Faculty of Law and Management
FUNDAMENTALS OF FINANCE
Lecture 5: Investment Evaluation Techniques
Presented by:
Dr Balasingham Balachandran
Professor of Finance
Department of Finance, La Trobe Business School
Investment Evaluation Techniques
2 These slides have been drafted by the La Trobe University School of Economics & Finance based on Berk (2011).
Topic Overview
Introduction to capital budgeting and investment
evaluation
Net Present Value (NPV)
Internal Rate of Return (IRR)
Payback Period (PP)
Accounting Rate of Return (ARR)
Choosing between projects when resources are
limited
These slides have been drafted by the Department of Finance, La Trobe Business School based on Berk (2014).
Investment Evaluation Techniques
Learning Objectives
Understand alternative decision rules and their
drawbacks
Choose between mutually exclusive investments
Rank projects when a company’s resources are
limited so that it cannot take all positive- NPV
projects
3
Investment Evaluation Techniques
4
The investment decision entails deciding which projects or investments
should be undertaken
Companies need to use investment evaluation techniques to determine
the value of the projects available to them
The final decision as to which projects a company should undertake is
known as ‘capital budgeting’
In this topic we will apply a number of techniques to the valuation of
individual projects
Investment evaluation and capital budgeting
Investment Evaluation Techniques
5
When a corporation allocates funds to long-term investment
projects, the outlay is made in the expectation of generating
future cash flows
In making the decision to invest in a project, the key
consideration is whether or not the proposal provides an
adequate return to investors
The process used to select projects to invest – capital budgeting
– is essentially a process to decide on the optimum use of scarce
resources
Investment evaluation and capital budgeting
Investment Evaluation Techniques
6
There are three fundamental stages in making capital budgeting
decisions:
Stage 1 is the forecasting of costs and benefits associated with a project – the most
important being the financial ones
Stage 2 involves the application of an investment evaluation technique to decide
whether a project is acceptable, or optimal amongst alternative projects
Stage 3 is the ultimate decision to accept or reject a project
The capital budgeting process
Investment Evaluation Techniques
7
In this lecture we will discuss the four best-known
investment evaluation techniques
Two of these are based on the discounted cash flow
(DCF) model:
Net present value (NPV)
Internal rate of return (IRR)
The other two are accounting-based techniques:
Payback
(Average) accounting rate of return (ARR)
Investment evaluation techniques
Investment ...
Capital budgeting involves planning expenditures for long-term assets that provide returns over several years. It is an important process that requires evaluating projects carefully due to their large size, long-term implications, and irreversible nature. Key aspects of capital budgeting include identifying and evaluating investment proposals, determining which provide the highest expected rates of return, and preparing a capital expenditure budget. Various techniques can be used to evaluate projects, including payback period, accounting rate of return, net present value, internal rate of return, and risk-adjusted methods that account for uncertainty in projected cash flows.
PGBM01 - MBA Financial Management And Control (2015-16 Trm1 A)Lecture 9 lon...Aquamarine Emerald
This document provides an overview of long-term decision making processes and techniques. It discusses the characteristics of long-term investments, the typical decision making process including initial investigation, evaluation, authorization, implementation and monitoring. It then covers techniques for evaluating investments, including payback period, accounting rate of return, net present value and internal rate of return. An example calculation compares two potential investment projects using these techniques, and recommends selecting the project with the highest net present value or internal rate of return.
Capital budgeting is the process of evaluating long-term investments to maximize shareholder wealth. It involves assessing projects that require fixed assets operating for over one year. The key evaluation techniques are payback period, net present value (NPV), and internal rate of return (IRR), with NPV preferred as it considers total cash flows over time. NPV accepts projects when the present value of inflows exceeds outflows, while IRR accepts projects when the rate of return exceeds the cost of capital.
This document discusses various capital budgeting techniques for evaluating long-term investment projects, including payback period, net present value (NPV), internal rate of return (IRR), and profitability index. It covers how to calculate and apply these methods to determine whether to accept or reject stand-alone and mutually exclusive projects. It also addresses challenges like unequal project lives and capital rationing.
The document discusses various capital budgeting techniques that students should be able to discuss, explain, analyze, calculate, determine, and provide examples of after completing a lesson. These include non-discounted payback period, accounting rate of return, net present value, profitability index, internal rate of return, independent investment projects, mutually exclusive investment projects, and incremental cash flow calculations. The techniques help companies evaluate long-term investment decisions by analyzing project cash flows and determining which projects will increase shareholder wealth.
Slide 1
8-1
Capital Budgeting
• Analysis of potential projects
• Long-term decisions
• Large expenditures
• Difficult/impossible to reverse
• Determines firm’s strategic direction
When a company is deciding whether to invest in a new project, large sums of money can be at stake. For
example, the Artic LNG project would build a pipeline from Alaska’s North Slope to allow natural gas to
be sent from the area. The cost of the pipeline and plant to clean the gas of impurities was expected to be
$45 to $65 billion. Decisions such as these long-term investments, with price tags in the billions, are
obviously major undertakings, and the risks and rewards must be carefully weighed. We called this the
capital budgeting decision. This module introduces you to the practice of capital budgeting. We will
consider a variety of techniques financial analysts and corporate executives routinely use for the capital
budgeting decisions.
1. Net Present Value (NPV)
2. Payback Period
3. Average Accounting Rate (AAR)
4. Internal Rate of Return (IRR) or Modified Internal Rate of Return (MIRR)
5. Profitability Index (PI)
Slide 2
8-2
• All cash flows considered?
• TVM considered?
• Risk-adjusted?
• Ability to rank projects?
• Indicates added value to the firm?
Good Decision Criteria
All things here are related to maximize the stock price. We need to ask ourselves the following
questions when evaluating capital budgeting decision rules:
Does the decision rule adjust for the time value of money?
Does the decision rule adjust for risk?
Does the decision rule provide information on whether we are creating value for the firm?
Slide 3
8-3
Net Present Value
• The difference between the market value of a
project and its cost
• How much value is created from undertaking
an investment?
Step 1: Estimate the expected future cash flows.
Step 2: Estimate the required return for projects of
this risk level.
Step 3: Find the present value of the cash flows and
subtract the initial investment to arrive at the Net
Present Value.
Net present value—the difference between the market value of an investment and its cost.
The NPV measures the increase in firm value, which is also the increase in the value of what the
shareholders own. Thus, making decisions with the NPV rule facilitates the achievement of our
goal – making decisions that will maximize shareholder wealth.
