Doi10.18535ijmsciv7i11.06 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY ihsanalsaimary@gmail.com mobile : 009647801410838 university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Assessment of immunomolecular_expression_and_prognostic_role_of_tlr7_among_pa...dr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Src jbbr-20-120 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL M...dr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...Thermo Fisher Scientific
The introduction of defined Ion AmpliSeq™ panels for detection and characterization of actionable mutations occurring in tumor tissue has the potential to revolutionize translational oncology research. The Ion Ampliseq™ cancer hot spot panel version 2 (CHP v2) by Ion Torrent includes 207 actionable sequences from a single target and mutation targets present in 50 genes and the more comprehensive Ion Oncomine™ cancer panel (OCP) developed by Life Technologies Compendia Bioscience™ contains over 2000 mutations. A hallmark of these Ion Torrent Ampliseq cancer panels is the low amount of input DNA needed which is critical when the clinical specimen material is limited such as with fine needle biopsy or FFPE samples. Typically, 10 ng of DNA obtained from these sources is sufficient to produce informative sequencing data. Often, cancer-causing or promoting mutations are detected at relatively low allele frequencies like 10-20 % compared to the major normal allele. Many researchers wish to verify these findings of low frequency mutations by an orthologous method such as traditional dye-fluorescent Sanger sequencing on a capillary electrophoresis (CE) instrument such as the Applied Biosystems 3500 genetic analyzer. To that end, we have developed a workflow that enables the amplification and traditional Sanger sequencing of individual Ion AmpliSeq targets directly from the AmpliSeq library starting material.
The method requires a retainer of 1 μl (~ 5%) of the original AmpliSeq preamplification material. A dilution of this aliquot is used as template source for individualized PCR/sequencing reactions. We show that a random selection of 48 targets from the CHPv2 panel could be successfully amplified and Sanger-sequenced from an Ion Torrent Ampliseq library originally prepared from 10 ng of FFPE
DNA. Furthermore, we show the successful Sanger-re-sequencing of all individual 24 targets covering the TP53 exons from the same sample processed and pre-amplified with the OncoMine AmpliSeq panel.
Taken together, this method will enable researchers to reflex-test potential mutations of interest from very material-limited specimen using Sanger CE sequencing
Detection of somatic mutations at 0.5% frequency from cfDNA and CTC DNA using...Thermo Fisher Scientific
Availability of effective blood screening for tracking of recurrence and
resistance of tumors may improve outcomes in the future. Research
studies suggest that virtually all tumors carry somatic DNA mutations, and
these may serve as biomarkers that may be tracked from blood. The
two well-characterized sources of tumor DNA in blood are circulating
tumor cells (CTC) and cell-free tumor DNA (ctDNA). The abundance of
CTC and/or ctDNA in blood may be very low at critical stages such as
early recurrence or development of resistance. Hence there is great
interest in being able to detect biomarkers at very low frequency from
blood, and in characterizing the relationship between somatic mutations
present in the tumor and those in CTC or ctDNA.
We present a research use only analysis workflow for peripheral
monitoring that enables detection of low frequency variants in blood. We
developed an analysis algorithm, using statistical modeling of next
generation sequencing reads, and optimizing parameters and filters to
enable sensitive and specific detection of somatic mutations at 0.5% allele
ratio. We demonstrate the analysis on a blood sample split into 3 subsamples
comprising normal blood, CTC enriched, and cell-free DNA
(cfDNA) samples.
We used lysis to isolate white blood cells (germline), centrifugation to
extract plasma DNA (cfDNA), while CTC cells were isolated using
Cynvenio LiquidBiopsy™ platform a fully automated antibody-based
solution. We barcoded 3 sub-samples and run them on a single Ion 318™
sequencing chip using Ion AmpliSeq™ Cancer Hotspot Panel (CHPv2),
that enables very deep (~10,000x coverage) and accurate
sequencing. This panel allows interrogation of ~2800 relevant
biomarkers from COSMIC and FDA actionable databases, and denovo
variant detection at ~20,000 genomic positions. Mutations were
annotated using the Oncomine® database in Ion Reporter™ software. The
research assay requires a small amount of input DNA (~10ng), and has a
fast turn around time from extracted DNA to variants of less than 24 hr.
