This document summarizes a study investigating the gene expression and localization of group I metabotropic glutamate receptors (mGluRs) in the adult zebrafish brain. The study aims to determine if mGluR1 and mGluR5 are present at high levels in the adult zebrafish brain at the gene expression and protein localization levels. Methods include RNA extraction from zebrafish brains followed by RT-PCR and real-time PCR to analyze mGluR1 and mGluR5 gene expression. Immunohistochemistry will also be used to determine the localization of mGluR1 and mGluR5 proteins in zebrafish brain sections. Results may provide insights into using zebrafish models to study neurological diseases

1. Gene expression and
localization of group I mGluR in
Adult Brain Zebrafish
Elvin J. Estrada, MS Student
PUCPR Master of Science in Biotechnology

2. Glutamate Receptors
Glutamate
receptors
Ionotropic
AMPA NMDA Kainate
Metabotropic
mGlur group I
mGlur group
II
mGlur group
III

3. Ionotropic vs metabotropic receptors
Image from: http://webvision.med.utah.edu/imageswv/GLU5.jpeg

4. Why Zebrafish?
• 80% of homology
• Popular novel model in translational neuroscience research
• Both larval and adult zebrafish contribute to modeling complex brain
disorders.
• Zebrafish models can be used to study brain cancer, epilepsy, anxiety,
and autism.
• Zebrafish are a useful tool for genetic and small molecule screening.

5. mGluR 1 and mGluR 5
• Both G-proteins are coupled to phospholipase C and intracellular calcium
signalling
• mGluR 1 is linked to plasticity and long-term depression
• Learning and Memory
• mGluR Group I are found at high levels in (rat brain):
• Cerebellum
• Thalamus
• Olfactory bulb
• mGluR 1 is a potential therapeutic target for neurological diseases,
including:
• Schizophrenia
• Epilepsy
• Parkinson and Alzheimer diseases

6. Research Hypothesis
• We hypothesize that mGluRs group I is present at high level, at gene
expression and protein localization, in adult Zebrafish brain.

7. Specific Aims
• Specific Aim #1: To determine the gene expression of mGluR 1 and
mGluR 5 in whole-brain adult Zebrafish
• Specific Aim #2: To determine localization of mGluR 1 and mGluR 5 in
whole-brain adult Zebrafish.

8. Methodology
• Brains (n=29)
• 9- IHC
• 20- RNA extraction
Dissection
• Homogenization
• Centrifugation
• IHC
Brains
• Bradford Method (RNA
concentration and Quality)
• RT-PCR
• Real Time PCR
Assays

9. Research Methods
Zebrafish + H2O + isoflurane
Zebrafish Brain Dissection
4% Formaldehyde
Series Alcohol
Dehydration/Methyl
salicylate
Microtome Section 4
mm (Standard)
RNeasy
kit (Qiagen)
RT-PCR
and Real-
Time PCR

10. Specific Aim #1
• To determine the gene expression of mGluR 1 and mGluR 5 in whole-
brain adult Zebrafish.
• Dissection of Zebrafish adult brain
• anesthetize fish in 120uL/50ml dilution of isoflurane
• RNA extraction and RT-PCR
• 20 adult wildtype Zebrafish brain (AllPrep DNA/RNA/Protein Qiagen kit, 20mg)
• mGluR 1: Primer Forward 5’ TACAACCCCTCAAACAGCCC 3’, Primer Reverse: 3’
CGTGCCACAACAGAACAGTG 5’
• mGluR 5: Primer Forward: 5’ AACACGAGCGATGGACCAAA 3’, Primer Reverse: 3’
AAAGACATGGCAGCAAGGA 5’
• Primers mGluR 1/mGluR 5 (Primer 3 software design)
• Real-Time PCR

11. Specific Aim #2
• To determine localization of mGluR 1 and mGluR 5 in whole-brain
adult Zebrafish.
• Dissection of Zebrafish adult brain
• anesthetize fish in 120uL/50ml dilution of isoflurane
• Tissue Dehydration
• 4% formaldehyde whole Zebrafish brain
• Series alcohol concentration
• Group I mGluRs Immunohistochemistry
• slice (4-7 um in thickness)
• mAB rabbit mGluR1 (1:50)

12. IHC Process
Formalin-Fixed
Paraffin Embedded tissue
Prepare sections and mount on
slides
Add Primary antibody
Add HRP-linked Ab
Detect with DAB chromagen
Counterstain with hematoxylin
and Interpret result

13. Group I mGluR Expression
Muñoz et al. J Comparative Neurology, 1999.

14. Future Directions
• Our laboratory should direct its future experiments toward:
• Drug response assay
• Immunohistochemical analysis (Habenula)
• electrophysiological activity and molecular presence of
mGluRs
• To study the effect of mGluR on shoaling behavior

15. Acknowledgements
• Dr. Zaira Mateo
• Dr. Gladys Chompre
• Dr. Dinah Ramos
• Dr. Olga Santiago
• Dr. James Porter (PSM)
• Daisy Morales
• Undergraduate Student
• Roberto León
• Pedro Colon
• Maite León
• CEIBA BTEC program

17. References
• Kalueff, A., Stewart, A., & Gerlai, R. (2014, January 31). Zebrafish as an emerging
model for studying complex brain disorders. Trends in pharmacological sciences.
doi:10.1016/j.tips.2013.12.002
• Sidoryk-Wegrzynowicz, M., & Aschner, M. (2013, April 30). Manganese toxicity in
the central nervous system: the glutamine/glutamate-γ-aminobutyric acid
cycle. Journal of internal medicine. doi:10.1111/joim.12040
• Teles, M., Dahlbom, S., Winberg, S., & Oliveira, R. (2013, September 14). Social
modulation of brain monoamine levels in zebrafish. Behavioural brain research.
doi:10.1016/j.bbr.2013.07.012
• Haug, M., Gesemann, M., Mueller, T., & Neuhauss, S. (2013, April 30). Phylogeny
and expression divergence of metabotropic glutamate receptor genes in the brain
of zebrafish (Danio rerio). The Journal of comparative neurology.
doi:10.1002/cne.23240

18. References
• Magi, S., Arcangeli, S., Castaldo, P., Nasti, A., Berrino, L., Piegari, E., Bernardini, R.,
et al. (2013, September 30). Glutamate-Induced ATP Synthesis: Relationship
between Plasma Membrane Na+/Ca2+ Exchanger and Excitatory Amino Acid
Transporters in Brain and Heart Cell Models. Molecular pharmacology.
doi:10.1124/mol.113.087775
• McKenna, M. (2012, October 31). Substrate competition studies demonstrate
oxidative metabolism of glucose, glutamate, glutamine, lactate and 3-
hydroxybutyrate in cortical astrocytes from rat brain. Neurochemical research.
doi:10.1007/s11064-012-0901-3
• Gerlai, R., Chatterjee, D., Pereira, T., Sawashima, T., & Krishnannair, R. (2009, July
31). Acute and chronic alcohol dose: population differences in behavior and
neurochemistry of zebrafish. Genes, brain, and behavior. doi:10.1111/j.1601-
183X.2009.00488.x
• Scerbina, T., Chatterjee, D., & Gerlai, R. (2012, October 31). Dopamine receptor
antagonism disrupts social preference in zebrafish: a strain comparison study.
Amino acids. doi:10.1007/s00726-012-1284-0