1) Transmission of ESBL-producing Enterobacteriaceae was higher within households (22.7% for E. coli, 25% for K. pneumoniae) than in hospitals (4.5% for E. coli, 8.3% for K. pneumoniae).
2) Importation of ESBL-producers into hospitals was as frequent as nosocomial transmission.
3) Transmission of ESBL-K. pneumoniae may have been more efficient in hospitals than ESBL-E. coli, despite more infection control measures for K. pneumoniae cases.
1. This study analyzed 20,027 pneumococcal genome sequences from multiple countries and clustered them into 621 lineages called Global Pneumococcal Sequence Clusters (GPSCs).
2. Thirty-five dominant GPSCs contained over 100 isolates each. Both vaccine and non-vaccine serotypes were found in 22 of these dominant GPSCs before PCV introduction, indicating potential for serotype replacement.
3. Increased resistance to penicillin and multiple drug classes was found in some dominant GPSCs. The country of isolation predicted the antibiotic resistance patterns in most dominant GPSCs.
This document summarizes a doctoral thesis on the pharmaceutical and immunological challenges of fungal pathogens. The thesis explored the interactions between the pathogenic fungus Candida albicans and human immune cells like neutrophils and mast cells. It developed a high-throughput screening assay to identify small molecules that block the yeast-to-hypha transition in C. albicans, which is important for its virulence. The screening revealed several FDA-approved drugs with previously unknown antifungal activity. The thesis provides new insights into antifungal defenses and tools to discover more effective antifungal therapies.
This document discusses tuberculosis (TB) outbreaks reported in literature from the 1950s to 2013. It provides details on 186 TB outbreaks reported since 2000 across various settings like schools, hospitals, homeless shelters, and more. Characteristics of outbreaks discussed include their location, magnitude, impact, presence of drug resistance, high-risk populations affected, and environmental factors. Large, ongoing outbreaks involving strains resistant to isoniazid or multiple drugs are also mentioned. The document analyzes trends in recognized TB outbreaks and their characterization to understand transmission dynamics.
This document discusses a study analyzing the neutralizing antibody response in convalescent plasma from 3 survivors of Ebola virus disease (EVD). The plasma was tested for neutralizing activity against variants of Ebola virus as well as other ebolaviruses using a glycoprotein-pseudotyped lentiviral system with both full-length and cleaved glycoprotein. The results showed low neutralizing activity against full-length glycoproteins but broad and potent neutralizing activity against the cleaved glycoprotein forms, suggesting conserved epitopes are exposed upon cleavage. This could inform development of immunogens to induce broadly neutralizing antibodies.
1. The document discusses studying host-pathogen interactions from a clinical perspective, focusing on Listeria monocytogenes, Group B Streptococcus, and Chikungunya virus.
2. It addresses microbial species specificity, with L. monocytogenes as an example, and the importance of rational design of relevant animal models.
3. Key topics covered include microbial crossing of host barriers, microbial and host biodiversity, and the need for a holistic view of the infectious process that considers the microbial, host, and environmental factors.
Oxford coronavirus vaccine safe and promising, according to early human trial...Dr Matt Boente MD
The Oxford coronavirus vaccine was found to be safe and stimulate strong immune responses according to early human trials published in The Lancet. The Phase 1/2 trial involved 1077 volunteers and found no serious side effects. While more research is still needed, scientists were optimistic that the vaccine could produce immune cells that provide protection for an extended period. Larger trials are now underway in the UK, Brazil and South Africa to further test the vaccine's ability to protect against infection. However, researchers cautioned that safety must remain the top priority and that widespread vaccination will be needed to protect populations.
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
Guided by several doctors, Dr. Chavan Sneha S. presented on the role of viruses in periodontal diseases. The summary is:
1) Periodontal diseases have multiple etiological factors, and various viruses may play a role in their development, including herpesviruses like cytomegalovirus and Epstein-Barr virus.
2) These viruses are more frequently detected in aggressive periodontitis lesions compared to healthy sites or gingivitis, and their presence may impair host defenses allowing bacterial pathogens to proliferate.
3) Local reactivation of herpesviruses from latent infections in the periodontium has been proposed as one mechanism by which viruses could contribute to period
1. This study analyzed 20,027 pneumococcal genome sequences from multiple countries and clustered them into 621 lineages called Global Pneumococcal Sequence Clusters (GPSCs).
2. Thirty-five dominant GPSCs contained over 100 isolates each. Both vaccine and non-vaccine serotypes were found in 22 of these dominant GPSCs before PCV introduction, indicating potential for serotype replacement.
3. Increased resistance to penicillin and multiple drug classes was found in some dominant GPSCs. The country of isolation predicted the antibiotic resistance patterns in most dominant GPSCs.
This document summarizes a doctoral thesis on the pharmaceutical and immunological challenges of fungal pathogens. The thesis explored the interactions between the pathogenic fungus Candida albicans and human immune cells like neutrophils and mast cells. It developed a high-throughput screening assay to identify small molecules that block the yeast-to-hypha transition in C. albicans, which is important for its virulence. The screening revealed several FDA-approved drugs with previously unknown antifungal activity. The thesis provides new insights into antifungal defenses and tools to discover more effective antifungal therapies.
This document discusses tuberculosis (TB) outbreaks reported in literature from the 1950s to 2013. It provides details on 186 TB outbreaks reported since 2000 across various settings like schools, hospitals, homeless shelters, and more. Characteristics of outbreaks discussed include their location, magnitude, impact, presence of drug resistance, high-risk populations affected, and environmental factors. Large, ongoing outbreaks involving strains resistant to isoniazid or multiple drugs are also mentioned. The document analyzes trends in recognized TB outbreaks and their characterization to understand transmission dynamics.
This document discusses a study analyzing the neutralizing antibody response in convalescent plasma from 3 survivors of Ebola virus disease (EVD). The plasma was tested for neutralizing activity against variants of Ebola virus as well as other ebolaviruses using a glycoprotein-pseudotyped lentiviral system with both full-length and cleaved glycoprotein. The results showed low neutralizing activity against full-length glycoproteins but broad and potent neutralizing activity against the cleaved glycoprotein forms, suggesting conserved epitopes are exposed upon cleavage. This could inform development of immunogens to induce broadly neutralizing antibodies.
1. The document discusses studying host-pathogen interactions from a clinical perspective, focusing on Listeria monocytogenes, Group B Streptococcus, and Chikungunya virus.
2. It addresses microbial species specificity, with L. monocytogenes as an example, and the importance of rational design of relevant animal models.
3. Key topics covered include microbial crossing of host barriers, microbial and host biodiversity, and the need for a holistic view of the infectious process that considers the microbial, host, and environmental factors.
Oxford coronavirus vaccine safe and promising, according to early human trial...Dr Matt Boente MD
The Oxford coronavirus vaccine was found to be safe and stimulate strong immune responses according to early human trials published in The Lancet. The Phase 1/2 trial involved 1077 volunteers and found no serious side effects. While more research is still needed, scientists were optimistic that the vaccine could produce immune cells that provide protection for an extended period. Larger trials are now underway in the UK, Brazil and South Africa to further test the vaccine's ability to protect against infection. However, researchers cautioned that safety must remain the top priority and that widespread vaccination will be needed to protect populations.
International Journal of Engineering Research and Applications (IJERA) is an open access online peer reviewed international journal that publishes research and review articles in the fields of Computer Science, Neural Networks, Electrical Engineering, Software Engineering, Information Technology, Mechanical Engineering, Chemical Engineering, Plastic Engineering, Food Technology, Textile Engineering, Nano Technology & science, Power Electronics, Electronics & Communication Engineering, Computational mathematics, Image processing, Civil Engineering, Structural Engineering, Environmental Engineering, VLSI Testing & Low Power VLSI Design etc.
Guided by several doctors, Dr. Chavan Sneha S. presented on the role of viruses in periodontal diseases. The summary is:
1) Periodontal diseases have multiple etiological factors, and various viruses may play a role in their development, including herpesviruses like cytomegalovirus and Epstein-Barr virus.
2) These viruses are more frequently detected in aggressive periodontitis lesions compared to healthy sites or gingivitis, and their presence may impair host defenses allowing bacterial pathogens to proliferate.
3) Local reactivation of herpesviruses from latent infections in the periodontium has been proposed as one mechanism by which viruses could contribute to period
This document provides information about Staphylococcus aureus (staph), including methicillin-sensitive Staph aureus (MSSA) and methicillin-resistant Staph aureus (MRSA). It discusses the emergence of antibiotic resistance in staph over time, risk factors for MRSA infection, differences between community-acquired and healthcare-associated MRSA, and treatment approaches for soft tissue infections.
Epidemiology of Onychomycosis in Pernambuco, Northeastern of Brazil: Results ...CrimsonpublishersCJMI
Epidemiology of Onychomycosis in Pernambuco, Northeastern of Brazil: Results of a Laboratory-Based Survey by Gonçalves de Lima Neto in Cohesive Journal of Microbiology & Infectious Disease
- No differences in treatment success and mortality have been demonstrated between empiric conventional amphotericin B and lipid preparations in pediatric and adult trials for prolonged fever and neutropenia. Fewer breakthrough infections may occur with liposomal amphotericin B.
- Conventional amphotericin B and fluconazole appear equally effective in febrile neutropenic subjects not previously administered fluconazole. Voriconazole is not inferior to liposomal amphotericin B in managing fever and neutropenia in adults and adolescents, though equivalence has not been shown. Caspofungin appears as effective as liposomal amphotericin B in treating febrile neutropenic adults.
1. Researchers have developed a new DNA-based test that can more quickly and accurately distinguish between two potato pests called the golden nematode and pale cyst nematode.
2. The test identifies unique DNA sequences in the parasitism genes of each nematode species, allowing identification from small nematode samples.
3. Scientists also discovered a new species of Ehrlichia bacteria carried by ticks that can cause febrile illness in humans in Wisconsin and Minnesota. The most severe cases can impact multiple organs and effective treatment involves antibiotics like doxycycline.
The document discusses coronaviruses and their variants. It begins with a brief history of coronaviruses, noting their discovery in the 1930s and their naming due to their appearance under electron microscopy. It then discusses taxonomy and the MRCA of coronaviruses dating back to 8000 BCE. It provides details on SARS-CoV-1 and SARS-CoV-2, including their structures, receptors, and differences in infectiousness. It then summarizes transmission patterns and clinical symptoms of COVID-19 before discussing immune evasion strategies of coronaviruses and challenges to vaccine development. It concludes with an overview of coronavirus variants and classification systems.
