This document summarizes a study on standardizing Trichomonas foetus DNA testing across multiple laboratories. The study aimed to minimize variables that could influence sample or testing quality. It evaluated pooling of positive samples, different sample preparation methods, and real-time PCR protocols across five feeder labs compared to a central study lab. The study found 95.6% agreement between labs and confirmed 175 of 176 positive samples as T. foetus by DNA sequencing. Pooling was found to potentially miss some positives, with 1:5 pooling missing 4% and 1:3 pooling missing 3.5% of positives. The study supports standardizing sample collection, handling, preparation and PCR analysis to increase testing accuracy and consistency.

1. 1Proprietary & Confidential
Trich Laboratory Testing Standardization
Trichomonas foetus DNA testing
Proper & Confidential

2. 2Proprietary & Confidential
Objectives
To build confidence in Trich testing
To increase consistency in test results
To minimize sample quality influence variables
To minimize laboratory testing variables
To reduce the burden and cost to man and beast
Trich Laboratory Testing Standardization
Proper & Confidential

3. 3Proprietary & Confidential
Opportunities
 Veterinarian sample collection
 Veterinarian sample handling & shipment recommended by
Laboratory
 Laboratory sample preparation method
 Laboratory extract volume used
 Laboratory Taq enzyme type used
 Laboratory analysis threshold level
 Laboratory use of IPC (Internal Positive Control)
 Laboratory use of USDA licensed kits
 Laboratory pooling of samples
Trich Laboratory Testing Standardization
Proper & Confidential

4. 4Proprietary & ConfidentialThe world leader in serving scienceProprietary & Confidential
Pooling of cultured samples and comparison of multistate
laboratory workflows with the MagMAX sample
preparation system and VetMAX quantitative polymerase
chain reaction reagents for detection of Tritrichomonas
foetus–colonized bulls
Lee Effinger
Lalitha Peddireddi
Marilyn Simunich
Richard Oberst
Catherine O’Connell
Ivan Leyva-Baca
Oregon Department of Agriculture, Animal Health and Identification Division, Animal Health Laboratory, Salem, OR (Effinger)
Department of Diagnostic Medicine/Pathobiology (Peddireddi), Kansas State University, Manhattan, KS Kansas State
Veterinary Diagnostic Laboratory (Oberst), Kansas State University, Manhattan, KS Animal Health Laboratory, Idaho State
Department of Agriculture, Boise, ID (Simunich) Animal Health and Food Safety Group at Life Technologies, Austin, TX
(Leyva-Baca, O’Connell)
JVDI, 2014, Vol. 26(1) 72-87
Proper & Confidential

5. 5Proprietary & Confidential
Study Background
2010 AAVLD parasitology committee
• Proposed a study to determine whether T. foetus samples can be pooled in
order to reduce the costs for testing
• Lee Effinger from Oregon State Department of Agriculture led Experimental
Design for the project
• Marilyn Simunich Idaho State Department of Agriculture served as Study
Coordinator & Data Keeper
• The Life Technologies Animal Health & Food Safety Group agreed to support
the study
Proper & Confidential

6. 6Proprietary & Confidential
Study Objectives
1. Determine the effect of pooling a single positive sample having various
CT ranges with four negative samples (1:5). If a negative effect was
seen, a 1:3 pooling study would then be conducted
2. Compare different sample preparation systems and various real-time
PCR (feeder lab workflows) with the 5X MagMAXTM-pathogen
RNA/DNA purification kit and amplification with VetMAXTM T. foetus
reagents (Life Technologies workflow)
3. Assess the specificity of the VetMAXTM T. foetus reagents by
sequencing all positive samples with CT values less than 38 and
suspect sample CT values between 38 and less than 40 cycles
Proper & Confidential