Slide 4
8-4
Net Present Value
Sum of the PVs of all cash flows
Initial cost often is CF0 and is an outflow.
NPV =∑
n
t = 0
CFt
(1 + R)t
NPV =∑
n
t = 1
CFt
(1 + R)t
- CF0
NOTE: t=0
Up to now, we’ve avoided cash flows at time t = 0, the summation begins with cash flow zero—
not one.
The PV of future cash flows is not NPV; rather, NPV is the amount remaining after offsetting the
PV of future cash flows with the initial cost. Thus, the NPV amount determines the incremental
value created by unde.
Capital budgeting involves planning expenditures for long-term assets that provide returns over several years. It is an important process that requires evaluating projects carefully due to their large size, long-term implications, and irreversible nature. Key aspects of capital budgeting include identifying and evaluating investment proposals, determining which provide the highest expected rates of return, and preparing a capital expenditure budget. Various techniques can be used to evaluate projects, including payback period, accounting rate of return, net present value, internal rate of return, and risk-adjusted methods that account for uncertainty in projected cash flows.
PGBM01 - MBA Financial Management And Control (2015-16 Trm1 A)Lecture 9 lon...Aquamarine Emerald
This document provides an overview of long-term decision making processes and techniques. It discusses the characteristics of long-term investments, the typical decision making process including initial investigation, evaluation, authorization, implementation and monitoring. It then covers techniques for evaluating investments, including payback period, accounting rate of return, net present value and internal rate of return. An example calculation compares two potential investment projects using these techniques, and recommends selecting the project with the highest net present value or internal rate of return.
Capital budgeting is the process of evaluating long-term investments to maximize shareholder wealth. It involves assessing projects that require fixed assets operating for over one year. The key evaluation techniques are payback period, net present value (NPV), and internal rate of return (IRR), with NPV preferred as it considers total cash flows over time. NPV accepts projects when the present value of inflows exceeds outflows, while IRR accepts projects when the rate of return exceeds the cost of capital.
This document discusses various capital budgeting techniques for evaluating long-term investment projects, including payback period, net present value (NPV), internal rate of return (IRR), and profitability index. It covers how to calculate and apply these methods to determine whether to accept or reject stand-alone and mutually exclusive projects. It also addresses challenges like unequal project lives and capital rationing.
The document discusses various capital budgeting techniques that students should be able to discuss, explain, analyze, calculate, determine, and provide examples of after completing a lesson. These include non-discounted payback period, accounting rate of return, net present value, profitability index, internal rate of return, independent investment projects, mutually exclusive investment projects, and incremental cash flow calculations. The techniques help companies evaluate long-term investment decisions by analyzing project cash flows and determining which projects will increase shareholder wealth.
Slide 1
8-1
Capital Budgeting
• Analysis of potential projects
• Long-term decisions
• Large expenditures
• Difficult/impossible to reverse
• Determines firm’s strategic direction
When a company is deciding whether to invest in a new project, large sums of money can be at stake. For
example, the Artic LNG project would build a pipeline from Alaska’s North Slope to allow natural gas to
be sent from the area. The cost of the pipeline and plant to clean the gas of impurities was expected to be
$45 to $65 billion. Decisions such as these long-term investments, with price tags in the billions, are
obviously major undertakings, and the risks and rewards must be carefully weighed. We called this the
capital budgeting decision. This module introduces you to the practice of capital budgeting. We will
consider a variety of techniques financial analysts and corporate executives routinely use for the capital
budgeting decisions.
1. Net Present Value (NPV)
2. Payback Period
3. Average Accounting Rate (AAR)
4. Internal Rate of Return (IRR) or Modified Internal Rate of Return (MIRR)
5. Profitability Index (PI)
Slide 2
8-2
• All cash flows considered?
• TVM considered?
• Risk-adjusted?
• Ability to rank projects?
• Indicates added value to the firm?
Good Decision Criteria
All things here are related to maximize the stock price. We need to ask ourselves the following
questions when evaluating capital budgeting decision rules:
Does the decision rule adjust for the time value of money?
Does the decision rule adjust for risk?
Does the decision rule provide information on whether we are creating value for the firm?
Slide 3
8-3
Net Present Value
• The difference between the market value of a
project and its cost
• How much value is created from undertaking
an investment?
Step 1: Estimate the expected future cash flows.
Step 2: Estimate the required return for projects of
this risk level.
Step 3: Find the present value of the cash flows and
subtract the initial investment to arrive at the Net
Present Value.
Net present value—the difference between the market value of an investment and its cost.
The NPV measures the increase in firm value, which is also the increase in the value of what the
shareholders own. Thus, making decisions with the NPV rule facilitates the achievement of our
goal – making decisions that will maximize shareholder wealth.
Slide 4
8-4
Net Present Value
Sum of the PVs of all cash flows
Initial cost often is CF0 and is an outflow.
NPV =∑
n
t = 0
CFt
(1 + R)t
NPV =∑
n
t = 1
CFt
(1 + R)t
- CF0
NOTE: t=0
Up to now, we’ve avoided cash flows at time t = 0, the summation begins with cash flow zero—
not one.
The PV of future cash flows is not NPV; rather, NPV is the amount remaining after offsetting the
PV of future cash flows with the initial cost. Thus, the NPV amount determines the incremental
value created by unde.
The document discusses various capital budgeting techniques for investment decision making including net present value (NPV), benefit-cost ratio (BCR), internal rate of return (IRR), payback period, and accounting rate of return (ARR). Examples are provided to illustrate how to use the techniques to evaluate potential projects. The key criteria are NPV (accept if greater than 0), BCR (accept if greater than 1), IRR (accept if greater than required rate of return), and payback period (accept if less than cutoff period).
04 EMSE 6410-LectureNotes-Evaluating a Single Project-Fall2022 (1) ch5&6.pptAliAbdulla63
1. The document discusses methods for evaluating capital investment projects, including net present value (NPV), internal rate of return (IRR), and payback period.
2. NPV considers the time value of money and incorporates the required rate of return, while IRR is the discount rate that results in an NPV of zero.
3. Examples are provided to demonstrate calculating NPV and IRR for projects. The preferred method is NPV since it assumes cash flows are reinvested at the required rate, while IRR assumes reinvestment at the project rate.