Treating cancer effectively requires an understanding of the molecular alterations driving each patient’s tumor. Targeted sequencing efforts that characterize prevalent somatic alterations and require limited sample input may provide an effective diagnostic approach. Herein, we describe the design and characterization of the Oncomine™ Cancer Research Panel (OCP) that includes recurrent somatic alterations in solid tumors derived from the Oncomine™ cancer database. Using Ion AmpliSeq™ technology, we designed a DNA panel that includes assays for 73 oncogenes with 1,826 recurrent hotspot mutations, 26 tumor suppressor genes enriched for deleterious mutations, as well as 75 genes subject to recurrent focal copy gain or loss. A complementary RNA panel includes 183 assays for relevant gene fusions involving 22 fusion driver genes. Recommended sample inputs were 10 ng of nucleic acid per pool. Sequencing libraries were analyzed on an Ion Torrent™ Personal Genome Machine™. Initial testing revealed an average read depth of > 1,500X with > 95% uniformity and on target frequency. The panel was shown to reliably detect known hotspots, insertions/deletions, gene copy changes, and gene fusions in molecular standards, cell lines and formalin-fixed paraffin embedded samples. Retrospective analysis of large sample cohorts has been completed and the results of analysis of 100 lung cancer and 100 prostate cancer cases will be summarized. In addition, a prospective cohort of 100 samples from the University of Michigan Molecular Diagnostics laboratory was profiled with OCP. Overall, we achieved >95% sensitivity and specificity for detection of KRAS, EGFR and BRAF mutations and ALK gene fusions.
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
Assessment of immunomolecular_expression_and_prognostic_role_of_tlr7_among_pa...dr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Src jbbr-20-120 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL M...dr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Direct Sanger CE Sequencing of Individual Ampliseq Cancer Panel Targets from ...Thermo Fisher Scientific
The introduction of defined Ion AmpliSeq™ panels for detection and characterization of actionable mutations occurring in tumor tissue has the potential to revolutionize translational oncology research. The Ion Ampliseq™ cancer hot spot panel version 2 (CHP v2) by Ion Torrent includes 207 actionable sequences from a single target and mutation targets present in 50 genes and the more comprehensive Ion Oncomine™ cancer panel (OCP) developed by Life Technologies Compendia Bioscience™ contains over 2000 mutations. A hallmark of these Ion Torrent Ampliseq cancer panels is the low amount of input DNA needed which is critical when the clinical specimen material is limited such as with fine needle biopsy or FFPE samples. Typically, 10 ng of DNA obtained from these sources is sufficient to produce informative sequencing data. Often, cancer-causing or promoting mutations are detected at relatively low allele frequencies like 10-20 % compared to the major normal allele. Many researchers wish to verify these findings of low frequency mutations by an orthologous method such as traditional dye-fluorescent Sanger sequencing on a capillary electrophoresis (CE) instrument such as the Applied Biosystems 3500 genetic analyzer. To that end, we have developed a workflow that enables the amplification and traditional Sanger sequencing of individual Ion AmpliSeq targets directly from the AmpliSeq library starting material.
The method requires a retainer of 1 μl (~ 5%) of the original AmpliSeq preamplification material. A dilution of this aliquot is used as template source for individualized PCR/sequencing reactions. We show that a random selection of 48 targets from the CHPv2 panel could be successfully amplified and Sanger-sequenced from an Ion Torrent Ampliseq library originally prepared from 10 ng of FFPE
DNA. Furthermore, we show the successful Sanger-re-sequencing of all individual 24 targets covering the TP53 exons from the same sample processed and pre-amplified with the OncoMine AmpliSeq panel.
Taken together, this method will enable researchers to reflex-test potential mutations of interest from very material-limited specimen using Sanger CE sequencing
Detection of somatic mutations at 0.5% frequency from cfDNA and CTC DNA using...Thermo Fisher Scientific
Availability of effective blood screening for tracking of recurrence and
resistance of tumors may improve outcomes in the future. Research
studies suggest that virtually all tumors carry somatic DNA mutations, and
these may serve as biomarkers that may be tracked from blood. The
two well-characterized sources of tumor DNA in blood are circulating
tumor cells (CTC) and cell-free tumor DNA (ctDNA). The abundance of
CTC and/or ctDNA in blood may be very low at critical stages such as
early recurrence or development of resistance. Hence there is great
interest in being able to detect biomarkers at very low frequency from
blood, and in characterizing the relationship between somatic mutations
present in the tumor and those in CTC or ctDNA.