Nosocomial Infections in Pediatric Intensive Care Unitijtsrd
Hospital acquired infection is one of the ignored causes that burden the developing country like India economically. The present prospective study was carried out in the Pediatric Intensive Care Unit (PICU) of a tertiary care teaching hospital in Mumbai. As intensive care units pose patients to higher risk of infection, they need more attention in view of reducing hospital acquired infections. This study was undertaken to determine the incidence rate, risk factors and organisms responsible for nosocomial infections along with antimicrobial sensitivity patterns of the pathogens. Among all the positive isolates two isolates were found to be multi drug resistant. The infection pattern was analyzed based on the different criteria viz. age of the patient, stay in ICU in terms of number of days and gender of the patient, to understand their roles in incidence of infection. The study intends to throw light upon the increasing incidences of nosocomial infections in hospitals and increase awareness among society to follow simple precautionary measures to avoid the loss. Sayali Daptardar"Nosocomial Infections in Pediatric Intensive Care Unit" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-2 | Issue-4 , June 2018, URL: http://www.ijtsrd.com/papers/ijtsrd14153.pdf http://www.ijtsrd.com/biological-science/microbiology/14153/nosocomial-infections-in-pediatric-intensive-care-unit/sayali-daptardar
This editorial summarizes recent research on oncolytic viruses for cancer therapy. It discusses how oncolytic viruses can directly kill tumor cells and induce immune responses. Clinical trials have explored various naturally occurring and engineered viruses to treat cancers like melanoma, hepatocellular carcinoma, and glioblastoma. Recent FDA approval of the first oncolytic virus therapy for melanoma marks progress in the field. However, many questions remain regarding optimal viruses, combinations, dosages and administration methods. The role of the immune system is complex, with barriers and opportunities to leverage. Future work is needed to address challenges and maximize the potential of this innovative cancer treatment approach.
The study characterized 270 MRSA isolates from Colombia to determine molecular epidemiology and virulence genes. PFGE analysis identified dominant clones related to the Chilean and USA300-0114 clones. MLST found sequence types ST1110 and ST1111 related to known clones. SCCmec typing showed types I, II, IVa-c. Virulence genes like enterotoxins, exfoliative toxins, and adhesins were present. Mortality was higher for HA-MRSA and infections like bacteremia. The presence of certain genes was associated with increased severity and pathology.
Antibiotic resistance is increasing in Gram Negative organisms. It is important to know the antibiogram of the hospital to start empirical therapy. It can serve as a reference to clinician looking for information on antibiotic resistance. A retrospective analysis of the isolates obtained from January 2016 to December 2016 was performed. Samples were processed as per CLSI guideline. A total of 718 isolates were obtained. These were analysed for the prevalence
of MDR/XDR/PDR. It was found that XDR isolates are prevalent in our teaching hospital. The study showed an emergence in pan drug resistant isolates. The knowledge of local antibiogram
along with strong antibiotic stewardship program can help in guiding antibiotic therapy.This reduces antibiotic pressure among organisms and hence development of resistance.
- The document discusses chronic granulomatous disease (CGD), an immunodeficiency caused by a defect in the NADPH oxidase complex resulting in recurrent infections.
- It covers the genetics, clinical presentation including infections by bacteria, fungi and mycobacteria, diagnostic testing such as NBT and DHR, and management including antimicrobial prophylaxis and IFN-γ therapy.
- Mendelian susceptibility to mycobacterial disease is also discussed, which is caused by defects in IFN-γ signaling and results in selective predisposition to mycobacterial infections despite otherwise normal health. Causative genes involved in IFN-γ production and response are identified.
El coronavirus, relacionado con el virus que causa el SARS (síndrome respiratorio agudo severo), ha desencadenado un renovado debate sobre si las variantes de laboratorio de ingeniería de virus con posible potencial pandémico valen los riesgos.
En un artículo publicado en Nature Medicine 1 el 9 de noviembre, los científicos investigaron un virus llamado SHC014, que se encuentra en murciélagos de herradura en China. Los investigadores crearon un virus quimérico, compuesto por una proteína de superficie de SHC014 y la columna vertebral de un virus del SARS que se había adaptado para crecer en ratones e imitar una enfermedad humana. La quimera infectó las células de las vías respiratorias humanas, lo que demuestra que la proteína de superficie de SHC014 tiene la estructura necesaria para unirse a un receptor clave en las células e infectarlas. También causó enfermedades en ratones, pero no los mató.
----------------------
Engineered bat virus stirs debate over risky research
Lab-made coronavirus related to SARS can infect human cells.
12 November 2015
An experiment that created a hybrid version of a bat coronavirus — one related to the virus that causes SARS (severe acute respiratory syndrome) — has triggered renewed debate over whether engineering lab variants of viruses with possible pandemic potential is worth the risks.
In an article published in Nature Medicine 1 on 9 November, scientists investigated a virus called SHC014, which is found in horseshoe bats in China. The researchers created a chimaeric virus, made up of a surface protein of SHC014 and the backbone of a SARS virus that had been adapted to grow in mice and to mimic human disease. The chimaera infected human airway cells — proving that the surface protein of SHC014 has the necessary structure to bind to a key receptor on the cells and to infect them. It also caused disease in mice, but did not kill them
Draft Genome Sequence of an Enterobacter Species Associated with Illnesses an...Pauline Ogrodzki
This document reports on the draft genome sequence of an Enterobacter species (strain 8706) associated with illnesses in infants and transmission from powdered infant formula. The genome was sequenced using Illumina sequencing and assembled into 187 contigs totaling 4.99 Mb. Phylogenetic analysis showed it clustered within the Enterobacter genus. Annotation identified genes related to virulence, antibiotic resistance, and stress response. The genome provides insight into an Enterobacter species permitted in powdered infant formula but which may present a risk to infant health.
Marios Stylianou_Paper III_Antifungal application of nonantifungal drugs.Marios Stylianou
This study screened 844 drugs from two libraries against Candida albicans to identify previously unknown antifungal activities. 26 drugs showed antifungal activity, including 12 standard antifungal drugs and 7 drugs previously reported to have anti-Candida activity. The screening identified 7 additional drugs with antifungal activity: amonafide, tosedostat, megestrol acetate, melengestrol acetate, stanozolol, trifluperidol, and haloperidol. Further analysis found these 7 drugs had antifungal activity comparable to the standard antifungal drugs against multiple Candida species. The aminopeptidase inhibitor tosedostat displayed broad antifungal activity, including against Candid
In a week when the coronavirus closures and quarantines hit like falling dominoes – the lockdown in Italy, the empty workplaces and college campuses in the U.S., suspended sports seasons, canceled festivals – far less attention fell on the global scientific community's drive to find treatments for the new virus.
In silico analysis of potential human T Cell antigens from Mycobacterium tube...Santhi Devasundaram
In silico analysis was used to predict MHC class I and class II promiscuous epitopes and
potential antigens, from 24 novel T cell antigens of Mycobacterium tuberculosis.
Majority of the antigens (16/24) had high affinity peptides to both MHC class I and
class II alleles and higher population coverage compared to well-proven T cell antigens
ESAT-6, CFP-10 and Ag85B. Among these, highest population coverage were calculated
for three novel T cell antigens Rv0733 (97.24%), Rv0462 (96.9%) and Rv2251 (96.3%).
Genomic epidemiology of Campylobacter jejuni associated with asymptomatic pae...Ben Pascoe
The document summarizes research on Campylobacter jejuni associated with asymptomatic paediatric infection in the Peruvian Amazon. It finds that isolates from Peruvian children have a local gene pool and genotypes rarely seen globally. Lineages associated with asymptomatic infection are proliferating in the region. Though globally circulating strains are present, the regional accessory genome content differs. Poultry is identified as the predominant infection source for children in the Peruvian Amazon. Further sampling is needed to better understand regional differences and reservoirs.
This document summarizes a study that examined the relationship between intestinal inflammation, dysbiosis (imbalances in the gut microbiome), and bacterial invasion in murine models of ileal Crohn's disease. The researchers found that moderate to severe intestinal inflammation induced by Toxoplasma gondii infection or high-dose indomethacin caused dysbiosis characterized by a shift from Gram-positive to Gram-negative bacteria and reduced microbial diversity. This dysbiosis was accompanied by invasion of mucosal tissues by adherent-invasive E. coli, similar to what is seen in human Crohn's disease. In contrast, mild intestinal inflammation induced by Giardia muris did not result in dysbiosis or bacterial
The study characterized the nasal microbiome of subjects with exacerbated asthma, non-exacerbated asthma, and healthy controls using 16S rRNA sequencing. It found that nasal bacterial composition significantly differed among the three groups. Relative to controls, subjects with asthma had higher levels of Bacteroidetes and Proteobacteria taxa. Four species - Prevotella buccalis, Dialister invisus, Gardnerella vaginalis, and Alkanindiges hongkongensis - were more abundant in asthma subjects. Metagenomic analysis also found differences in glycerolipid metabolism between asthma activity groups. The identified nasal bacteria could provide insight into asthma mechanisms and serve as potential biomarkers of asthma activity.
This study analyzed 321 infections caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria at a hospital in Rhode Island from 2006-2011. The number of such infections increased each year. While Klebsiella pneumoniae was previously dominant, there was a shift to Escherichia coli as the predominant organism. Resistance to common oral antibiotics was high. A comparison with studies in Pakistan found similar high resistance levels in ESBL-producing E. coli isolates from hospitalized patients in Islamabad and Peshawar.
This document provides information about Staphylococcus aureus (staph), including methicillin-sensitive Staph aureus (MSSA) and methicillin-resistant Staph aureus (MRSA). It discusses the emergence of antibiotic resistance in staph over time, risk factors for MRSA infection, differences between community-acquired and healthcare-associated MRSA, and treatment approaches for soft tissue infections.
Epidemiology of Onychomycosis in Pernambuco, Northeastern of Brazil: Results ...CrimsonpublishersCJMI
Epidemiology of Onychomycosis in Pernambuco, Northeastern of Brazil: Results of a Laboratory-Based Survey by Gonçalves de Lima Neto in Cohesive Journal of Microbiology & Infectious Disease
- No differences in treatment success and mortality have been demonstrated between empiric conventional amphotericin B and lipid preparations in pediatric and adult trials for prolonged fever and neutropenia. Fewer breakthrough infections may occur with liposomal amphotericin B.