7. 7Proprietary & Confidential
Materials and Methods
• Sample collection (Cultured Smegma Samples)
• 5 Feeder labs provided 803 samples
• 1 on the West Coast
• 1 in the Southwest
• 1 in the Central States
• 2 in the South
• Each feeder lab ran their own protocol including sample preparation
system and real-time PCR
 1 Central Study lab (KSVDL)
 Sample preparation with MagMAXTM
 Real-time PCR with VetMAXTM T. foetus reagents
Proper & Confidential

8. 8Proprietary & Confidential
Cultured smegma samples provided by feeder labs
Sample
Matrix
Source
# of positive
samples *
# of negative
samples*
# of inconclusive
samples *
Total samples
submitted
Cultured
smegma
samples
(A) 73 301 0 374
(B) 28 72 0 100
(C) 9 52 2 63
(D) 17 33 0 50
(F) 34 182 0 216
Total 161 640 2 803
* As reported by the feeder labs
Proper & Confidential

9. 9Proprietary & Confidential
Real Time PCR Parameters for Feeder Laboratories
Lab A Lab B Lab C Herds 1-2
Lab C Herds 3-
6
Lab D Lab F Study Lab
Final reaction volume(µL) 20 20 25 25 25 25 25
Vol. of T. foetus primer/probe per reaction
(µL)
1 1 1 1 1 0.88/1.13-F&R 1
Volume of extract per reaction(µL) 4 4 8 8 5 5 8
Volume Master Mix (µL) 15 15 12.5 12.5 19 18.75 12.5
Primer/probe design McMillen McMillen Vet-Max Vet-Max Vet-Max
Modified
McMillen
Vet-Max
Taq used Universal qPCR Universal qPCR qPCR MM qPCR MM
TaqMan
Univ.MM
Absolute qPCR
low rox mix
qPCR MM
Thermocycler AB 7500 AB 7500 Cepheid SC AB7500 AB7500 AB7500 AB7500
Thermocycler mode Standard Standard Fast Standard Standard
Stage 1 temperature(°C) 95 95 95 95 50/95 95 95
Stage 1 time (sec) 10 10 600 10 120/120 15 600
Stage2 denaturation (°C) 95 95 95 97 95 95 95
Stage 2 denaturation time (sec) 15 15 15 2 20 15 15
Stage 2 annealing temp (°C) 55 55 55 55 60 60 55
Stage 2 annealing time (sec) 45 45 45 40 45 60 45
# cycles 40 40 40 40 40 45 40
Analysis threshold Fixed 2.0 Fixed 2.0
Control based
threshold-10% max
TF/5% max Xeno
Control based
threshold-10%
max TF/5% max
Xeno
Fixed 0.2
Control based threshold- 10%
max TF/Xeno
Analysis baseline setting 3-15 3-15 auto
Positive (Ct) <35 <35 <36 <36 <38 <37 <38
Suspect/Inconclusive(CT) 35-40 35-40 36-40 36-40 38-39 >37 38-40/Xeno 28.5-31.5
Negative(CT) >40 >40 >40 >40 >40 undetected Undetected/Xeno 28.5-31.5
Internal extraction control No No Yes <36 CT Yes <36 CT No Yes Yes CT = 28.5-31.5
Proper & Confidential

10. 10Proprietary & Confidential
Results: Individual Sample Testing
Study Lab Result / Feeder Lab Result
Sample
Matrix
Lab
Source
Sample
preparation
system
Pos/Pos Pos/Neg Pos/Inc
PresPos
/Neg
Neg/Pos Neg/Inc Neg/Neg Total
Percent
agreement
Cultured
smegma
samples
A Boiling 71 5 0 1 2 0 295 374 97.9
B Boiling 21 10 0 0 7 0 62 100 83.0
C MagMax 9 2 2 0 0 0 50 63 96.7
D Boiling 17 4 0 1 0 0 28 50 90.0
F Qiagen 34 0 0 1 0 0 181 21 6 99.5
Results All labs Multiple 152 21 2 3 9 0 616 803 95.6
Order of the call = KSVDL Study Lab / Feeder Laboratory
Pos = positive, Neg = negative, Inc = inconclusive, PresPos= presumptive positive
Study Lab Results vs. Feeder Lab Results
Proper & Confidential