Capital budgeting ppt@ bec doms on financeBabasab Patil
Capital budgeting involves planning for large long-term expenditures on projects. Projects can be replacements, expansions, or new ventures with increasing risk levels. The key steps are analyzing cash flows, costs of capital, and techniques like payback period, net present value (NPV), and internal rate of return (IRR) to evaluate projects. NPV is preferred over IRR when they conflict. Methods like replacement chain and equivalent annual annuity address unequal project lives in comparisons. Capital may also be rationed with constrained maximization.
This document discusses various investment criteria for capital budgeting decisions, with a focus on net present value (NPV). It defines NPV as the difference between the present value of a project's future cash flows and the initial investment cost. The document provides examples of calculating NPV for projects and discusses how NPV accounts for the time value of money and risk. It also discusses other criteria like payback period, accounting rate of return, and internal rate of return. It notes that the internal rate of return is the discount rate that makes the NPV equal to zero. The document compares the advantages and disadvantages of each method and emphasizes that NPV is generally the best criteria to use for capital budgeting decisions.
A ppt on capital expenditure by corporate for MbaVishalMotwani15
Capital expenditure refers to large investments made by companies that are expected to generate benefits over multiple years. It involves evaluating potential investments based on factors like anticipated benefits, risk level, and payback period. Capital budgeting techniques help analyze projects using metrics like net present value (NPV), internal rate of return (IRR), accounting rate of return (ARR), profitability index, and payback period to determine which projects to undertake. Traditional non-discounted methods include payback period and ARR, while discounted cash flow methods like NPV and IRR incorporate the time value of money in decision making.
This document discusses various capital budgeting techniques including:
- NPV, payback period, IRR, profitability index, and linear programming. It provides examples of how to calculate and properly apply each technique. It also discusses potential pitfalls of some techniques like multiple IRRs. Capital rationing constraints can require using the profitability index approach. A post audit reviews actual vs predicted results to improve future forecasts and operations.
The document discusses capital budgeting and investment project evaluation. It states that when projects deliver discounted cash flows exceeding investment costs, shareholder value increases through stock price appreciation. Several capital budgeting techniques are described like net present value, internal rate of return, payback period. Risk analysis methods in capital budgeting are also covered like sensitivity analysis, scenario analysis and Monte Carlo simulation to incorporate risk.
The document discusses capital budgeting and investment project evaluation. It states that when projects are undertaken that are expected to generate discounted cash flows exceeding the initial investment, it increases the economic value of the company and benefits shareholders through stock price appreciation. It also briefly describes several capital budgeting techniques used to evaluate projects, such as payback period, net present value, internal rate of return, and discounted payback period.
The document discusses capital budgeting and investment project evaluation. It states that when projects deliver discounted cash flows exceeding investment costs, shareholder value increases through stock price appreciation. Several capital budgeting techniques are described like net present value, internal rate of return, payback period. Risk analysis methods in capital budgeting like sensitivity analysis and scenario analysis are also covered.
This document discusses various methods for evaluating engineering projects using cash flow analysis and discounted cash flow methods. It defines key terms like present value, net present value, internal rate of return, payback period, and discount rates. Examples are provided to illustrate how to use these methods to calculate metrics like NPV, IRR, payback period for both acceptance/rejection of projects.
This document discusses various methods for evaluating engineering projects using cash flow analysis and discounted cash flow methods. It defines key terms like present value, net present value, internal rate of return, payback period, and discount rates. Examples are provided to illustrate how to use these methods to calculate metrics like NPV, IRR, payback period for both acceptance/rejection of projects.
The document discusses various capital budgeting techniques used to evaluate investment projects, including:
1) The cash payback period method which calculates the years to recover initial costs from annual cash flows.
2) The net present value method which discounts future cash flows to determine if a project's present value exceeds costs.
3) The internal rate of return method which calculates the discount rate that sets a project's present value of cash flows equal to its costs.
4) The annual rate of return and profitability index methods which evaluate profitability as a percentage of investment size. Post-audits of actual results are recommended to improve future investment analyses.
The document outlines the session plan for evaluating capital projects. It discusses key capital budgeting concepts like net present value (NPV), internal rate of return (IRR), payback period, accounting rate of return. It provides examples and formulas to calculate these metrics and explains the decision rules for project selection using NPV, IRR and other techniques. The document also discusses other topics like discounted cash flow analysis, time value of money, types of projects and risk analysis in capital budgeting.
The document discusses various methods for analyzing the financial feasibility of a project, including net present value (NPV), payback period, discounted payback period, average accounting return, and internal rate of return (IRR). It then provides an example calculation of each method for a sample project with an initial investment of $165,000 and cash flows over 3 years. Based on the calculations, the project would be accepted based on the NPV and IRR methods but rejected according to the payback period, discounted payback period, and average accounting return methods.
Investment Decision — Capital Budgeting Techniques — Pay Back Method — Accounting Rate Of Return — NPV — IRR — Discounted Pay Back Method — Capital Rationing — Risk Adjusted Techniques Of Capital Budgeting. — Capital Budgeting Practices.
The document analyzes 3 potential investment projects for ABC Company using capital budgeting tools. Project A involves a $10 million equipment purchase with an NPV of $44 million and IRR of 79.79%. Project B is a $7 million expansion with an NPV of $22 million and IRR of 91.48%. Project C is a $2 million marketing campaign with an NPV of $33 million and IRR of 90.36%. All projects have positive NPVs and IRRs above required rates of return, making them worthwhile. The recommended order of projects from best to worst is Project A, Project C, then Project B.
This document discusses project costs, budgeting, and appraisal. It defines key terms like project costs, classifications of costs, and budgeting. It explains methods for forecasting, budgeting, and appraising projects. Project appraisal techniques like payback period, accounting rate of return, and net present value are explained in detail. Factors that affect project costs and the importance of project cost management are also discussed.
The document discusses various capital budgeting techniques used to evaluate long-term investment projects. It describes traditional methods like payback period and accounting rate of return, as well as discounted cash flow methods like net present value, internal rate of return, and profitability index. These time-adjusted methods account for the time value of money and required rate of return when analyzing projects. The document also discusses factors that introduce risk and uncertainty into capital budgeting decisions.
Chapter- III Techniques of Capital Budgeting
Concept, Significance, Nature and classification of capital budgeting decisions, cash flow computation- Incremental approach; Evaluation criteria- Pay Back Period, ARR, NPV, IRR and PI methods; capital rationing, Capital budgeting under risk and uncertainty.