- Conventional amphotericin B and fluconazole appear equally effective in febrile neutropenic subjects not previously administered fluconazole. Voriconazole is not inferior to liposomal amphotericin B in managing fever and neutropenia in adults and adolescents, though equivalence has not been shown. Caspofungin appears as effective as liposomal amphotericin B in treating febrile neutropenic adults.
1. Researchers have developed a new DNA-based test that can more quickly and accurately distinguish between two potato pests called the golden nematode and pale cyst nematode.
2. The test identifies unique DNA sequences in the parasitism genes of each nematode species, allowing identification from small nematode samples.
3. Scientists also discovered a new species of Ehrlichia bacteria carried by ticks that can cause febrile illness in humans in Wisconsin and Minnesota. The most severe cases can impact multiple organs and effective treatment involves antibiotics like doxycycline.
The document discusses coronaviruses and their variants. It begins with a brief history of coronaviruses, noting their discovery in the 1930s and their naming due to their appearance under electron microscopy. It then discusses taxonomy and the MRCA of coronaviruses dating back to 8000 BCE. It provides details on SARS-CoV-1 and SARS-CoV-2, including their structures, receptors, and differences in infectiousness. It then summarizes transmission patterns and clinical symptoms of COVID-19 before discussing immune evasion strategies of coronaviruses and challenges to vaccine development. It concludes with an overview of coronavirus variants and classification systems.
Nosocomial Infections in Pediatric Intensive Care Unitijtsrd
Hospital acquired infection is one of the ignored causes that burden the developing country like India economically. The present prospective study was carried out in the Pediatric Intensive Care Unit (PICU) of a tertiary care teaching hospital in Mumbai. As intensive care units pose patients to higher risk of infection, they need more attention in view of reducing hospital acquired infections. This study was undertaken to determine the incidence rate, risk factors and organisms responsible for nosocomial infections along with antimicrobial sensitivity patterns of the pathogens. Among all the positive isolates two isolates were found to be multi drug resistant. The infection pattern was analyzed based on the different criteria viz. age of the patient, stay in ICU in terms of number of days and gender of the patient, to understand their roles in incidence of infection. The study intends to throw light upon the increasing incidences of nosocomial infections in hospitals and increase awareness among society to follow simple precautionary measures to avoid the loss. Sayali Daptardar"Nosocomial Infections in Pediatric Intensive Care Unit" Published in International Journal of Trend in Scientific Research and Development (ijtsrd), ISSN: 2456-6470, Volume-2 | Issue-4 , June 2018, URL: http://www.ijtsrd.com/papers/ijtsrd14153.pdf http://www.ijtsrd.com/biological-science/microbiology/14153/nosocomial-infections-in-pediatric-intensive-care-unit/sayali-daptardar
This editorial summarizes recent research on oncolytic viruses for cancer therapy. It discusses how oncolytic viruses can directly kill tumor cells and induce immune responses. Clinical trials have explored various naturally occurring and engineered viruses to treat cancers like melanoma, hepatocellular carcinoma, and glioblastoma. Recent FDA approval of the first oncolytic virus therapy for melanoma marks progress in the field. However, many questions remain regarding optimal viruses, combinations, dosages and administration methods. The role of the immune system is complex, with barriers and opportunities to leverage. Future work is needed to address challenges and maximize the potential of this innovative cancer treatment approach.
The study characterized 270 MRSA isolates from Colombia to determine molecular epidemiology and virulence genes. PFGE analysis identified dominant clones related to the Chilean and USA300-0114 clones. MLST found sequence types ST1110 and ST1111 related to known clones. SCCmec typing showed types I, II, IVa-c. Virulence genes like enterotoxins, exfoliative toxins, and adhesins were present. Mortality was higher for HA-MRSA and infections like bacteremia. The presence of certain genes was associated with increased severity and pathology.
Antibiotic resistance is increasing in Gram Negative organisms. It is important to know the antibiogram of the hospital to start empirical therapy. It can serve as a reference to clinician looking for information on antibiotic resistance. A retrospective analysis of the isolates obtained from January 2016 to December 2016 was performed. Samples were processed as per CLSI guideline. A total of 718 isolates were obtained. These were analysed for the prevalence
of MDR/XDR/PDR. It was found that XDR isolates are prevalent in our teaching hospital. The study showed an emergence in pan drug resistant isolates. The knowledge of local antibiogram
along with strong antibiotic stewardship program can help in guiding antibiotic therapy.This reduces antibiotic pressure among organisms and hence development of resistance.
- The document discusses chronic granulomatous disease (CGD), an immunodeficiency caused by a defect in the NADPH oxidase complex resulting in recurrent infections.
- It covers the genetics, clinical presentation including infections by bacteria, fungi and mycobacteria, diagnostic testing such as NBT and DHR, and management including antimicrobial prophylaxis and IFN-γ therapy.
- Mendelian susceptibility to mycobacterial disease is also discussed, which is caused by defects in IFN-γ signaling and results in selective predisposition to mycobacterial infections despite otherwise normal health. Causative genes involved in IFN-γ production and response are identified.
El coronavirus, relacionado con el virus que causa el SARS (síndrome respiratorio agudo severo), ha desencadenado un renovado debate sobre si las variantes de laboratorio de ingeniería de virus con posible potencial pandémico valen los riesgos.
En un artículo publicado en Nature Medicine 1 el 9 de noviembre, los científicos investigaron un virus llamado SHC014, que se encuentra en murciélagos de herradura en China. Los investigadores crearon un virus quimérico, compuesto por una proteína de superficie de SHC014 y la columna vertebral de un virus del SARS que se había adaptado para crecer en ratones e imitar una enfermedad humana. La quimera infectó las células de las vías respiratorias humanas, lo que demuestra que la proteína de superficie de SHC014 tiene la estructura necesaria para unirse a un receptor clave en las células e infectarlas. También causó enfermedades en ratones, pero no los mató.
----------------------
Engineered bat virus stirs debate over risky research
Lab-made coronavirus related to SARS can infect human cells.
12 November 2015
An experiment that created a hybrid version of a bat coronavirus — one related to the virus that causes SARS (severe acute respiratory syndrome) — has triggered renewed debate over whether engineering lab variants of viruses with possible pandemic potential is worth the risks.
In an article published in Nature Medicine 1 on 9 November, scientists investigated a virus called SHC014, which is found in horseshoe bats in China. The researchers created a chimaeric virus, made up of a surface protein of SHC014 and the backbone of a SARS virus that had been adapted to grow in mice and to mimic human disease. The chimaera infected human airway cells — proving that the surface protein of SHC014 has the necessary structure to bind to a key receptor on the cells and to infect them. It also caused disease in mice, but did not kill them
Draft Genome Sequence of an Enterobacter Species Associated with Illnesses an...Pauline Ogrodzki
This document reports on the draft genome sequence of an Enterobacter species (strain 8706) associated with illnesses in infants and transmission from powdered infant formula. The genome was sequenced using Illumina sequencing and assembled into 187 contigs totaling 4.99 Mb. Phylogenetic analysis showed it clustered within the Enterobacter genus. Annotation identified genes related to virulence, antibiotic resistance, and stress response. The genome provides insight into an Enterobacter species permitted in powdered infant formula but which may present a risk to infant health.
Marios Stylianou_Paper III_Antifungal application of nonantifungal drugs.Marios Stylianou
This study screened 844 drugs from two libraries against Candida albicans to identify previously unknown antifungal activities. 26 drugs showed antifungal activity, including 12 standard antifungal drugs and 7 drugs previously reported to have anti-Candida activity. The screening identified 7 additional drugs with antifungal activity: amonafide, tosedostat, megestrol acetate, melengestrol acetate, stanozolol, trifluperidol, and haloperidol. Further analysis found these 7 drugs had antifungal activity comparable to the standard antifungal drugs against multiple Candida species. The aminopeptidase inhibitor tosedostat displayed broad antifungal activity, including against Candid
In a week when the coronavirus closures and quarantines hit like falling dominoes – the lockdown in Italy, the empty workplaces and college campuses in the U.S., suspended sports seasons, canceled festivals – far less attention fell on the global scientific community's drive to find treatments for the new virus.
In silico analysis of potential human T Cell antigens from Mycobacterium tube...Santhi Devasundaram
In silico analysis was used to predict MHC class I and class II promiscuous epitopes and
potential antigens, from 24 novel T cell antigens of Mycobacterium tuberculosis.
Majority of the antigens (16/24) had high affinity peptides to both MHC class I and
class II alleles and higher population coverage compared to well-proven T cell antigens
ESAT-6, CFP-10 and Ag85B. Among these, highest population coverage were calculated
for three novel T cell antigens Rv0733 (97.24%), Rv0462 (96.9%) and Rv2251 (96.3%).
Genomic epidemiology of Campylobacter jejuni associated with asymptomatic pae...Ben Pascoe
The document summarizes research on Campylobacter jejuni associated with asymptomatic paediatric infection in the Peruvian Amazon. It finds that isolates from Peruvian children have a local gene pool and genotypes rarely seen globally. Lineages associated with asymptomatic infection are proliferating in the region. Though globally circulating strains are present, the regional accessory genome content differs. Poultry is identified as the predominant infection source for children in the Peruvian Amazon. Further sampling is needed to better understand regional differences and reservoirs.
This document summarizes a study that examined the relationship between intestinal inflammation, dysbiosis (imbalances in the gut microbiome), and bacterial invasion in murine models of ileal Crohn's disease. The researchers found that moderate to severe intestinal inflammation induced by Toxoplasma gondii infection or high-dose indomethacin caused dysbiosis characterized by a shift from Gram-positive to Gram-negative bacteria and reduced microbial diversity. This dysbiosis was accompanied by invasion of mucosal tissues by adherent-invasive E. coli, similar to what is seen in human Crohn's disease. In contrast, mild intestinal inflammation induced by Giardia muris did not result in dysbiosis or bacterial
The study characterized the nasal microbiome of subjects with exacerbated asthma, non-exacerbated asthma, and healthy controls using 16S rRNA sequencing. It found that nasal bacterial composition significantly differed among the three groups. Relative to controls, subjects with asthma had higher levels of Bacteroidetes and Proteobacteria taxa. Four species - Prevotella buccalis, Dialister invisus, Gardnerella vaginalis, and Alkanindiges hongkongensis - were more abundant in asthma subjects. Metagenomic analysis also found differences in glycerolipid metabolism between asthma activity groups. The identified nasal bacteria could provide insight into asthma mechanisms and serve as potential biomarkers of asthma activity.