We present a research use only analysis workflow for peripheral
monitoring that enables detection of low frequency variants in blood. We
developed an analysis algorithm, using statistical modeling of next
generation sequencing reads, and optimizing parameters and filters to
enable sensitive and specific detection of somatic mutations at 0.5% allele
ratio. We demonstrate the analysis on a blood sample split into 3 subsamples
comprising normal blood, CTC enriched, and cell-free DNA
(cfDNA) samples.
We used lysis to isolate white blood cells (germline), centrifugation to
extract plasma DNA (cfDNA), while CTC cells were isolated using
Cynvenio LiquidBiopsy™ platform a fully automated antibody-based
solution. We barcoded 3 sub-samples and run them on a single Ion 318™
sequencing chip using Ion AmpliSeq™ Cancer Hotspot Panel (CHPv2),
that enables very deep (~10,000x coverage) and accurate
sequencing. This panel allows interrogation of ~2800 relevant
biomarkers from COSMIC and FDA actionable databases, and denovo
variant detection at ~20,000 genomic positions. Mutations were
annotated using the Oncomine® database in Ion Reporter™ software. The
research assay requires a small amount of input DNA (~10ng), and has a
fast turn around time from extracted DNA to variants of less than 24 hr.
Treating cancer effectively requires an understanding of the molecular alterations driving each patient’s tumor. Targeted sequencing efforts that characterize prevalent somatic alterations and require limited sample input may provide an effective diagnostic approach. Herein, we describe the design and characterization of the Oncomine™ Cancer Research Panel (OCP) that includes recurrent somatic alterations in solid tumors derived from the Oncomine™ cancer database. Using Ion AmpliSeq™ technology, we designed a DNA panel that includes assays for 73 oncogenes with 1,826 recurrent hotspot mutations, 26 tumor suppressor genes enriched for deleterious mutations, as well as 75 genes subject to recurrent focal copy gain or loss. A complementary RNA panel includes 183 assays for relevant gene fusions involving 22 fusion driver genes. Recommended sample inputs were 10 ng of nucleic acid per pool. Sequencing libraries were analyzed on an Ion Torrent™ Personal Genome Machine™. Initial testing revealed an average read depth of > 1,500X with > 95% uniformity and on target frequency. The panel was shown to reliably detect known hotspots, insertions/deletions, gene copy changes, and gene fusions in molecular standards, cell lines and formalin-fixed paraffin embedded samples. Retrospective analysis of large sample cohorts has been completed and the results of analysis of 100 lung cancer and 100 prostate cancer cases will be summarized. In addition, a prospective cohort of 100 samples from the University of Michigan Molecular Diagnostics laboratory was profiled with OCP. Overall, we achieved >95% sensitivity and specificity for detection of KRAS, EGFR and BRAF mutations and ALK gene fusions.
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
T-Cell receptor (TCR) repertoire sequencing by next-generation
sequencing (NGS) is a valuable tool for building a deeper
understanding of the adaptive immune system. As immunotherapy,
particularly T-cell therapies, show increasing potential in treating
cancer, the ability to gain a detailed, unbiased view of the TCR
repertoire becomes imperative for biomarker discovery, immune
response to treatment, and study of tumor microenvironments. A key
question the field seeks to understand is the relationship between
circulating T-cells and infiltrating T-cells at the tumor site. Here, we
present a novel AmpliSeq approach for TCR repertoire sequencing
using the Ion Torrent S5 sequencer which leverages simplified
workflows and offers up to 600 bp reads which allow for a more
complete characterization of the entire V(D)J region of TCRβ. With a
unique long read length capability, this method can leverage mRNA as
input, which minimizes requirement as starting materials (10-500ng for
typical use cases) and focusing sequencing to productive TCRβ
arrangements.
Decades of cancer research including comprehensive molecular profiling combined with the
development of a broad array of targeted therapies have created the opportunity to transform
cancer care in the near future by implementing precision oncology based approaches. An
important element of this system is the widespread availability of robust and cost-effective
multivariate profiling methods in order to characterize relevant cancer associated molecular
alterations.