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
More Related Content
Similar to Faculty of Law and Management FUNDAMENTALS OF FINANCE .docx
The document discusses various capital budgeting techniques for investment decision making including net present value (NPV), benefit-cost ratio (BCR), internal rate of return (IRR), payback period, and accounting rate of return (ARR). Examples are provided to illustrate how to use the techniques to evaluate potential projects. The key criteria are NPV (accept if greater than 0), BCR (accept if greater than 1), IRR (accept if greater than required rate of return), and payback period (accept if less than cutoff period).
04 EMSE 6410-LectureNotes-Evaluating a Single Project-Fall2022 (1) ch5&6.pptAliAbdulla63
1. The document discusses methods for evaluating capital investment projects, including net present value (NPV), internal rate of return (IRR), and payback period.
2. NPV considers the time value of money and incorporates the required rate of return, while IRR is the discount rate that results in an NPV of zero.
3. Examples are provided to demonstrate calculating NPV and IRR for projects. The preferred method is NPV since it assumes cash flows are reinvested at the required rate, while IRR assumes reinvestment at the project rate.
Capital budgeting ppt@ bec doms on financeBabasab Patil
Capital budgeting involves planning for large long-term expenditures on projects. Projects can be replacements, expansions, or new ventures with increasing risk levels. The key steps are analyzing cash flows, costs of capital, and techniques like payback period, net present value (NPV), and internal rate of return (IRR) to evaluate projects. NPV is preferred over IRR when they conflict. Methods like replacement chain and equivalent annual annuity address unequal project lives in comparisons. Capital may also be rationed with constrained maximization.
This document discusses various investment criteria for capital budgeting decisions, with a focus on net present value (NPV). It defines NPV as the difference between the present value of a project's future cash flows and the initial investment cost. The document provides examples of calculating NPV for projects and discusses how NPV accounts for the time value of money and risk. It also discusses other criteria like payback period, accounting rate of return, and internal rate of return. It notes that the internal rate of return is the discount rate that makes the NPV equal to zero. The document compares the advantages and disadvantages of each method and emphasizes that NPV is generally the best criteria to use for capital budgeting decisions.
A ppt on capital expenditure by corporate for MbaVishalMotwani15
Capital expenditure refers to large investments made by companies that are expected to generate benefits over multiple years. It involves evaluating potential investments based on factors like anticipated benefits, risk level, and payback period. Capital budgeting techniques help analyze projects using metrics like net present value (NPV), internal rate of return (IRR), accounting rate of return (ARR), profitability index, and payback period to determine which projects to undertake. Traditional non-discounted methods include payback period and ARR, while discounted cash flow methods like NPV and IRR incorporate the time value of money in decision making.
This document discusses various capital budgeting techniques including:
- NPV, payback period, IRR, profitability index, and linear programming. It provides examples of how to calculate and properly apply each technique. It also discusses potential pitfalls of some techniques like multiple IRRs. Capital rationing constraints can require using the profitability index approach. A post audit reviews actual vs predicted results to improve future forecasts and operations.
The document discusses capital budgeting and investment project evaluation. It states that when projects deliver discounted cash flows exceeding investment costs, shareholder value increases through stock price appreciation. Several capital budgeting techniques are described like net present value, internal rate of return, payback period. Risk analysis methods in capital budgeting are also covered like sensitivity analysis, scenario analysis and Monte Carlo simulation to incorporate risk.
The document discusses capital budgeting and investment project evaluation. It states that when projects are undertaken that are expected to generate discounted cash flows exceeding the initial investment, it increases the economic value of the company and benefits shareholders through stock price appreciation. It also briefly describes several capital budgeting techniques used to evaluate projects, such as payback period, net present value, internal rate of return, and discounted payback period.
The document discusses capital budgeting and investment project evaluation. It states that when projects deliver discounted cash flows exceeding investment costs, shareholder value increases through stock price appreciation. Several capital budgeting techniques are described like net present value, internal rate of return, payback period. Risk analysis methods in capital budgeting like sensitivity analysis and scenario analysis are also covered.
This document discusses various methods for evaluating engineering projects using cash flow analysis and discounted cash flow methods. It defines key terms like present value, net present value, internal rate of return, payback period, and discount rates. Examples are provided to illustrate how to use these methods to calculate metrics like NPV, IRR, payback period for both acceptance/rejection of projects.
This document discusses various methods for evaluating engineering projects using cash flow analysis and discounted cash flow methods. It defines key terms like present value, net present value, internal rate of return, payback period, and discount rates. Examples are provided to illustrate how to use these methods to calculate metrics like NPV, IRR, payback period for both acceptance/rejection of projects.
The document discusses various capital budgeting techniques used to evaluate investment projects, including:
1) The cash payback period method which calculates the years to recover initial costs from annual cash flows.
2) The net present value method which discounts future cash flows to determine if a project's present value exceeds costs.
3) The internal rate of return method which calculates the discount rate that sets a project's present value of cash flows equal to its costs.
4) The annual rate of return and profitability index methods which evaluate profitability as a percentage of investment size. Post-audits of actual results are recommended to improve future investment analyses.
The document outlines the session plan for evaluating capital projects. It discusses key capital budgeting concepts like net present value (NPV), internal rate of return (IRR), payback period, accounting rate of return. It provides examples and formulas to calculate these metrics and explains the decision rules for project selection using NPV, IRR and other techniques. The document also discusses other topics like discounted cash flow analysis, time value of money, types of projects and risk analysis in capital budgeting.
The document discusses various methods for analyzing the financial feasibility of a project, including net present value (NPV), payback period, discounted payback period, average accounting return, and internal rate of return (IRR). It then provides an example calculation of each method for a sample project with an initial investment of $165,000 and cash flows over 3 years. Based on the calculations, the project would be accepted based on the NPV and IRR methods but rejected according to the payback period, discounted payback period, and average accounting return methods.
Investment Decision — Capital Budgeting Techniques — Pay Back Method — Accounting Rate Of Return — NPV — IRR — Discounted Pay Back Method — Capital Rationing — Risk Adjusted Techniques Of Capital Budgeting. — Capital Budgeting Practices.
The document analyzes 3 potential investment projects for ABC Company using capital budgeting tools. Project A involves a $10 million equipment purchase with an NPV of $44 million and IRR of 79.79%. Project B is a $7 million expansion with an NPV of $22 million and IRR of 91.48%. Project C is a $2 million marketing campaign with an NPV of $33 million and IRR of 90.36%. All projects have positive NPVs and IRRs above required rates of return, making them worthwhile. The recommended order of projects from best to worst is Project A, Project C, then Project B.