This study analyzed 321 infections caused by extended-spectrum beta-lactamase (ESBL)-producing bacteria at a hospital in Rhode Island from 2006-2011. The number of such infections increased each year. While Klebsiella pneumoniae was previously dominant, there was a shift to Escherichia coli as the predominant organism. Resistance to common oral antibiotics was high. A comparison with studies in Pakistan found similar high resistance levels in ESBL-producing E. coli isolates from hospitalized patients in Islamabad and Peshawar.
The prevalence of extended spectrum beta-lactamases (ESBLs) among Escherichia...Open Access Research Paper
The prevalence of extended spectrum β-lactamases among 246 clinical isolates from Abia State University teaching Hospital patients was investigated. The isolates were made up of 134 Escherichia coli and 112 Klebsiella species. Antimicrobial susceptibility of the isolates was determined by the disc diffusion method. ESBL phenotypes were determined by the double disc synergy method using ceftazidime, cefotaxime, ceftriaxone and co-amoxiclav. Out of the 246 isolates, 125 (50.8%) were ESBL producers, made up of 62(50.8%) E. coli and 63 (50.4%) Klebsiella isolates. Seventeen (54.8%) of the ESBL producing E. coli isolates were from in-patients while 45 (47.9%) were from out-patients. For the ESBL positive Klebsiella spp., 14 (45.2%) and 49 (52.1%) were from in-patients and out-patients respectively. ESBL producing isolates were also found to be more prevalent among the female patients (72.8%) than among the male patients (27.2%). The isolates also expressed high rates of resistance to other classes of antibiotics tested. However, Amikacin was found to have excellent performance against the urinary isolates tested and therefore is recommended for the treatment of infections caused by Escherichia coli and Klebsiella species. This study shows high prevalence of ESBL producing E. coli and Klebsiella isolates clinical samples of patients attending the Abia State University Teaching Hospital Aba, Abia State Nigeria.
Incidence of Tuberculosis in HIV Sero-positive Patients at HIV Clinic at Kamp...PUBLISHERJOURNAL
Incidence of Tuberculosis in HIV Sero-positive Patients at HIV Clinic at Kampala International University Teaching Hospital, Bushenyi District
Okello, Andrew
School of Allied Health Sciences Kampala International University-Western Campus
________________________________________
ABSTRACT
This study on the prevalence of TB among HIV sero-positive was carried at the HIV CLINIC of Kampala International University Teaching Hospital (KIUTH), Ishaka Bushenyi district. A retrospective cross-sectional study design was used to conduct this research. The study targeted all patients attending KIUTH HIV/TB clinic. A standard structured and semi-structured questionnaires were designed and pre-tested for validity and reliability at Kampala International University Teaching Hospital HIV/Tuberculosis clinic before being used for data collection. Data collection started by recruitment of qualified research assistants, appropriate training and orientation of the interviewers before the survey for example when reading the questions. Quantitative methods of data analysis was used in which data was presented in form of bar charts, graphs and tables. The prevalence of TB among HIV sero-positive patients attending HIV clinic at KIUTH stands at 8.06 per 100 participants. The study found that generally, people are aware about the modes of transmission of TB but there is still need for more awareness. Many patients are still not certain whether TB is curable in HIV patients. As seen from the above study, most of the people are not yet aware whether HIV goes hand in hand with tuberculosis. The prevalence of TB in HIV sero-positive attending HIV clinic at KIUTH is high. Generally, TB is affecting patients of all ages and most patients are still not aware if TB in HIV is curable. Most patients have a perception that all TB patients have HIV. Health workers in HIV clinic of KIU-TH should teach patients the modes of transmission and prevention of TB. KIUTH also need to provide easy access to TB screening services to patients. There is need for financial support by the government to the unemployed patients and low-income earners in order to curb TB infections.
Keywords: Tuberculosis, HIV, Sero-positive, Bushenyi District
________________________________________
This document discusses bovine spongiform encephalopathy (BSE), also known as mad cow disease, and its link to variant Creutzfeldt-Jakob disease (vCJD) in humans. BSE was first identified in cattle in the UK in 1987 and was spread through feeding cattle meat and bone meal from infected cows. It was later determined that BSE caused vCJD in humans who consumed contaminated beef products. While BSE affected over 180,000 cattle, it is estimated millions of infected cattle were consumed, putting thousands at risk for developing vCJD later in life. Fortunately, only around 230 cases of vCJD have been reported globally so far, with incidence declining in the UK since controls
Bacteria Isolated From the Cerebrio-Spinal Fluid (Csf) of Suspected Cases of ...iosrjce
This document summarizes a study that analyzed 742 cerebrospinal fluid (CSF) samples from suspected meningitis cases in Enugu State, Nigeria. 11 samples (1.5%) tested positive for bacteria. The main bacteria isolated were Escherichia coli (36.4%), Neisseria meningitidis (18.2%), Streptococcus pneumoniae (18.2%), Staphylococcus aureus (18.2%), and Pseudomonas aeruginosa (9.1%). 64% of cases were in children under 2 years old. All isolated bacteria were found to be sensitive to cephalosporins.
This document summarizes a study of pediatric bloodstream infections (BSIs) in Cambodia between 2007-2011. The key findings are:
- A total of 606 BSIs were identified in 588 children during the study period. The most common pathogens were Salmonella Typhi, Staphylococcus aureus, Streptococcus pneumoniae, Klebsiella pneumoniae, and Escherichia coli.
- Mortality from BSI was substantial at 19% overall, and higher in neonates at 37%. Factors associated with increased mortality included meningitis/meningoencephalitis and K. pneumoniae infection.
- Antimicrobial resistance was common, particularly among Enterobacteriaceae.
Is susceptibility to tuberculosis acquiredThanka Elango
This document discusses the complex interplay between genetic and environmental factors in determining susceptibility to tuberculosis. It summarizes recent research showing that some genetic susceptibility factors, like variants in the NRAMP1 gene, have a strong effect on tuberculosis risk only in certain epidemiological settings that involve low prior exposure to mycobacteria. Other susceptibility genes, like one found on chromosome 8q12-q13, appear to have a strong, independent effect regardless of environmental context. The document emphasizes that fully understanding tuberculosis susceptibility requires detailed knowledge of gene-environment interactions, as the same genetic variants may have highly variable effects in different populations and exposure settings.
Is susceptibility to tuberculosis acquiredThanka Elango
This document discusses the complex interplay between genetic and environmental factors in determining susceptibility to tuberculosis. It summarizes recent research showing that some genetic susceptibility factors, like variants in the NRAMP1 gene, have a strong effect on tuberculosis risk only in certain epidemiological settings or exposure histories, indicating gene-environment interactions are important. However, other loci, like one found on chromosome 8q12-q13, appear to have a strong, independent effect on risk across different populations and exposures. Understanding these interactions is key to explaining variability in individual susceptibility to tuberculosis in different contexts.
Is susceptibility to tuberculosis acquiredThanka Elango
This document discusses the question of whether susceptibility to tuberculosis is acquired or inherited. It summarizes recent research that suggests both acquired and inherited factors contribute to susceptibility. Some key points:
1) Studies of tuberculosis outbreaks and twin studies provide evidence that genetic factors play a role in susceptibility.
2) Genome-wide studies have identified some candidate genes associated with susceptibility, but results are not always replicated due to gene-environment interactions.
3) A study of a tuberculosis outbreak in a Canadian aboriginal community found a strong genetic effect of the NRAMP1 gene on susceptibility, but only when accounting for differences in individuals' exposure histories through "liability classes" modeling gene-environment interactions.
4) The
The molecular characterisation of Escherichia coli K1 isolated from neonatal ...Pauline Ogrodzki
This study characterized 30 E. coli strains isolated from the residual liquid and biofilms of neonatal nasogastric feeding tubes. The E. coli strains clustered into five pulsotypes and sequence types (ST). ST95 was the most common and encoded virulence traits associated with neonatal meningitis. ST95 and other strains were able to attach to and invade intestinal and brain cell lines, and persist in macrophages. The colonization of feeding tubes by these pathogenic E. coli strains poses a potential health risk to neonates.
Etiologia de la celulitis y Predicción clínica de la enfermedad Estreptocócic...Alex Castañeda-Sabogal
Etiologia de la celulitis. Estudio prospectivo y predicción clínica de la infeccion por Estreptococcus basado en la frecuencia encontrada de las especies de estreptococo
This study evaluated the diagnostic validity of cerebrospinal fluid (CSF) parameters for distinguishing tuberculous meningitis (TBM) from other causes of meningitis. The study assessed CSF analyses of adenosine deaminase activity, protein and glucose levels, and lymphocyte count in 157 patients in Peru, which has a high tuberculosis incidence. Adenosine deaminase activity above 6 U/l had the best performance, with 95% specificity and a positive likelihood ratio of 10.7, but only 55% sensitivity. No combination of CSF parameters achieved good performance for ruling out TBM. The study found that an elevated CSF adenosine deaminase level strongly supports a diagnosis of TBM
This study examined the relationship between atypical lymphocytes, large immature cells, platelet counts, and hematocrit in 79 patients with dengue virus infection. The results showed that increases in the percentage of atypical lymphocytes were associated with decreases in platelet count, suggesting atypical lymphocytes may play a role in platelet count fluctuations in dengue. A similar relationship was found between large immature cells and platelet count. The study supports the potential of atypical lymphocytes and large immature cells as predictive markers of the hematological changes seen in dengue, such as low platelet counts and increased hematocrit. However, limitations include the retrospective single-center design and lack of effective prognostic markers for vascular leakage in dengue.
An overview of Bacillus anthracis and its Potential Risks to North Carolina S...Kelsey Hall
This document provides an overview of Bacillus anthracis, the bacteria that causes anthrax. It discusses the potential risks of anthrax to North Carolina State University and describes anthrax's ability to infect both animals and humans. The document then summarizes NC State's emergency response protocols and prevention measures in place to respond to any anthrax outbreaks on campus. It concludes by stating that students attending NC State should not fear anthrax infections or its use as a bioterrorist weapon.
The word "vaccine" originates from the Latin word “vacca”, meaning “cow” a virus (cowpox) which manly effect the cow. which Edward Jenner demonstrated in 1798 could prevent smallpox in humans.
