
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development ProvidersYour One-Stop Shop for Python Success: Top 10 US Python Development Providers
Your One-Stop Shop for Python Success: Top 10 US Python Development Providers
 
Y-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PPY-Combinator seed pitch deck template PP
Y-Combinator seed pitch deck template PP
 
Energy Efficient Video Encoding for Cloud and Edge Computing Instances
Energy Efficient Video Encoding for Cloud and Edge Computing InstancesEnergy Efficient Video Encoding for Cloud and Edge Computing Instances
Energy Efficient Video Encoding for Cloud and Edge Computing Instances
 
AppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSFAppSec PNW: Android and iOS Application Security with MobSF
AppSec PNW: Android and iOS Application Security with MobSF
 
Harnessing the Power of NLP and Knowledge Graphs for Opioid Research
Harnessing the Power of NLP and Knowledge Graphs for Opioid ResearchHarnessing the Power of NLP and Knowledge Graphs for Opioid Research
Harnessing the Power of NLP and Knowledge Graphs for Opioid Research
 
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
Overcoming the PLG Trap: Lessons from Canva's Head of Sales & Head of EMEA Da...
 
Generating privacy-protected synthetic data using Secludy and Milvus
Generating privacy-protected synthetic data using Secludy and MilvusGenerating privacy-protected synthetic data using Secludy and Milvus
Generating privacy-protected synthetic data using Secludy and Milvus
 
Driving Business Innovation: Latest Generative AI Advancements & Success Story
Driving Business Innovation: Latest Generative AI Advancements & Success StoryDriving Business Innovation: Latest Generative AI Advancements & Success Story
Driving Business Innovation: Latest Generative AI Advancements & Success Story
 
5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides5th LF Energy Power Grid Model Meet-up Slides
5th LF Energy Power Grid Model Meet-up Slides
 
Skybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoptionSkybuffer SAM4U tool for SAP license adoption
Skybuffer SAM4U tool for SAP license adoption
 
Mutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented ChatbotsMutation Testing for Task-Oriented Chatbots
Mutation Testing for Task-Oriented Chatbots
 
Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024Northern Engraving | Nameplate Manufacturing Process - 2024
Northern Engraving | Nameplate Manufacturing Process - 2024
 
Artificial Intelligence and Electronic Warfare
Artificial Intelligence and Electronic WarfareArtificial Intelligence and Electronic Warfare
Artificial Intelligence and Electronic Warfare
 