This document discusses project costs, budgeting, and appraisal. It defines key terms like project costs, classifications of costs, and budgeting. It explains methods for forecasting, budgeting, and appraising projects. Project appraisal techniques like payback period, accounting rate of return, and net present value are explained in detail. Factors that affect project costs and the importance of project cost management are also discussed.
The document discusses various capital budgeting techniques used to evaluate long-term investment projects. It describes traditional methods like payback period and accounting rate of return, as well as discounted cash flow methods like net present value, internal rate of return, and profitability index. These time-adjusted methods account for the time value of money and required rate of return when analyzing projects. The document also discusses factors that introduce risk and uncertainty into capital budgeting decisions.
Chapter- III Techniques of Capital Budgeting
Concept, Significance, Nature and classification of capital budgeting decisions, cash flow computation- Incremental approach; Evaluation criteria- Pay Back Period, ARR, NPV, IRR and PI methods; capital rationing, Capital budgeting under risk and uncertainty.
Similar to Faculty of Law and Management FUNDAMENTALS OF FINANCE .docx (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan
CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan
CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan
CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan
CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan
This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan
CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan
This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan
CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan
CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan
CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan
CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan
CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
Cryptography is the application of algorithms to ensure the confiden.docxmydrynan
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations.
The following are the deliverables for this project:
Deliverables
Enterprise Key Management Plan:
An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations.
Enterprise Key Management Policy:
A two- to three-page double-spaced Word document.
Lab Report:
A Word document sharing your lab experience along with screenshots.
There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.”
When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
Step 1: Identify Components of Key Management
Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem.
Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care.
Review these authentication resources to learn about
authentication
and the characteristics of key management.
Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram.
Read these resources on
data at rest
, data in use, and
data in motion
.
Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed.
Review these resources on insecure handling, and identify areas where
insecure handling
may be a concern for your organization.
Incorporate this information in your key management plan.
In the next step, you will consider key management capabilities.
Step 3: Identify Key Management Gaps, Risks,
Solution
s, and Challenges
In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care.
Conduct independent research to identify typical gaps in key manage.
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan
CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
How to Manage Your Lost Opportunities in Odoo 17 CRMCeline George
Odoo 17 CRM allows us to track why we lose sales opportunities with "Lost Reasons." This helps analyze our sales process and identify areas for improvement. Here's how to configure lost reasons in Odoo 17 CRM
How to Build a Module in Odoo 17 Using the Scaffold MethodCeline George
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
Main Java[All of the Base Concepts}.docxadhitya5119
This is part 1 of my Java Learning Journey. This Contains Custom methods, classes, constructors, packages, multithreading , try- catch block, finally block and more.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar Kanvaria
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
Community pharmacy- Social and preventive pharmacy UNIT 5
Faculty of Law and Management FUNDAMENTALS OF FINANCE .docx
1. Faculty of Law and Management
FUNDAMENTALS OF FINANCE
Lecture 5: Investment Evaluation Techniques
Presented by:
Dr Balasingham Balachandran
Professor of Finance
Department of Finance, La Trobe Business School
Investment Evaluation Techniques
2 These slides have been drafted by the La Trobe University
School of Economics & Finance based on Berk (2011).
Topic Overview
evaluation
)
2. limited
These slides have been drafted by the Department of Finance,
La Trobe Business School based on Berk (2014).
Investment Evaluation Techniques
Learning Objectives
drawbacks
limited so that it cannot take all positive- NPV
projects
3
Investment Evaluation Techniques
4
investments
3. should be undertaken
determine
the value of the projects available to them
undertake is
known as ‘capital budgeting’
valuation of
individual projects
Investment evaluation and capital budgeting
Investment Evaluation Techniques
5
-term investment
projects, the outlay is made in the expectation of generating
future cash flows
nvest in a project, the key
consideration is whether or not the proposal provides an
adequate return to investors
4. – capital
budgeting
– is essentially a process to decide on the optimum use of scarce
resources
Investment evaluation and capital budgeting
Investment Evaluation Techniques
6
There are three fundamental stages in making capital budgeting
decisions:
with a project – the most
important being the financial ones
technique to decide
whether a project is acceptable, or optimal amongst alternative
projects
reject a project
The capital budgeting process
5. Investment Evaluation Techniques
7
-known
investment evaluation techniques
(DCF) model:
t present value (NPV)
-based techniques:
Investment evaluation techniques
Investment Evaluation Techniques
8
g projects, it is important to keep in mind the
type of projects being considered
6. as long as there are sufficient funds are available, a
company should invest in all acceptable independent
projects
Types of projects
Investment Evaluation Techniques
9
can
only choose one of them – the one that is ranked highest by
the evaluation technique being used
in the sense that accepting one project affects the cash flows
of another
7. the scope of this subject
Types of projects
Investment Evaluation Techniques
10
future cash
inflows and cash outflows that will result from undertaking a
project
and negative present values are then netted off
against one another to determine the net present value of the
project
-NPV projects and reject
negative-
NPV projects, because NPV measures the increase in value from
the
project
Net Present Value (NPV)
Investment Evaluation Techniques
8. 11
between
undertaking the project or paying the available cash back to
shareholders
e zero NPV indicates that the project yields the
same
future cash that the investors could obtain by investing
themselves
end of the
project exceeds the cash flow that investors could have
generated
Net Present Value (NPV)
Investment Evaluation Techniques
12
–that
is, in
terms of cash today.
9. The NPV decision rule
NPV = PV (Benefits) – PV (Costs)
(Eq. 8.1)
Investment Evaluation Techniques
13
where:
CFt = cash flow generated by the project in year t
r = the opportunity cost of capital
CF0 = the cost of the project (initial cash flow, if any)
n = the life of the project in years
The net present value of a project is calculated as
follows:
Net Present Value (NPV)
0
11. 14
Month: 0 1 2 3
4
Cash Flow: ($81.60) $28 $28 $28 $28
Cost of capital is10%
Investment Evaluation Techniques
get an NPV of
$7.2 million, which is positive.
million and will
increase the value of the firm.
15
Using the NPV Rule
NPV = -81.6 +
28
12. +
28
+
28
+
28
1+r (1+r)2 (1+r)3 (1+r)4
Investment Evaluation Techniques
capital.
project’s NPV over
a range of discount rates.
16
NPV Profile
is positive only when the
discount rates are less than 14%.
13. Investment Evaluation Techniques
17
Net Present Value (NPV)
Example:
A company is considering whether to outlay $500,000 for a
machine
that will generate $150,000 p.a. over the next 5 years. What is
the
NPV of this project, given an opportunity cost of capital of
10%?