This document discusses Cryptococcal infections and Pneumocystis jirovecii pneumonia. It covers the epidemiology, life cycles, pathogenesis, clinical presentations, diagnostic modalities, and management of these fungal infections. Specifically, it notes that cryptococcosis has a worldwide distribution and causes life-threatening infections in HIV/AIDS patients. It affects the lungs and central nervous system. Pneumocystis jirovecii commonly causes pneumonia in immunosuppressed individuals, especially those with HIV/AIDS, and has clinical manifestations of fever, cough and dyspnea. Both infections are diagnosed using stains of respiratory samples and treated with antifungal medications like amphotericin and fluconazole.
This paper proposes a vaccine-dependent mathematical model to study the transmission dynamics of tuberculosis (TB) epidemics at the population level. The model divides the population into susceptible, latently infected unvaccinated, latently infected vaccinated, actively infected, recovered, and vaccinated classes. The paper proves the existence and uniqueness of a solution to the system of equations that defines the model. It also shows that the infection will die out if the basic reproduction number is less than one. The model could be used to estimate new TB infections and help design prevention and intervention strategies.
Leveraging Generative AI to Drive Nonprofit InnovationTechSoup
In this webinar, participants learned how to utilize Generative AI to streamline operations and elevate member engagement. Amazon Web Service experts provided a customer specific use cases and dived into low/no-code tools that are quick and easy to deploy through Amazon Web Service (AWS.)
How to Make a Field Mandatory in Odoo 17Celine George
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
Beyond Degrees - Empowering the Workforce in the Context of Skills-First.pptxEduSkills OECD
Iván Bornacelly, Policy Analyst at the OECD Centre for Skills, OECD, presents at the webinar 'Tackling job market gaps with a skills-first approach' on 12 June 2024
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
LAND USE LAND COVER AND NDVI OF MIRZAPUR DISTRICT, UPRAHUL
This Dissertation explores the particular circumstances of Mirzapur, a region located in the
core of India. Mirzapur, with its varied terrains and abundant biodiversity, offers an optimal
environment for investigating the changes in vegetation cover dynamics. Our study utilizes
advanced technologies such as GIS (Geographic Information Systems) and Remote sensing to
analyze the transformations that have taken place over the course of a decade.
The complex relationship between human activities and the environment has been the focus
of extensive research and worry. As the global community grapples with swift urbanization,
population expansion, and economic progress, the effects on natural ecosystems are becoming
more evident. A crucial element of this impact is the alteration of vegetation cover, which plays a
significant role in maintaining the ecological equilibrium of our planet.Land serves as the foundation for all human activities and provides the necessary materials for
these activities. As the most crucial natural resource, its utilization by humans results in different
'Land uses,' which are determined by both human activities and the physical characteristics of the
land.
The utilization of land is impacted by human needs and environmental factors. In countries
like India, rapid population growth and the emphasis on extensive resource exploitation can lead
to significant land degradation, adversely affecting the region's land cover.
Therefore, human intervention has significantly influenced land use patterns over many
centuries, evolving its structure over time and space. In the present era, these changes have
accelerated due to factors such as agriculture and urbanization. Information regarding land use and
cover is essential for various planning and management tasks related to the Earth's surface,
providing crucial environmental data for scientific, resource management, policy purposes, and
diverse human activities.
Accurate understanding of land use and cover is imperative for the development planning
of any area. Consequently, a wide range of professionals, including earth system scientists, land
and water managers, and urban planners, are interested in obtaining data on land use and cover
changes, conversion trends, and other related patterns. The spatial dimensions of land use and
cover support policymakers and scientists in making well-informed decisions, as alterations in
these patterns indicate shifts in economic and social conditions. Monitoring such changes with the
help of Advanced technologies like Remote Sensing and Geographic Information Systems is
crucial for coordinated efforts across different administrative levels. Advanced technologies like
Remote Sensing and Geographic Information Systems
9
Changes in vegetation cover refer to variations in the distribution, composition, and overall
structure of plant communities across different temporal and spatial scales. These changes can
occur natural.
How to Fix the Import Error in the Odoo 17Celine George
An import error occurs when a program fails to import a module or library, disrupting its execution. In languages like Python, this issue arises when the specified module cannot be found or accessed, hindering the program's functionality. Resolving import errors is crucial for maintaining smooth software operation and uninterrupted development processes.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
Walmart Business+ and Spark Good for Nonprofits.pdfTechSoup
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
This document provides an overview of wound healing, its functions, stages, mechanisms, factors affecting it, and complications.
A wound is a break in the integrity of the skin or tissues, which may be associated with disruption of the structure and function.
Healing is the body’s response to injury in an attempt to restore normal structure and functions.
Healing can occur in two ways: Regeneration and Repair
There are 4 phases of wound healing: hemostasis, inflammation, proliferation, and remodeling. This document also describes the mechanism of wound healing. Factors that affect healing include infection, uncontrolled diabetes, poor nutrition, age, anemia, the presence of foreign bodies, etc.
Complications of wound healing like infection, hyperpigmentation of scar, contractures, and keloid formation.
it describes the bony anatomy including the femoral head , acetabulum, labrum . also discusses the capsule , ligaments . muscle that act on the hip joint and the range of motion are outlined. factors affecting hip joint stability and weight transmission through the joint are summarized.
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.
2. 2
ABSTRACT
Background. Studies about transmission rates of extended-spectrum β-lactamase (ESBL)-
t
producing Enterobacteriaceae in hospitals and households are scarce.
rip
Methods. Eighty-two index patients with new carriage of ESBL-producing Escherichia coli
(ESBL-Ec; n=72) or Klebsiella pneumoniae (ESBL-Kp; n=10) and their hospital (n=112) and
household (n=96) contacts were studied prospectively between May 2008 and September
sc
2010. Isolates were phenotypically and molecularly (sequencing of bla genes, rep-PCR,
PFGE, MLST) characterized. Transmission was defined as carriage of a clonally-related
nu
ESBL-producer with identical blaESBL gene(s) in the index patient and its contact(s).
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
Results. CTX-M-15 was the most prevalent ESBL in Ec (58%) and Kp (70%) in the index
patients. Twenty (27.8%) ESBL-Ec isolates were of the hyperepidemic clone ST131. In the
Ma
hospital, transmission rates were 4.5% (ESBL-Ec) and 8.3% (ESBL-Kp) and the incidences of
transmissions were 5.6 (Ec) and 13.9 (Kp) per 1000 exposure days, respetively. Incidence of
ESBL-Kp hospital transmission was significantly higher than ESBL-Ec (p<0.0001), despite
implementation of infection control measures in 75% of ESBL-Kp index patients but only
d
22% of ESBL-Ec index patients. Detection of ESBL producers not linked to an index patient
pte
was as frequent (ESBL-Ec 5.7 %, ESBL-Kp 16.7 %) as nosocomial transmission events. In
households, transmission rates were 22.7% for ESBL-Ec and 25% for ESBL-Kp (p <0.001).
Conclusions. Household outweighs nosocomial transmission of ESBL producers. The impact
of hospital infection control measures may differ between different species and clones of
ce
ESBL producers.
Ac
3. 3
INTRODUCTION
Since the late 1980s, extended-spectrum β-lactamase (ESBL)-producing
t
Enterobacteriaceae, mainly Klebsiella pneumoniae (Kp), have been recognized as a major
rip
cause of nosocomial infections and outbreaks [1]. However, during the late 1990s, blaESBL
genes have increasingly been identified within the community setting in the context of urinary
tract infections (UTIs) caused by Escherichia coli (Ec) [2, 3]. Currently, the CTX-M-15 is
sc
recognized as the most widely distributed blaESBL among Enterobacteriaceae [4, 5] and the
worldwide spread of the Ec “hyper-epidemic” clone of sequence type (ST) 131 represent one
nu
of the major challenges for the health-care systems [6, 7].
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
An important strategy for controlling the spread of these multidrug-resistant (MDR)
pathogens is the identification of patients with risks for acquisition [2, 8]. In addition, active
Ma
surveillance and contact/isolation precautions are recommended
(http://www.premierinc.com/safety/topics/guidelines/cdc_guidelines.jsp). However, proposed
guidelines refer to the outbreak situations only and data about the efficiency of infection
control measures in the endemic hospital setting or even in the community are currently not
d
available [9, 10].
pte
Community spread of ESBL producers indicates that person-to-person transmission
may occur outside the hospital. However, data regarding household spread and risk factors
thereof are still limited [11, 12]. Prolonged carriage of ESBL producers in the gastrointestinal
tract of patients after hospital discharge may enhance such transmission [13]. Thus, a better
ce
understanding of the transmission dynamics of ESBL producers in this setting is warranted in
order to guide measures for the control of ESBL producers in the community.
Ac
In the present study, we prospectively evaluated transmission rates of ESBL-Ec and
ESBL-Kp from hospital index patients to hospital room mates and to household persons. Our
data indicate that the transmission rate is significantly higher within households than in our
non-outbreak hospital scenario.
4. 4
METHODS
Study setting and recruitment of patients. A prospective, longitudinal study was conducted
t
between May 1, 2008 and September 30, 2010. Index patients and their hospital contacts were
rip
recruited between May 1, 2008 and September 30, 2009 at the University Hospital of Bern
(Switzerland), a 1,033-bed tertiary-care hospital with a 30-bed mixed intensive care unit
(ICU), and more than 35,000 admissions resulting in 280,000 patient-days per year. Index
sc
patients included pediatric (< 10 years) and adult patients hospitalized or treated as
outpatients at the study center presenting with a newly detected carriage or infection with
nu
ESBL-Ec or ESBL-Kp. The study was conducted in accordance to local requirements of the
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
ethics committee.
Definitions. Patients were categorized as inpatients if they required admission to the hospital
Ma
for more than 24 hours. An index patient was defined as an in- or outpatient with a newly
recognized infection or colonization with ESBL-Ec or ESBL-Kp isolates. Hospital contact
patients were defined as roommates who shared the same wardroom, intensive or immediate
care room for 48 hours with an index patient. Household contact persons were defined as
d
persons who shared the same household with the index patient on a regular basis.
pte
Transmission was assumed when index patient and contacts shared a clonally-related (see
below) ESBL-Ec or ESBL-Kp isolate with identical blaESBL gene(s).
