1. Genome
1
Genome
What is genome?
The total amount of genetic information in the chromosomes of an organism, including its
genes and DNA sequences. The genome of eukaryotes is made up of a single, haploid set of
chromosomes that is contained in the nucleus of every cell and exists in two copies in the
chromosomes of all cells except reproductive and red blood cells. The human genome is made
up of about 35,000 genes.
Why should we study about genomes?
Unique creation of body of organisms.
DNA is the blue print of life.
Human body has 1013 cells and each cell has 6 billion base pairs (A, C, G, T)
A hidden language/code determines which proteins should be made and when this
language is common to all organisms.
Origin of terminology:
• The term genome was used by German botanist Hans Winker in 1920 .
• Collection of genes in haploid set of chromosomes.
• Now it encompasses all DNA in a cell.
• In 1986 mouse geneticist Thomas Roderick used Genomics for “mapping, sequencing
and characterizing genomes”.
How many types of genomes are there in this world?
Prokaryotic genomes
Eukaryotic Genomes
Nuclear Genomes
Mitochondrial genomes
Chloroplast genomes
The genome sequences tell us about:
Everything about the organism's life
Its developmental program
Disease resistance or susceptibility
History
2. Genome
2
What is the human genome?
The human genome is the entire "treasury of human inheritance." The 46 human chromosomes
(22 pairs of autosomal chromosomes and 1pair sex chromosomes) between them house almost
3 billion base pairs of DNA that contains about 20,500 protein-coding genes. The coding regions
make up less than 5% of the genome (the function of the entire remaining DNA is not clear) and
some chromosomes have a higher density of genes than others.
Human genome organized by:
• 3% coding and rest of it junk (repetitive DNA).
• Nuclear and mitochondrial.
DNA sequence:
• 1 gtcgacccac gcgtccgtct tgaaagaata tgaagttgta aagagctggt aaagtggtaa
• 61 taagcaagat gatggaatct ggggctccta tatgccatacctgtggtgaacaggtggggc
• 121 atgatgcaaa tggggagcta tttgtggctt gccatgagtg tagctatccc atgtgcaagt
• 181 cttgtttcga gtttgaaatc aatgagggcc ggaaagtttg cttgcggtgt ggctcgccat
• 241 atgatgagaa cttgctggat gatgtagaaaagaaggggtc tggcaatcaatccacaatgg
• 301 catctcacct caacgattct caggatgtcg gaatccatgctagacatatc agtagtgtgt
• 361 ccactgtgga tagtgaaatg aatgatgaat atgggaatcc aatttggaag aatcgggtga
• 421 agagctgtaa ggataaagag aacaagaaga aaaagagaag tcctaaggct gaaactgaac
• Protein coding regions of Genes begin with ATG and end with either TAG, TGA or
TAA atg atg gaa tct ggg gct cct… use genetic code. M M E S G A P
Conclusion:
In modern molecular biology and genetics, the genome is the entirety of an organism's
hereditary information. So as a Student of Fisheries we have to know about genome which will
help us in our future study.