11. 11Proprietary & Confidential
Conclusions Individual Testing
• 803 smegma samples were provided by feeder labs (FL)
• All the samples were tested by study laboratory with Life Technologies
workflow systems:
• MagMAXTM
• VetMAXTM T. foetus reagents
• Agreement of 95.6% was reached with 768/803 samples between feeder labs
and study lab
• Interestingly, Lab F reached almost 100% agreement using a different sample
prep system and a modified McMillen’s assay
• Study laboratory (KSVDL) with LT protocol identified 24 more positives than
the feeder laboratories. On retesting, one of the feeder labs missed 9
samples reported as positives.
Proper & Confidential

12. 12Proprietary & Confidential
Pooling Study
Laboratory ID
Positive Samples
Available
Negative Samples
Available
Negatives Needed
Deficit /Surplus of
Negative Samples
A 77 297 308 -11
B 31 69 124 -55
C 13 50 52 -2
D 21 28 84 -56
F 34 181 136 +45
Total 176 625 704
Positives, presumptive positive and negative samples used from each lab for pooling
Proper & Confidential

13. 13Proprietary & Confidential
Pooling results
Sample ID* Individual test CT
Pooled1:5 Test
CT
Pooled1:3 Test
CT
Study lab final call
Pooled 1:5
call
Pooled 1:3 call
1 C-6-11 35.05 Undetected Undetected Positive Negative Negative
2 A-40-5 35.20 37.83 37.86 Positive Positive Positive
3 A-39-2 35.41 35.93 34.82 Positive Positive Positive
4 F-1-7 35.43 35.43 35.53 Positive Positive Positive
5 F-18-1 35.52 36.16 34.75 Positive Positive Positive
6 C-1-23 35.93 35.75 35.82 Positive Positive Positive
7 B-8-4 36.02 34.91 35.59 Positive Positive Positive
8 F-19-10 36.30 33.48 32.82 Positive Positive Positive
10 A-27-9 36.36 Undetected Undetected Positive Negative Negative
9 B-4-1 36.45 Undetected Undetected Positive Negative Negative
11 C-6-10 37.20 Undetected 37.69 Positive Negative Positive
12 A-41-2 37.89 36.92 Not tested Positive Positive Not tested
13 C-4-5** 38.77 (ave of 4) Undetected Undetected Positive WFA* Negative Negative
14 C-6-15** 39.09 (ave of 3) Undetected Undetected Positive WFA Negative Negative
15 A-24-10** 39.12 (ave of 2) Undetected Undetected
Suspect Positive
WFA
Negative Negative
Effect of pooling for T. foetus samples with CT>35 after individual testing
*WFA: Suspect workflow A; ** samples confirmed T. foetus by sequencing
Proper & Confidential

14. 14Proprietary & Confidential
Pooling results
1:5 Pools
• 1:5 pooling of positive samples with a CT of 35 and below were all
detected
• Only 3 of 9 positive samples with CTs between 36-39.9 were detected
in 1:5 pools
• Pooling at 1:5 missed 4% (7/176) of T. foetus positive samples
1:3 Pools
• Only 8 of 15 positive samples with CTs between 36-39.9 were
detected in the 1:3 pools
• 1:3 pooling missed 3.5% (6/176) of T. foetus positive samples
Proper & Confidential