Data collection. For in- and outpatients included in the study, the presence of the following
risk factors for ESBL carriage active during the previous 3 months were considered: previous
ce
hospitalization, ICU stay, surgical procedures, use of indwelling devices (i.e., intravascular
and urinary catheters, endotracheal and naso-gastric tubes, tracheostomy, drainages),
Ac
peritoneal- or haemodialysis, urinary/fecal incontinence, recurrent UTI, intermittent self-
catheterization or other chronic urologic conditions, presence of skin lesions, domestic or
livestock animal husbandry, antibiotic treatment, immunosuppressive therapy (i.e., 20
mg/day prednisone, radio-/chemotherapy, or immunomodulators). The presence and severity
5. 5
of comorbidity was assessed at recruitment by calculating the Charlson comorbidity index
[14]. The patient setting (e.g., stay in a long-term care facility, hospital-acute care or stay in
t
private household) was recorded at recruitment (see below).
rip
Infection control policy. According to local infection control guidelines, patients with ESBL
carriage were put in contact isolation if they presented with any of the above mentioned risk
factors. The isolation protocol involved use of gloves by medical personnel during any
sc
physical contact and medical procedure. Occupation of a 2-bed room was possible if the
neighboring patient did not present any of these risk factors (which are assumed to enhance
nu
the risk of transmission). For ICU-patients isolation measures were implemented in 4-bed
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
rooms. Hospital-wide hand hygiene compliance is monitored on a yearly basis since 2005
using the SwissNOSO methodology. Overall, compliance was 62% in 2008, 63% in 2009 and
Ma
68% in 2010 (www.swissnoso.ch).
Screening and follow up program. The follow up period for in- and outpatients and their
contacts was 12 months except for death or stay abroad. For index inpatients, screening
samples were obtained at time of first detection of the ESBL-producing organism and weekly
d
thereafter until hospital discharge. After discharge of the index patient, samples were also
pte
collected from the household contact persons at 3 months intervals. Screening samples
included a fecal sample and for index patients only urines in the case of a Foley catheter,
respiratory samples in case of intubation or tracheostomy and, if applicable, drainage fluids
and swabs from skin lesions. Screening was stopped if the index patient and his/her household
ce
contacts tested negative in two consecutive screenings. For index outpatients, a fecal sample
was obtained at time of first detection of the ESBL producer and trimonthly thereafter. In
Ac
addition, screening samples were obtained in case of hospitalization at the study center during
the follow up period. Hospital contact patients were screened weekly until one week after
physical separation from the index patient and at hospital discharge if the last screening was
performed >7 days before discharge.
6. 6
Detection and phenotypic analysis of isolates. Stool samples were analyzed with different
selective culture media designed to detect cephalosporin resistant isolates: ChromID ESBL
agar (bioMérieux SA), BLSE agar (AES), a bi-plate with 2 selective media (MacConkey
t
rip
agar plus ceftazidime and Drigalski agar plus cefotaxime at a concentration of 2 and 1.5
mg/L, respectively) and CHROMagar ESBL (chromagar). Growing colonies were subject to
species identification by using standard biochemical methods and the Vitek 2 system
sc
(bioMérieux SA). Phenotypic confirmation of ESBL production was obtained by using the
double-disk synergy test with ceftazidime, cefpodoxime and aztreonam in combination with
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
amoxicillin-clavulanate [15]. Co-resistance to other antibiotics was assessed by disk diffusion
and interpreted according to the Clinical Laboratory Standards Institute criteria [16].
Multidrug-resistant (MDR) isolates were resistant to at least 1 representative of ≥3
Ma
antimicrobial classes as described [6].
Molecular characterization of ESBL-producing isolates. PCR for blaTEM and blaSHV genes
was performed as previously reported [17, 18]. For blaCTX-M genes, universal primers were
used as an initial screen revealing the distinct CTX-M groups 1, 2 and 4 [19]. Subsequently,
d
blaCTX-M group specific primers were used for amplification and sequencing CTX-Ms of
pte
group 1 (CTX-M_F_Grp1: TGGTTAAAAAATCACTGCGYCA; CTX-M_R_Grp1:
GTYGGTGACGATTTTAGCC; CTX-M_R2_Grp1: ACAGAYTCGGTTCGCTTTCA),
group 2 (CTX-M_F_Grp2: AATGTTAACGGTGATGGCGA; CTX-M_R_Grp2:
GATTTTCGCCGCCGCA) and group 4 (CTX-M_F_Grp4:
ce
AGAGARTGCAACGGATGATGT; CTX-M_R_Grp4: CCCYTYGGCGATGATTCTC;
CTX-M_F2_Grp4: CAGACGTTGCGTCAGCTTAC).
Ac
DNA sequencing was done according to the manufactures instructions using the ABI 3130
sequencer (Applied Biosystems). Sequences were analyzed using MEGA 4 [20], translated
into protein sequences and compared to those previously described
7. 7
(http://www.lahey.org/Studies/). Two new TEM types were identified (i.e., TEM-191 and
TEM-192) (Accession numbers JF949915 and JF949916).
t
Analysis of clonal relatedness. Phylogenetic groups (i.e., A, B1, B2 and D) of Ec were
rip
determined as previously reported [21]. Multi locus sequence typing (MLST) for selected Ec
and Kp isolates was done according to the Pasteur (Kp) and Achtman (Ec) schemes [22, 23].
Furthermore, all ESBL-Ec of phylogenetic group B2 were tested for the pabB allele to detect
sc
those of ST131 according to the Achtman scheme [24].
The relatedness of ESBL-Ec and ESBL-Kp isolates was also analyzed by pulse-field gel
nu
electrophoresis (PFGE) using the XbaI restriction enzyme and the repetitive extragenic
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
palindromic polymerase chain reaction (rep-PCR) [25, 26]. Resulting rep-PCR and PFGE
‘fingerprints’ were analyzed using bioanalyzer (Agilent Technologies) and GEL-COMPAR II
Ma
software (Applied Maths). The cosine coefficient and unweighted pair group method with
arithmetic averages was used for cluster analysis. Ec isolate were defined as clonally-related
when they shared the same phylogenetic group, >85% genetic relatedness by rep-PCR and
similar PFGE band patters as defined by Tenover’s criteria (i.e. differing by ≤ 3 bands) [26].
d
Clonally-related Kp isolates were defined as those of Ec but the rep-PCR cut-off was >90%
pte
Statistical analysis. Using STATA 10 (Stata Corporation), continuous and categorical
variables were tested by the Student’s t and the Fisher’s exact test (two tailed), respectively.
Kaplan-Meier curves were derived by Graph Pad Prism software and differences calculated
using the Logrank test.
ce
Ac
8. 8
RESULTS AND DISCUSSION
Index patients and molecular characteristics of ESBL producing isolates. A total of 82
t
index patients (48 inpatients and 34 outpatients) with an infection or colonization due to
rip
ESBL-Ec (n=72) or ESBL-Kp (n=10) were included into the study (Table 1). New index
cases were detected with a median frequency of 4.8 (range 1-9) patients per month but there
was no outbreak situation (Figure 1). The average incidence of index inpatients was
sc
0.12/1,000 patient-days (48 index inpatients for a total of 400,000 patient-days) in accordance
with a recent German study in which an incidence of 0.12/1,000 patient-days was observed
nu
[27].
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
Overall, the CTX-M-15 producers were the most prevalent ESBL-Ec (n=42) and
ESBL-Kp (n=7) isolates (Table 1). Ec clustered mainly within phylogenetic groups A, B2 and
Ma
D. 20 (27.8%) isolates were of ST131 according to the Achtman scheme (Table 1). Presence
of blaCTX-M-15 was associated with resistance to ciprofloxacin and gentamicin (p<0.001 and
p<0.001, respectively). As previously observed, ciprofloxacin resistance was highly prevalent
among Ec of ST131 [6].
d
Characteristics of index patients and sampling of ESBL-producing isolates. As shown in
pte
Table 2, 13% of index patients were children. An earlier Swiss study had already indicated
that this population may be an important reservoir of ESBL producers [28]. In accordance
with the literature, the urinary tract was the most frequent source of ESBL producers [2].
Index inpatients had more severe underlying disease and were more frequently referred from a
ce
hospital setting as compared to the index outpatients. Almost all index patients had received
antibiotic treatment during the 3 months prior to the detection of ESBL producers (Table 2).
Ac
The mean time between collection of the initial sampling and the first screening was
18.4 days (95% CI: 16.3-20.4). Fecal carriage of an identical ESBL producer as found in the
clinical sample was detected in the initial screen in 65% of out- and 71% of inpatients which
is comparable with a previous study [11]. Index inpatients stayed in the hospital for an
9. 9
average of 34.6 days (±37.1 days). Carriage of an ESBL producer was detected within 48
hours after hospital entry in 20 (42%) of the index inpatients (data not shown).
t
Transmission dynamics in the hospital. A total of 88 hospital patients were exposed for 715
rip
days to the 72 index patients with ESBL-Ec for a mean of 8.1 ±5.8 days. The average follow-
up time of the hospital contacts was 27.6±40.0 days. An ESBL-Ec was found in 9 of 88
(10.2%) contact patients (Supplemental Figure 1). According to the study definition,
sc
transmission from the index patient was assumed for 4 contacts (i.e., patients #36, #16, #110
and #70; Figure 2). The overall transmission rate for ESBL-Ec was therefore 4.5% (4 of 88
nu
exposed contacts) corresponding to an incidence of transmission of 5.6 per 1,000 exposure
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
days. The observed transmission rates were consistent to a report with a transmission rate of
2.8% and 4.2 per 1,000 exposure days, respectively [29].
Ma
A total of 24 hospital patients were exposed to the 8 index patients with ESBL-Kp
during 144 days for a mean of 6.0 ±4.3 days. ESBL-Kp was found in 7 of 24 (29.1%) hospital
contacts (Supplemental Figure 1) but transmission was plausible for only 2 (8.3%, incidence
13.8 per 1,000 exposure days) contacts (Figure 2). Therefore, the transmission rate was higher
d
for ESBL-Kp (8.3%) than for ESBL-Ec (4.5%), albeit the difference did not reach statistical
pte
significance. However, the incidences of Ec (5.6/1,000) and Kp (13.8/1,000) transmissions
resulted in a significant higher incidence of Kp transmission (p<0.0001). This suggests that
ESBL-Kp has a higher transmission potential than an ESBL-Ec, in accordance with the
frequency of ESBL-Kp nosocomial outbreaks being reported in the literature (supporting
ce
information literature search). Notably, the Kp STs involved in transmission events were
ST11 and ST323, which have been identified as frequently detected clones also carrying
Ac
blaKPC [30].