Investment Evaluation Techniques
18
wealth of
shareholders
project
14. project,
which can be problematic
-finance-trained managers to
understand
Net Present Value (NPV)
Investment Evaluation Techniques
Payback Period
• Payback period is the amount of time required for an
investment
to generate cash flows to recover its initial cost.
• Steps in estimating the payback period are:
investment.
• An investment is acceptable if its calculated payback is less
than
some prescribed number of years.
15. Investment Evaluation Techniques
20
The payback technique
year before full recovery
cost to be recovered at start of year
cash flow during year
Investment Evaluation Techniques
21
The payback technique
Example:
Calculate the payback period for the following project.
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
16. Investment Evaluation Techniques
22
The payback technique
Example:
Calculate the payback period for the following project.
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Cum NCF
Investment Evaluation Techniques
23
The payback technique
Example:
Calculate the payback period for the following project.
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Cum NCF -900
17. Investment Evaluation Techniques
24
The payback technique
Example:
Calculate the payback period for the following project.
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Cum NCF -900 -700
Investment Evaluation Techniques
25
The payback technique
Example:
Calculate the payback period for the following project.
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Cum NCF -900 -700 100
18. Investment Evaluation Techniques
26
The payback technique
Example:
Calculate the payback period for the following project.
Year 0 1 2 3 4 5 6 Payback
Project A -1000 100 200 800 100 100 100
Cum NCF -900 -700 100 200 300 400 2.88 yrs
At the end of the third year, the sign of the cumulative net cash
flow
has changed from negative to positive. Therefore the payback
occurred during the third year. If we assume the year 3 cash
flow
is earned evenly
during year 3, the
payback period is:
years88.2
800
700
19. A
Payb ack
Investment Evaluation Techniques
27
Example
Cash flows for projects A to F are given
below:
Year A B C D E F
0 -900 -900 -900 -900 -900 -900
1 300 300 100 600 600 300
2 300 300 200 200 200 300
3 300 300 600 100 100 300
4 - 300 - - 100
Calculate the payback period for these projects A-F.
Which one is the best investment?
Investment Evaluation Techniques
20. 28
Example
Cash flows for projects I and D are given
below:
Year Project I Project D
0 (100) (100)
1 10 70
2 60 50
3 80 20
Investment Evaluation Techniques
29
Example continued
The significant cash flows occur in later years!
10 80 60
0 1 2 3
– 100
21. =
Cumulative – 100 – 90 – 30 50
PBPI 2 + 30/80 = 2.375
years
0
2.375
Project I
30
Investment Evaluation Techniques
30
Example Continued
The significant cash flows come early!
70 20 50
0 1 2 3
– 100
Cumulative – 100 – 30 20 40
PBPD 1 + 30/50 = 1.6 years
22. 0
1.6
=
Project D
30
Investment Evaluation Techniques
Decision Criteria Test - Payback
• Does the payback rule account for the time value of money?
• Does the payback rule account for the risk of the cash flows?
• Does the payback rule provide an indication about the
increase in value?
• Should we consider the payback rule for our primary
decision rule?
Investment Evaluation Techniques
Evaluation of Payback Period
23. ey and risk ignored.
-off date.
-term projects or Lacks a decision
criterion grounded in
economics.
Investment Evaluation Techniques
33
payback
period, except that the cash flows are discounted to present
value
24. the
outlay from discounted cash flows
takes account of the time value of money (for cash flows
within the payback period) but does not allow for risk, ignores
cash flows after the pay- back period and is subject to an
arbitrary cut-off
The discounted payback technique
Investment Evaluation Techniques
34
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
Cum NCF
25. Investment Evaluation Techniques
35
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF -1000
Cum NCF
Investment Evaluation Techniques
36
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
26. Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
Cum NCF
1.1
100
Investment Evaluation Techniques
37
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
27. = 91
Cum NCF
1.1
100
Investment Evaluation Techniques
38
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
= 91
Cum NCF
28. 1.1
100
2
1.1
200
Investment Evaluation Techniques
39
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
= 91
29. = 165
Cum NCF
1.1
100
2
1.1
200
Investment Evaluation Techniques
40
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
31. 100
5
1.1
100
6
1.1
100
Investment Evaluation Techniques
41
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
= 91
33. 5
1.1
100
6
1.1
100
Investment Evaluation Techniques
42
The discounted payback technique
Example:
Calculate the discounted payback period for the following
project
(discounting cash flows at a required rate of return of 10%).
Year 0 1 2 3 4 5 6 DPB
Project A -1000 100 200 800 100 100 100
Disc CF
-1000
= 91
36. about the increase in value?
• Should we consider the discounted payback rule for our
primary decision rule?
Investment Evaluation Techniques
Evaluation of Discounted Payback
Advantages
- Includes time value of money
- Easy to understand
- Does not accept negative NPV
investments
Disadvantages
- May reject positive NPV investments
- Arbitrary determination of acceptable
payback period
- Ignores cash flows beyond the cut-off
37. date
- Biased against long-term investments.
Investment Evaluation Techniques
45
capital,
and is based on accounting income and historical cost asset
figures
:
Average Accounting Rate of Return (ARR)
“cut-
off” rate, to determine whether to proceed with the project
capital invested average
income average
Investment Evaluation Techniques
46
There are four stages in calculating the ARR:
38. estimated (Note that
“income” takes into account not only cash but non-cash items
such as depreciation
(after depreciation) is
estimated
should be accepted
Average Accounting Rate of Return (ARR)
Investment Evaluation Techniques
47
Average Accounting Rate of Return (ARR)
Example: Step 1
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows of
$53m & $65m in years 1 &
39. 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow
Less depreciation
Taxable income
Less tax (30%)
Net income
Investment Evaluation Techniques
48
Average Accounting Rate of Return (ARR)
Example: Step 1
40. Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow 53 65
Less depreciation
Taxable income
Less tax (30%)
Net income
41. Investment Evaluation Techniques
68
Average Accounting Rate of Return (ARR)
Example: Step 1
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow 53 65
42. Less depreciation 50 50
Taxable income
Less tax (30%)
Net income
Investment Evaluation Techniques
50
Average Accounting Rate of Return (ARR)
Example: Step 1
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
43. corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow 53 65
Less depreciation 50 50
Taxable income 3 15
Less tax (30%)
Net income
Investment Evaluation Techniques
51
Average Accounting Rate of Return (ARR)
Example: Step 1
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
44. 1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow 53 65
Less depreciation 50 50
Taxable income 3 15
Less tax (30%) 1 5
Net income
Investment Evaluation Techniques
52
Average Accounting Rate of Return (ARR)
Example: Step 1
45. Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow 53 65
Less depreciation 50 50
Taxable income 3 15
Less tax (30%) 1 5
Net income 2 10
46. Investment Evaluation Techniques
53
Average Accounting Rate of Return (ARR)
Example: Step 1
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average net income
Year 1 2
Cash flow 53 65
47. Less depreciation 50 50
Taxable income 3 15
Less tax (30%) 1 5
Net income 2 10
Average = (2 + 10) / 2 = 6
Investment Evaluation Techniques
54
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
48. line basis, and the
corporate tax rate is 30%.