GRM 2013: Genome-Wide Selection Update -- RK Varshney and A Rathore

  • 1. Rajeev K. Varshney and Abhishek Rathore Email: r.k.varshney@cgiar.org a.rathore@cgiar.org Genome-Wide Selection Update GCP General Research Meeting Session IX 30th September 2013
  • 2. ISMU 1.0 Challenges in SNP Detection • Mostly Command-line based Linux Tools • Multiple steps involved • Difficult pre-processing & cleaning of raw data • Specialized skills required to process the job • Developing genotyping assays (GoldenGate and KASPar) • Very few user-friendly software
  • 3. Solution: ISMU 1.0 Pipeline Features: – Multicore Architecture – One stop shop for SNP detection – Graphical User Interface – Automated Cleaning of Data – Integration of various popular alignment tools – Customized operation of tools for advanced users – Available in Online and Standalone versions – Easy Installation – Works on CentOS, RHEL & Fedora – Visualization of SNP and Alignment (TABLE/FLAPJACK)
  • 4. Raw Reads Reference ISMU V1.0 Assemble& Align Raw Reads Mine SNPs Generate Marker Matrix Visualizein TABLET and FLAPJACK Export in FLAT Files • Assemble & Align Raw Reads • Mine SNPs • Generate Marker Matrix • Automated Visualize in TABLET and FLAPJACK • Developing genotyping assays • Export in FLAT Files ISMU V1.0
  • 5. ISMU 1.0 Standalone Edition Selection of Alignment Tool & SNP Approach
  • 6. ISMU 1.0 Standalone Edition Results
  • 7. Locus Forward Polymorphism Reverse TC00001_1272 CGCTCAAGAGAACCAGTGTTGGAATGGTGGCGGCGATGGCTGTATTTCCA A/T GAAAAGTAAGGGACTAGAAG TC00075_852 T GAGATGTTCCTATCACCAATGCAAATATCAGGGCAAATGCACTAACATA C/T TTGAGTAAATTTCCCATCTT TC00118_13765 AATTAAGTTAGTAATGACTGGACGAAACCAAGAAATAACTACTTACGTGC T/G AAATTATAGAAGGTCTCCTG TC00130_2668 GTTGTTGATCGAAAGAAAATTTAATTTCTTGTTCGACTGATCACCTTGCT G/A GGTTCCAACTATTCTAAAGT TC00191_3430 TTAATGAATTTGCTTCATCGTCCAAGGTTTACCATTTAGGTGGGTAGAGC T/C ACAGAAATTAAGTATCTGGT TC00212_866 CCCATGTCAATCATCCCAATTTTCTTGCATAAATTATCCTTAAATGGATA G/T CTTTACGTATGATGCTGATC TC00295_2234 AGCCAGTGGAAGCTCCACCAGCAGCAGTAGCAGAAGTTCCAATTGAGACT C/T CTGAAGCTTAGACCAATGGA TC00329_2112 GAGGCGTGAAAAGAAAAAGGCAAAGGAGGAGAGGGAGAAGCAAATAAGGG A/C TGCTGAGGAAAGACTACTGG TC00336_3122 CTGAAATGGAGTGTTTTTATACAAGTTGTAAATAGTGATGTTTTGTACAT C/T TTTCTGGAAGATGATTCATG [HEADING] Customer_Name Company_Name Email_Address Platform_Type GGGT Format_Type Gene; Region; Sequence; Identity; ExistingDesign; or Score [select one] Design_iteration prelim Species Number_of_Assays [DATA] Locus_name,Target_Type,Sequence,Chromosome,Coordinate,Genome_Build_Version,Source,Source_Version,Sequence_Orienta TC00001_1272,SNP,TACTTCATCCCGCTCAAGAGAACCAGTGTTGGAATGGTGGCGGCGATGGCTGTATTTCCA[A/T]GAAAAGTAAGGGACTAGAAGGGCAGAGTGGA 72,0,0,0,Forward,Plus TC00075_852,SNP,TTGTCGACATTGAGATGTTCCTATCACCAATGCAAATATCAGGGCAAATGCACTAACATA[C/T]TTGAGTAAATTTCCCATCTTCATTTGCACAAA ,0,0,0,Forward,Plus TC00118_13765,SNP,ATCTAAAAATAATTAAGTTAGTAATGACTGGACGAAACCAAGAAATAACTACTTACGTGC[T/G]AAATTATAGAAGGTCTCCTGTAAGATCCAA 3765,0,0,0,Forward,Plus TC00130_2668,SNP,TGCGGTCATTGTTGTTGATCGAAAGAAAATTTAATTTCTTGTTCGACTGATCACCTTGCT[G/A]GGTTCCAACTATTCTAAAGTAATACAGGCAT 68,0,0,0,Forward,Plus KASPar ILLUMINA
  • 8.  MABC, MARS and GS approaches seem to most promising for crop improvement  Need to have genomic resources and cost- effective genotyping platforms  Breeders-friendly pipelines and decision support tools required for prediction of phenotype Novel breeding approaches for developing countries MBDT MBDT OptiMAS GS ?
  • 9. Breeding Cycle Crossing Field evaluation Line Selection y ir R A t σ = genetic gain over time years per cycle selection intensity selection accuracy genetic variance NEW cheaper to genotype = larger populations for same $$ make selections in ‘off target’ years maintain favorable rare alleles Select years earlier on single plant basis Inbreeding Multi-location, Multi-year testing Seed Increase Based on discussions with several colleagues e.g. Jesse Poland, J-L Jannink, Gary Atlin
  • 10. GS-Models • Usually involves relatively high number of markers • To meet the challenges, statistical methods that can handle high-dimensional data have been developed • However, their respective properties are still not fully understood, • Causing considerable uncertainty about the choice of models for genomic prediction • Factors affecting GS are also not very clear
  • 11. GS ISMU V2 Raw Reads Reference Assemble& Align Raw Reads Mine SNPs Generate Marker Matrix Visualizein TABLET and FLAPJACK Export in FLAT Files GDMS Genotypic Matrix & QTLs Lines selected for further crossing in GS External Genotyping Platforms Called SNPs ISMU V2.0
  • 12. GS-Models • To meet the challenges, statistical methods that can handle high-dimensional data have been developed • However, their respective properties are still not fully understood • Causing considerable uncertainty about the choice of models for genomic prediction • Factors affecting GS are also not very clear
  • 13. Factors Affecting GS-Models • Marker density, genome size and structure • Size of the training population • Historical effective population size • Trait heritability • Relationship between training population & selection candidates • Number of genes and distribution of their effects • Method used for the estimation of marker effects • GxE
  • 14. Validation Studies • Fit available models • Cross Validation • Prepare a matrix of validation scores • Compare over the multiple environments • Select Final model Training set Testing set Cross Validation K(=5) - fold cross-validation
  • 15. ISMU 2.0 Pipeline Analysis Capabilities to ISMU 1.0 • GUI for Genomic Selection • Multicore Support • R and Fortran Libraries for GS • Project Mode Development • IDE Supports • Multiple Method & Traits at once • Platform Support – Windows x64 and x32 – CentOS x64 and Ubuntu x64 – MAC (Under Testing…) In collaboration with J L Jannink, John Hickey and Aaron Lorenz
  • 16. • Data Diagnostics – Graphical Summary – Tabular Summary • Subset Data – Missing % – MAF – PIC • Genomic Selection – RR-BLUP – Kinship Gauss – Bayesian LASSO – BayesB and BayesCπ – Random Forest Regression (RFR) • HTML & PDF Output ISMU 2.0 Pipeline Analysis Capabilities to ISMU 2.0
  • 24. Export to MS-Excel (Windows)
  • 30. Export to High Quality Graphics 300DPI
  • 31. Future Plans • Customized Parameters for GS Scripts • Integrating more Algorithms • Implementation of Cross Validation • Linking with IBWS • Data Import/Export Module • Online Version of ISMU 2.0 • Linking with Agricultural Genomics Network • Making available on more OS • Average GEBVs • Multi-trait GS • Capacity building in NARS Partners – 4th International Workshop on Next Generation Genomics and Integrated Breeding for Crop Improvement, Feb 19th -21st 2014