Impact of isolation precautions in the hospital. Most of the index ESBL-Ec patients (75%)
were not under isolation precautions during exposure of the contacts (537 of 715 exposure
days). In contrast, only 22% of ESBL-Kp index patients (32 of 144 exposure days) were not
10. 10
in isolation (p<0.001). Therefore, if isolation precautions were efficient, one might have
expected a higher transmission rate for ESBL-Ec than ESBL-Kp, whilst the opposite was
t
observed, in agreement with a higher transmission potential of ESBL-Kp as discussed above.
rip
However, the interpretation of this result requires some caution. In this study, index patients
were only isolated in case they had risk factors for transmission. Therefore, ESBL-Kp were
likely more prone to serve as a source of transmission than ESBL-Ec index patients.
sc
Furthermore, ESBL-Kp-colonized index patients were more often in the ICU for at least one
day (n=4; 50%) than the ESBL-Ec (n=11; 27.5 %) and might therefore have been undergoing
nu
more clinical procedures leading to transmission.
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
Transmission dynamics in the household setting. ESBL-Ec carriage was found in 31
(35.2%) of 88 household contacts but, based on the molecular analysis, transmission was
Ma
plausible for only 20 (22.7%) contacts (20 transmission within 19 household clusters; Figure
3). A Spanish study revealed a lower rate of transmission among household members of 6/54
(11.1%), but this may be explained with the different methodology of the studies [11].
Interestingly, in our study, there were six mother-to-child and two child-to-child pairs, which
d
again suggest an important role for children in the ESBL epidemiology (Figure 3). With
pte
regard to the Ec, the phylogenetic groups B2 (8 of 28 contacts) and D (9 of 34 contacts)
tended to be more often transmitted within households than groups A (3 of 19 contacts) and
B1 (0 of 7 contacts), though this difference did not reach statistical significance (p=0.1).
Nevertheless, the result is in accordance with the groups B2 and D being more transmittable
ce
and virulent [21, 31].
Comparable to ESBL-Ec, the household transmission rate of ESBL-Kp was 25% (2 of 8
Ac
contacts). Since previous studies were limited to ESBL-Kp transmission in hospitals [32, 33],
we are unable to compare our results with other studies but we note that the Kp STs involved
in household transmission were of ST15 and ST147, which have been described earlier as
epidemic [34].
11. 11
Overall, for both ESBL-Ec and ESBL-Kp the net transmission rate was higher within the
household than in the hospital, though this difference reached statistical significance only for
t
ESBL-Ec (p=0.001). One of the explanations for this difference could be related to the longer
rip
exposure times in the outpatient household compared to the hospital setting.
Detection dynamics of ESBL producers not linked to transmission. A considerable
number of ESBL-producers detected by screening of contact patients or household contacts
sc
could not be explained due to transmission to an index patient (Supplemental Figure 1). In the
hospital setting, this proportion was slightly higher than the prevalence of nosocomial
nu
transmissions for both ESBL-Ec (5.7% versus 4.5%) and ESBL-Kp (16.7% versus 8.3%). In
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
particular, the dynamics of detection of ESBL producers in contact patients was quite similar
for transmission and non-transmission events (Figure 4A). Probably, detection of ESBL
Ma
producers requires some selection process (e.g., exposure to antibiotics), which fluctuates
during hospitalization. Thus, standard screenings (e.g., selective agar plates) performed at one
time point only (e.g., at hospital entry) might therefore not detect all ESBL carriers. In the
household setting, chance findings of ESBL carriage were less frequent than transmission
d
events (ESBL-Ec 12.5% versus 22.7%; ESBL-Kp 0% versus 25%). However, the dynamics of
pte
ESBL detection over time were again quite similar for both groups (Figure 4B).
Limitations of this study. Our study has several limitations. First, the criteria for
transmissions set in this study did not address the possibility of horizontal transmission of
common plasmids among different Enterobacteriaceae species [35]. Thus, transmission rates
ce
might have been underestimated but this hypothetical bias should have affected both
household and hospital transmissions to the same extent. Secondly, our study could not
Ac
address whether household transmission occurred from the index patients to other household
members or by acquisition from a common source. In fact, several studies have suggested that
common sources like food may contribute to the dissemination ESBL producers [12, 36].
However, for two household contacts (index patients #118 and #158) person-to-person
12. 12
transmission was likely, since in both cases the corresponding index patients (#110 and #70)
acquired the ESBL producer during their hospital stay and transmitted it probably
t
subsequently to their household contacts (Figure 3). In addition, the high prevalence of CTX-
rip
M-15-producing Ec of ST131 also indicates person-to-person transmission since humans are
the main reservoir of this clone [6, 37]. Overall, based on our data we speculate that patients
recently discharged from a hospital or cared for as outpatients may be a more efficient source
sc
of transmission in the community than healthy carriers. Whether such transmission can be
controlled by preventative measures has to be evaluated.
nu
Conclusions. This is the first epidemiological study analyzing the transmission rates of ESBL
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
producers in the household and the hospital setting simultaneously (i.e., within the same time
period and within the same geographic area and with the same index patients). Our data
Ma
indicate that household transmission outweighs hospital transmission in a non-outbreak
scenario and household transmission is enhanced in the presence of index patients recently
discharged or cared for in a hospital. Furthermore, in the non-outbreak setting importation of
ESBL-producers into the hospitals seems to be at least as frequent as transmission events
d
during hospital stay. Our data also suggest that ESBL-Kp maybe more efficiently transmitted
pte
within the hospital than ESBL-Ec and they question the impact of infection control measures
especially for ESBL-Ec. Further studies are needed to address the last issue.
ce
Ac
13. 13
ACKNOWLEDGMENTS
Financial support. This work was supported by internal funds of the Institute for Infectious
t
Diseases, University of Bern, Bern, Switzerland.
rip
Potential conflicts of interest. All authors: no conflicts.
sc
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
d Ma
pte
ce
Ac
14. 14
References:
1. Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy,
t
typing methods, and pathogenicity factors. Clin Microbiol Rev 1998 Oct;11(4):589-603.
rip
2. Ben-Ami R, Rodriguez-Bano J, Arslan H, et al. A multinational survey of risk factors for
infection with extended-spectrum β-lactamase-producing Enterobacteriaceae in nonhospitalized
patients. Clin Infect Dis 2009 Sep 1;49(5):682-90.
sc
3. Pitout JD, Nordmann P, Laupland KB, Poirel L. Emergence of Enterobacteriaceae producing
extended-spectrum β-lactamases (ESBLs) in the community. J Antimicrob Chemother 2005
nu
Jul;56(1):52-9.
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
4. Coque TM, Novais A, Carattoli A, et al. Dissemination of clonally related Escherichia coli
strains expressing extended-spectrum β-lactamase CTX-M-15. Emerg Infect Dis 2008 Feb;14(2):195-
200.
Ma
5. Bush K, Fisher JF. Epidemiological expansion, structural studies, and clinical challenges of
new β-lactamases from gram-negative bacteria. Annu Rev Microbiol 2011;65:455-78.
6. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M. Escherichia coli
sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United
d
States. Clin Infect Dis 2010 Aug 1;51(3):286-94.
pte
7. Rogers BA, Sidjabat HE, Paterson DL. Escherichia coli O25b-ST131: a pandemic,
multiresistant, community-associated strain. J Antimicrob Chemother 2011 Jan;66(1):1-14.
8. Marchaim D, Gottesman T, Schwartz O, et al. National multicenter study of predictors and
outcomes of bacteremia upon hospital admission caused by Enterobacteriaceae producing extended-
ce
spectrum β-lactamases. Antimicrob Agents Chemother 2010 Dec;54(12):5099-104.
9. Laurent C, Rodriguez-Villalobos H, Rost F, et al. Intensive care unit outbreak of extended-
spectrum beta-lactamase-producing Klebsiella pneumoniae controlled by cohorting patients and
Ac
reinforcing infection control measures. Infect Control Hosp Epidemiol 2008 Jun;29(6):517-24.
10. Lucet JC, Decre D, Fichelle A, et al. Control of a prolonged outbreak of extended-spectrum
beta-lactamase-producing enterobacteriaceae in a university hospital. Clin Infect Dis 1999
Dec;29(6):1411-8.
15. 15
11. Valverde A, Grill F, Coque TM, et al. High rate of intestinal colonization with extended-
spectrum-β-lactamase-producing organisms in household contacts of infected community patients. J
Clin Microbiol 2008 Aug;46(8):2796-9.
t
rip
12. Rodriguez-Bano J, Lopez-Cerero L, Navarro MD, Diaz de Alba P, Pascual A. Faecal carriage
of extended-spectrum β-lactamase-producing Escherichia coli: prevalence, risk factors and molecular
epidemiology. J Antimicrob Chemother 2008 Nov;62(5):1142-9.
sc
13. Zahar JR, Lanternier F, Mechai F, et al. Duration of colonisation by Enterobacteriaceae
producing extended-spectrum β-lactamase and risk factors for persistent faecal carriage. J Hosp Infect
2010 May;75(1):76-8.
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
14. Charlson ME, Pompei P, Ales KL, MacKenzie CR. A new method of classifying prognostic
comorbidity in longitudinal studies: development and validation. J Chronic Dis 1987;40(5):373-83.
15. Jarlier V, Nicolas MH, Fournier G, Philippon A. Extended broad-spectrum β-lactamases
Ma
conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence
and susceptibility patterns. Rev Infect Dis 1988 Jul-Aug;10(4):867-78.
16. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial
Susceptibility Testing: Eighteenth Informational Supplement M100-S18. Wayne, PA, USA: CLSI.
d
2008.
17. Leverstein-van Hall MA, Fluit AC, Paauw A, Box AT, Brisse S, Verhoef J. Evaluation of the
pte
Etest ESBL and the BD Phoenix, VITEK 1, and VITEK 2 automated instruments for detection of
extended-spectrum beta-lactamases in multiresistant Escherichia coli and Klebsiella spp. J Clin
Microbiol 2002 Oct;40(10):3703-11.
ce
18. Sabate M, Miro E, Navarro F, et al. β-lactamases involved in resistance to broad-spectrum
cephalosporins in Escherichia coli and Klebsiella spp. clinical isolates collected between 1994 and
1996, in Barcelona (Spain). J Antimicrob Chemother 2002 Jun;49(6):989-97.
Ac
19. Pitout JD, Hossain A, Hanson ND. Phenotypic and molecular detection of CTX-M-β-
lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol 2004 Dec;42(12):5715-
21.
16. 16
20. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Mol Biol Evol 2007 Aug;24(8):1596-9.
21. Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli
t
rip
phylogenetic group. Appl Environ Microbiol 2000 Oct;66(10):4555-8.
22. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Multilocus sequence typing of
Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 2005 Aug;43(8):4178-82.
sc
23. Wirth T, Falush D, Lan R, et al. Sex and virulence in Escherichia coli: an evolutionary
perspective. Mol Microbiol 2006 Jun;60(5):1136-51.
24. Clermont O, Dhanji H, Upton M, et al. Rapid detection of the O25b-ST131 clone of
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
Escherichia coli encompassing the CTX-M-15-producing strains. J Antimicrob Chemother 2009
Aug;64(2):274-7.
25. Endimiani A, Hujer KM, Hujer AM, et al. Acinetobacter baumannii isolates from pets and
Ma
horses in Switzerland: molecular characterization and clinical data. J Antimicrob Chemother 2011
Oct;66(10):2248-54.
26. Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction
patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin
d
Microbiol 1995 Sep;33(9):2233-9.
27. Kola A, Holst M, Chaberny IF, Ziesing S, Suerbaum S, Gastmeier P. Surveillance of
pte
extended-spectrum beta-lactamase-producing bacteria and routine use of contact isolation: experience
from a three-year period. J Hosp Infect 2007 May;66(1):46-51.
28. Lartigue MF, Zinsius C, Wenger A, Bille J, Poirel L, Nordmann P. Extended-spectrum beta-
ce
lactamases of the CTX-M type now in Switzerland. Antimicrob Agents Chemother 2007
Aug;51(8):2855-60.
29. Fankhauser C, Zingg W, Francois P, et al. Surveillance of extended-spectrum-β-lactamase-
Ac
producing Enterobacteriaceae in a Swiss Tertiary Care Hospital. Swiss Med Wkly 2009 Dec
26;139(51-52):747-51.
17. 17
30. Giakkoupi P, Papagiannitsis CC, Miriagou V, et al. An update of the evolving epidemic of
blaKPC-2-carrying Klebsiella pneumoniae in Greece (2009-10). J Antimicrob Chemother 2011
Jul;66(7):1510-3.
t
rip
31. Karisik E, Ellington MJ, Livermore DM, Woodford N. Virulence factors in Escherichia coli
with CTX-M-15 and other extended-spectrum beta-lactamases in the UK. J Antimicrob Chemother
2008 Jan;61(1):54-8.
sc
32. Harris AD, Perencevich EN, Johnson JK, et al. Patient-to-patient transmission is important in
extended-spectrum β-lactamase-producing Klebsiella pneumoniae acquisition. Clin Infect Dis 2007
Nov 15;45(10):1347-50.
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
33. Asensio A, Oliver A, Gonzalez-Diego P, et al. Outbreak of a multiresistant Klebsiella
pneumoniae strain in an intensive care unit: antibiotic use as risk factor for colonization and infection.
Clin Infect Dis 2000 Jan;30(1):55-60.
Ma
34. Damjanova I, Toth A, Paszti J, et al. Expansion and countrywide dissemination of ST11, ST15
and ST147 ciprofloxacin-resistant CTX-M-15-type β-lactamase-producing Klebsiella pneumoniae
epidemic clones in Hungary in 2005--the new 'MRSAs'? J Antimicrob Chemother 2008
Nov;62(5):978-85.
d
35. Woodford N, Turton JF, Livermore DM. Multiresistant Gram-negative bacteria: the role of
high-risk clones in the dissemination of antibiotic resistance. FEMS Microbiol Rev 2011
pte
Sep;35(5):736-55.
36. Calbo E, Freixas N, Xercavins M, et al. Foodborne nosocomial outbreak of SHV1 and CTX-
M-15-producing Klebsiella pneumoniae: epidemiology and control. Clin Infect Dis 2011 Mar
ce
15;52(6):743-9.
37. Geser N, Stephan R, Korczak BM, Beutin L, Hachler H. Molecular identification of extended-
spectrum-beta-lactamase genes from Enterobacteriaceae isolated from healthy human carriers in
Ac
Switzerland. Antimicrob Agents Chemother 2012 Mar;56(3):1609-12.
18. 18
Table 1.Molecular characteristics and antibiotic-resistance patterns of ESBL-producing E. coli (Ec) and K.
pneumoniae (Kp) isolates
t
rip
Species and phylogenetic group (%)
Ec B2 Ec B2
Ec A Ec B1 Ec D Ec (all) Kp (all) Total
(pabB-) (pabB+)a
sc
Total 21 7 3 20 21 72 10 82
ESBL genes
blaCTX-M-1 4 (19) 1 (14) 1 (5) 6 (8) 6 (7)
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
blaCTX-M-14 1 (5) 3 (15) 3 (14) 7 (10) 1 (10) 8 (10)
blaCTX-M-15 12 (57) 2 (29) 1 (33) 14 (70) 13 (62) 42 (59) 6 (60) 48 (59)
blaCTX-M-15 and blaSHV-5 1 (10) 1 (1)
blaCTX-M-27
Ma 1 (14) 1 (5) 1 (5) 3 (4) 3 (3)
blaSHV-2/2A/5/12 1 (5) 1 (33) 1 (5) 3 (4) 2 (20) 5 (6)
Other 1 (5) 3 (43) 1 (33) 1 (5) 2 (10) 8 (11) 8 (10)
Unknown blaESBL 2 (10) 1 (5) 3 (4) 3 (4)
Resistance phenotype b
d
Gentamicin 8 (38) 2 (29) 2 (67) 11 (55) 13 (62) 36 (50) 10 (100) 46 (56) c
Ciprofloxacin 15 (71) 4 (57) 0 (0) 17 (85) 12 (57) 48 (67) 8 (80) 56 (68) d
pte
Trimethoprim-sulfamethoxazole 17 (81) 6 (86) 2 (67) 12 (60) 17 (81) 54(75) 9 (90) 63 (77)
Piperacillin-tazobactam 10 (48) 2 (29) 0 (0) 5 (25) 1 (5) 18 (25) 7 (70) 25 (30)
MDR isolatese 10 (48) 3 (43) 0 (0) 9 (45) 7 (33) 29 (40) 9 (90) 38 (46)
ce
a
Phylogenetic group B2 with pabB gene are indicative for ST131 according to the Achtman MLST scheme
b
Intermediate susceptibility was grouped as resistant
c
36/46 isolates carried blaCTX-M 15 (p<0.001)
d
41/56 isolates carried blaCTX-M 15 (p<0.001).
Ac
e
Multidrug-resistant (MDR) isolates were resistant to at least 1 representative of ≥3 antimicrobial classes as described [6].
19. 19
Table 2. Characteristics of the 82 index patients carrying ESBL-producing isolates
Index patients (n=82)
Outpatients Inpatients
t
Total 34 48
rip
Age, mean (±SD) 39.8 (±23.3) 58.2 (±21.5)
<10years 7 4
10-50years 14 5
>50years 13 39
Female (%) 29 (85) 23 (48)
sc
Charlson-Score, mean (±SD) 1.0 (±2.3) 3.0 (±2.7) a
Charlson-Score, age adjusted, mean (±SD) 1.7 (±2.6) 4.7 (±3.3) a
Referred from (%)
Household 34 (100) 25 (52)
Other Hospital 0 11 (23)
nu
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
Long-term care facility 0 4 (8)
Other 0 4 (8)
unknown 0 4 (8)
Type of sample with ESBL producer detected (%)
Urine 32 (94) 27 (56)
Ma
Blood culture 0 5 (10)
Tracheal aspirates 0 3 (6)
Wound 0 4 (8)
Feces 0 2 (4)
other 2 (6) 7 (15)
Antibiotic exposure during the 3 months before referring to hospital (%)
yes 30 (88) 39 (81)
d
no 2 (6) 0
unknown 2 (6) 9 (19)
pte
Antibiotic treatment at sampling date (%)
yes 14 (41) 32 (67)
no 15 (44) 5 (10)
unknown 5 (15) 11 (23)
Bacterial species with ESBLs (%)
E. coli 32 (94) 40 (83)
2 (6) 8 (17)
ce
K. pneumoniae
Initial screening of stools (%)
ESBL producer of the identical species b 22 (65) 34 (71)
ESBL producer of different species b 0 (0) 5 (10)
No ESBL producers detected 10 (29) 7 (15)
Ac
No initial screening done 2 (6) 2 (4)
a
Data were not available for 3 index patients
b
When compared to the first ESBL-producing isolate
20. 20
Figure legends
Figure 1.Number of new patients with ESBL-producing K. pneumoniae (Kp) or E. coli (Ec)
t
isolates detected between May 2008 and September 2009.
rip
Data regarding Ec are stratified according to the phylogenetic groups A, B1, B2 and D. Ec
isolates of group B2 which are positive for the pabB gene are indicative for ST131 according
to Achtman MLST scheme [24].
sc
Figure 2. Characteristics of hospital transmissions from index patients to HC (Hospital
contacts) of ESBL-producing K. pneumoniae (Kp) and E. coli (Ec).
nu
Sequence types (ST) are shown according to Pasteur (Kp) and Achtman (Ec) MLST scheme.
Downloaded from http://cid.oxfordjournals.org/ by guest on July 12, 2012
Furthermore, Ec isolates of group B2 which are positive for the pabB gene are indicative for
ST131 according to Achtman MLST scheme. Initial screening of feces samples revealed
Ma
identical results for 9 index patients. For the remaining, two ESBL-Ec instead of initial
ESBL-Kp were detected (i.e., index patients #186 and #115), whereas two negative stool
results were obtained (i.e., index patients #194 and #110)
Figure 3. Characteristics of household transmissions of ESBL-producing E. coli (Ec) and K.
d
pneumoniae (Kp). Index patients (index), hospital (HC) and household contacts (HHC) are
pte
indicated. Household clusters are shown in boxes. Presence of pabB gene is illustrated
(ST131 according to Achtman MLST scheme). Sequence types (ST) according to Pasteur
(Kp) and Achtman (Ec) MLST scheme
Figure 4. Detection of ESBL producers by Kaplan-Meier curves for A) the hospital and B)
ce
the household contacts.
“ESBL transmission” includes those contacts, which were found to carry the same ESBL
Ac
strain as the index patient and “ESBL no transmission” describes contacts with ESBL carriage
but without a match to the index patients’ strain (according to the definition given in the
methods section). ESBL-Ec and Kp are grouped together. Differences between the curves are
calculated using the Logrank test.