Calculate average investment
Year 0 1 2
Machine cost
Less accum.
depreciation
Investment
Investment Evaluation Techniques
55
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
49. 1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average investment
Year 0 1 2
Machine cost 100 100 100
Less accum.
depreciation
Investment
Investment Evaluation Techniques
56
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
50. year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average investment
Year 0 1 2
Machine cost 100 100 100
Less accum.
depreciation
0
Investment
Investment Evaluation Techniques
51. 57
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average investment
Year 0 1 2
Machine cost 100 100 100
Less accum.
52. depreciation
0 50
Investment
Investment Evaluation Techniques
58
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
53. Calculate average investment
Year 0 1 2
Machine cost 100 100 100
Less accum.
depreciation
0 50 100
Investment
Investment Evaluation Techniques
59
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
54. The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average investment
Year 0 1 2
Machine cost 100 100 100
Less accum.
depreciation
0 50 100
Investment 100 50 0
Investment Evaluation Techniques
60
Average Accounting Rate of Return (ARR)
Example: Step 2
Calculate the ARR for a 2-
55. year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate average investment
Year 0 1 2
Machine cost 100 100 100
Less accum.
depreciation
0 50 100
Investment 100 50 0
Average investment =
(100 + 50 + 0) / 3 = 50
56. Investment Evaluation Techniques
61
Average Accounting Rate of Return (ARR)
Example: Step 3
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate the ARR
Step 4
57. Compare the ARR to a target or
“cut-off” rate to accept or reject
Investment Evaluation Techniques
62
Average Accounting Rate of Return (ARR)
Example: Step 3
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
58. Calculate the ARR
Step 4
Compare the ARR to a target or
“cut-off” rate to accept or reject
%12
50
6
capital invested Avg
income Avg
Investment Evaluation Techniques
63
Average Accounting Rate of Return (ARR)
Example: Step 3
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
59. and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate the ARR
Step 4
Compare the ARR to a target or
“cut-off” rate to accept or reject
%12
50
6
capital invested Avg
income Avg
60. Investment Evaluation Techniques
64
Average Accounting Rate of Return (ARR)
Example: Step 3
Calculate the ARR for a 2-
year project involving a
machine that costs $100m
and will yield cash flows
of $53m & $65m in years
1 & 2.
The machine is to be
depreciated on a straight-
line basis, and the
corporate tax rate is 30%.
Calculate the ARR
Step 4
Compare the ARR to a target or
61. “cut-off” rate to accept or reject
%12
50
6
capital invested Avg
income Avg
Investment Evaluation Techniques
65
The ARR technique has a number of disadvantages,
including the fact that it:
related to
cash flows and are based on accounting techniques that may
vary
from company to company
62. -off” rate, but there is
little
theoretical or other guidance in setting an appropriate target
ARR
Average Accounting Rate of Return (ARR)
Investment Evaluation Techniques
66
on the
rate of return in the DCF equation rather than the NPV
present value
of a project’s cash inflows with the present value of its cash
outflows
rate at
which the NPV of the project is equal to 0
Internal Rate of Return (IRR)
64. C0 = the cost of the project (initial cash flow, if any)
n = the life of the project in years
r = the internal rate of return on the project
Investment Evaluation Techniques
68
calculator or
by trial-and-error
than the
cost of capital and reject it if its IRR is less than the cost of
capital
that these
methods use the same framework and inputs, so they should
result in
the same accept/reject decision
Internal Rate of Return (IRR)
65. Investment Evaluation Techniques
69
Internal Rate of Return (IRR)
Example:
Apply the IRR rule to a project that costs $100 million and
yields
$106 million in one year when the opportunity cost of capital is
7%.
Investment Evaluation Techniques
70
Internal Rate of Return (IRR)
Example:
Apply the IRR rule to a project that costs $100 million and
yields
$106 million in one year when the opportunity cost of capital is
7%.
67. Investment Evaluation Techniques
71
Internal Rate of Return (IRR)
Example:
Apply the IRR rule to a project that costs $100 million and
yields
$106 million in one year when the opportunity cost of capital is
7%.
0
1
0
1
106
0 100
69. Investment Evaluation Techniques
72
Internal Rate of Return (IRR)
Example:
Apply the IRR rule to a project that costs $100 million and
yields $106
million in one year when the opportunity cost of capital is 7%.
If the hurdle rate is set at
the cost of capital (7%),
the project is not
acceptable since the IRR
is below the hurdle rate.
0
1
0
1
106
0 100
71. Investment Evaluation Techniques
73
NPV
technique, it shares most of the latter’s advantages
s a percentage rate of return that is intuitive to most,
and can
easily be compared with rates of return on alternative
investment
Internal Rate of Return (IRR)
Investment Evaluation Techniques
Example —IRR
Initial investment = –$200
Year Cash flow
1 $ 50
2 100
3 150
n Find the IRR such that NPV = 0
72. 50 100 150
0 = –200 + + +
(1+IRR) 1 (1+IRR) 2 (1+IRR) 3
50 100 150
200 = + +
(1+IRR) 1 (1+IRR) 2 (1+IRR) 3
Investment Evaluation Techniques
a is a discount rate which gives a positive NPV
b is a discount rate which gives a negative NPV
c is the positive NPV at the discount rate a
d is the negative NPV at the discount rate b
)(
)(
dc
c
abaIRR
73. IRR - Trial and Error Method
Investment Evaluation Techniques
Example —IRR (continued)
Trial and Error
Discount rates NPV
0% $100
5% 68
10% 41
15% 18
20% –2
IRR is just under 20%
Investment Evaluation Techniques
77
Example
What is the project’s IRR?