15. 15Proprietary & Confidential
Sequencing primer design for nested PCR
(R-TFSM-primer)
(O-F-TFSM-Primer) (M13-I-F-TFSM-Primer)
(M-13-R-TFSM-primer)
TTAGCTTTCTTT GCGA T. foetus
TTAGCTAACAAT GCGA S. moskowitzi
Primers for Nested PCR Abbreviation Primer Sequence
Forward outer forward primer (O-F-TFSM-Primer) CCTTAGGCAATGGATGTCTTGGC
Reverse primer (R-TFSM-primer) GCGCAATGTGCATTCAAAG
M13 Forward Inner primer (M13-I-F-TFSM-Primer)
TGTAAAACGACGGCCAGTCTTACACGATGAAGAA
CGTTGC
M13 Reverse primer (M-13-R-TFSM-primer)
CAGGAAACAGCTATGACCGCGCAATGTGCATTCA
AAG
GenBank: GQ254636.1 Simplicimonas moskowitzi
GenBank: AY349189.1 Tritrichomonas foetus
Proper & Confidential

16. 16Proprietary & Confidential
Sequencing results for 175 T. foetus positives
175/176 T. foetus positive samples, including three late risers,
were confirmed T. foetus by DNA sequencing
Proper & Confidential

17. 17Proprietary & Confidential
Sensitivity, specificity, & predictive values of positive & negative
results for all cultured smegma samples
Calculation Formula Result Result
% Sensitivity
True Positives
True Positives + False Negatives X
100
175 _
175 + 0
x100
100%
% Specificity
True Negatives
True Negatives + False Positives X
100
625___
625 + 3
x100
99.52%
Predictive value of a
positive test
True Positives
True Positives + False Positives X
100
175 __
175 + 3
x100
98.31%
Predictive value of a
negative test
True Negatives
True Negatives + False Negatives X
100
625 __
625 + 0
x100
100%
* Calculations made after qPCR and sequence confirmation
Proper & Confidential

18. 18Proprietary & Confidential
Sequencing Results
• 175/176 positive samples by qPCR were able to be
sequenced
• 1 sample (A-7-25) with a CT 33.95 was not able to be
sequenced.
• It is possible that there are point mutations in this positive sample in the
sequencing primer regions, which were designed based on a few T. foetus
and a single S. moskowitzi sequences from GenBank
• Most importantly, none of the samples reported S. moskowitzi
DNA sequences
Proper & Confidential

19. 19Proprietary & Confidential
Overall Study Results
• 95.6 % agreement was reached between Study Lab
(KSVDL) using Life technologies MagMAXTM and
VetMAXTM T. foetus reagents and the feeder laboratories
• 1:5 Pooling it is likely to miss 4% of the positives
• 1:3 Pooling it is likely to miss 3.5% of the positives
• DNA sequencing
• 175/176 positive samples were confirmed to be T. foetus, the 176th
sample could not be sequenced with the primers designed for this
study
Proper & Confidential

20. 20Proprietary & Confidential
Acknowledgements
Lalitha Peddireddi, KSVDL – performed the study at KSVDL
Lee Effinger, ODA-Animal Health Laboratory
Marilyn Simunich, Idaho State Dept. of Agriculture
Cate O’Connell, Life Technologies
Mangkey Bounpheng, Texas Veterinary Medical Diagnostic Laboratory
Dawn Bueschel, NMDA Veterinary Diagnostic Services
Muthu Chengappa, Kansas State Veterinary Diagnostic Laboratory
Alfonso Clavijo, Texas Veterinary Medical Diagnostic Laboratory
Kris A. Clothier, California Animal Health & Food Safety Lab System
Hemant K. Naikare, Texas Veterinary Medical Diagnostics Laboratory
Jeff Zinza, Life Technologies
Mary Anne Williams, Life Technologies
Proper & Confidential

21. 21Proprietary & Confidential
Objectives
To build confidence in Trich testing
To increase consistency in test results
To minimize sample quality influence variables
To minimize laboratory testing variables
To reduce the burden and cost to man and beast
Trich Laboratory Testing Standardization
Proper & Confidential

22. 22Proprietary & Confidential
Trich Laboratory Testing Standardization
Trichomonas foetus DNA testing
Proper & Confidential