10 80 60
75. 80 CFi (C3)
COMP IRR 18.13%
RCL CFi 2nd F C-CE = (clears CF registers)
Investment Evaluation Techniques
79
Conventional Projects
the beginning of the project
a series of cash inflows
–ve to
+ve); if so it is classed as conventional
76. Investment Evaluation Techniques
80
Non-conventional Projects
mmon is a cash outflow to set up the project,
followed
by a series of cash inflows, then a terminal cost to complete the
project (e.g., repair a damaged site)
urn, can occur in these
cases
(i.e., where a project has more than one sign change in the
77. series
of CFs)
Investment Evaluation Techniques
81
Inflow (+) or Outflow (–) in Year
0 1 2 3 4 5 C or NC?
– + + + + + C
– + + + + – NC
– – – + + + C
+ + + – – – C
– + + – + – NC
Examples of Cash Flows
79. Net cash flows -100 230 -132
Solving for the IRR, we find that IRR = 10% or 20%.
If the cost of capital were, say, 15%, it is unclear whether the
project should be undertaken using IRR.
An application of the NPV technique would resolve this
problem. (NPV = +$64.69).
Investment Evaluation Techniques
83
Example
and will generate the following cash flows:
80. – $150,000
eturn is 15%
Investment Evaluation Techniques
84
Example continued
Since the cash flows are non-conventional and indicate two sign
changes, there could be (at most) two IRRs – which is correct?
NPV = $1,769.54, so this suggests the project should be
accepted
Need to check to see if there are two IRRs
81. Can do this by drawing an NPV profile, i.e., calculate NPV for
different
values of the company cost of capital, r
Investment Evaluation Techniques
85
Example continued
r (%) NPV ($)
0 – 8,000.00
5 – 3,158.41
10 – 52.59
15 1769.54
20 2,638.89
25 2,800.00
84. Graph of NPV Profile
Investment Evaluation Techniques
87
Example continued
would accept the project
e get 10.11%, we would reject
it
should accept
85. Investment Evaluation Techniques
88
Example - No IRR
Year Cash Flows
0 – 9,000
1 8,000
2 2,000
3 4,000
4 12,000
5 – 20,000
(Try various values of r and see what happens to NPV!)
86. Investment Evaluation Techniques
89
Independent Projects
same
accept/reject decision, except for those non-
conventional projects where the CF patterns
result in either multiple, or no, internal rate of
return
Investment Evaluation Techniques
90
88. Independent Projects continued
Investment Evaluation Techniques
91
Mutually Exclusive Projects
be accepted, we need to rank them in
order of
acceptability
in the
scale or timing of the CFs), ranking should be based on NPV
and is
89. preferred
Investment Evaluation Techniques
92
Example - Mutually Exclusive Projects With Different Scale of
CFs
Cash flows for Projects I and D:
Year Project I Project D Project I-D
0 (100) (100) 0
1 10 70 (60)
2 60 50 10
3 80 20 60
90. problem case, and so we need to check it!
Investment Evaluation Techniques
93
Example - Construct NPV Profiles
IRRI and IRRD, and the crossover point (i.e., IRRI-D), and
graph them:
r
0
5
10
15
92. 5
Investment Evaluation Techniques
94
Example - Crossover Point
1. Find the difference between the CFs of the
projects (see data for Project I – D on slide 60)
2. Calculate the IRR for these CF differences
3. Can subtract cash flow of project D from project I
or vice versa
4. If the profiles don’t cross, then one project
dominates the other
97. they are discounted over shorter periods), and so NPVD >
NPVI
Why Do NPV Profiles Cross?
Investment Evaluation Techniques
98
The higher the opportunity cost, the more valuable are these
funds, so
a high r favours smaller projects
The IRR does not take into account the size of projects.
YEAR 0 1 IRR Which project is
better if the
opportunity cost of
capital is 5%?
98. Small project -10 15 50%
Large project -100 122 22%
project, and
returns $90m to shareholders, which is then reinvested at the
opportunity cost of capital (5%), their total wealth at the end of
the year
Investment Evaluation Techniques
99
99. Internal Rate of Return (IRR)
The IRR does not take into account the size of projects.
YEAR 0 1 IRR Which project is
better if the
opportunity cost of
capital is 20%?
Small project -10 15 50%
Large project -100 122 22%
The small project is favoured by the IRR technique. However:
project, and returns $90m to
shareholders, which is then reinvested at the opportunity cost of
capital (20%), their
15).
103. IRRA = 19.43%
IRRB =
22.17%
Investment Evaluation Techniques
102
Summary re NPV vs. IRR
-conventional cash flows – where cash flow signs
change more than once
104. flows is substantially different
Investment Evaluation Techniques
103
Drawbacks or Problems with IRR
105. Investment Evaluation Techniques
IRR rule to make investment decisions, the IRR itself
remains a very useful tool.
error in the cost of capital and the average return of the
investment.
make investment decisions can be hazardous.
104
IRR Versus the IRR Rule
106. Investment Evaluation Techniques
ine on IRR
timing of cash flows can lead to ranking projects incorrectly
using the IRR.
opportunity with the largest IRR can lead to a mistake.
are choosing between projects, or anytime when your
decision to accept or reject one project would affect your
decision on another project. In such a situation, always rely
on NPV.
105
Choosing Between Projects
107. Investment Evaluation Techniques
Choosing Between Projects when Resources are Limited
different amounts of a particular resource.
e is a fixed supply of the resource so that you cannot
undertake all possible opportunities, simply picking the highest-
NPV
opportunity might not lead to the best decision.
106
Investment Evaluation Techniques
107
Choosing Between Projects when Resources are Limited
108. - the NPV per unit
of resources consumed.
FORMULA
– 8.4
PI =
Value created
=
NPV
Resources consumed Resource consumed
Investment Evaluation Techniques
Table 8.4: Possible projects for $200 million budget
109. Choose B and C instead of A to maximize NPV
108
Investment Evaluation Techniques
Problem:
together a project proposal to develop a new home networking
router.
project
will require 50 software engineers.
hire
additional qualified engineers in the short run.
other
projects for these engineers:
110. 109
Example 7.5 Profitability Index with a Human Resource
Constraint
Investment Evaluation Techniques
Problem: How should NetIt prioritise these projects?
110
Example 7.5 Profitability Index with a Human Resource
Constraint
Project NPV ($ millions) Engineering Headcount
Router 17.7 50
Project A 22.7 47
Project B 8.1 44
111. Project C 14.0 40
Project D 11.5 61
Project E 20.6 58
Project F 12.9 32
Total 107.5 332
Investment Evaluation Techniques