Current commercially available multivariate profiling methods vary dramatically with regard to
the number of cancer genes interrogated. Given that many large scale and detailed molecular
profiling studies have been completed, the landscape of somatic alterations in solid tumors is
reasonably well-known. Furthermore, the specific gene variants that are relevant to application
of targeted therapies are also a matter of record. Therefore, we set out to define the number of
relevant cancer genes for precision oncology research based on the currently available
empirical evidence.
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
The tumor microenvironment (TME) is the intersection between tumor cells and
surrounding non-transformed cells. It contains immune cells, signaling molecules,
stromal and extracellular matrix. Research has shown the TME is often associated
with tumor growth. However, the function and regulatory mechanism of each
constituent is still poorly understood. The presence of PD-L1 is a promising marker
to predict positive response for T cell checkpoint therapy. Current IHC methods to
measure PD-L1 are subjective and highly variable. A higher-throughput and
standardized method that can systematically measure gene expression of cells
present in the TME has emerged to be a more desirable solution.
We applied the OncomineTM Immune Response Research Assay to measure the
expression of 395 genes in non-small cell lung cancer (NSCLC) research samples
from 40 matched FFPE and fresh frozen sample types. This assay covers genes
involved in checkpoint pathway, T cell regulation, cytokine and interferon signaling
pathways, and markers of different tumor infiltrating lymphocyte (TIL) subsets, as
well as tumor markers. With an input requirement of 10 ng of total RNA, libraries
were generated, templated on the Ion ChefTM and sequenced on the Ion S5TM
System. Sequencing data was analyzed and mapped with Torrent Suite Software
and differential expression analysis was conducted with AffymetrixTM Transcriptome
Analysis Console.
RNA-Seq To Identify Novel Markers For Research on Neural Tissue DifferentiationThermo Fisher Scientific
Neural tissue differentiated and cultured from derived stem cells is expected to revolutionize the treatment of brain and spinal injuries and diseases. Critical for these cellular therapies is accurate control and monitoring of differentiation but current methods for such cell typing are limited to qPCR and immunocytochemisty (ICC) which is not sufficient to discriminate between the numerous (likely >100,000) possible neural cell-types. Research using RNA sequencing (RNA-Seq) permits the characterization and discovery of much-needed novel markers. To define the temporal transcriptional signature of neural stem cells, cultured human embryonic stem cells (H9) were compared to induced neural stem cells (NSCs) at d0, d7 and d14. Total RNA was isolated over the time course from the undifferentiated and differentiated cells. Ion Torrent™ libraries were created to profile expression of miRNAs and whole transcriptomes for each cell population. Multiplexed Ion Proton™ sequencing and Torrent Suite™ Software analysis yielded ≥2.5 million small RNA reads and ≥29 million whole transcriptome reads per sample. Cluster analysis of the RNA-Seq profiles indicates that the cell populations have characteristic molecular signatures. Among genes that are decreased in induced cells are OCT4 (POU5F1), JARID2, NANOG, consistent with the differentiation of iPSCs into neurons. Among genes that showed increased expressions are NTRK2, POU3F2, and a number of HOX family genes. Recently, Ion AmpliSeq™ Transcriptome Human Gene Expression Kit has been launched, and the results from this analysis corroborated with whole transcriptome RNA-Seq results.
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Thermo Fisher Scientific
Blood screening to track tumor recurrence and
resistance may improve treatment selection and
monitoring. Virtually all tumors carry somatic DNA
mutations, serving as biomarker in blood. Circulating
cell-free DNA (cfDNA) is one source of tumor DNA in
blood. Tumor DNA comes from different tumor
clones, and its abundance in plasma can be very low
at critical stages such as early recurrence or
development of resistance. This enables interest in
detecting mutation biomarkers at very low frequency
from cfDNA. We present a research use only
analysis workflow for detection of low frequency DNA
variants. Our variant calling method enables
sensitive and specific detection of somatic mutations
to 0.1% frequency.
High-throughput processing to maximize genomic analysis through simultaneous ...Thermo Fisher Scientific
As personalized cancer care evolves, the patient’s nucleic acid becomes ever so important to provide valuable information regarding their genetic makeup and disease state. Common sample types for these analyses include biopsies, which can be very limited in material making the downstream measurement of more than one analyte rather difficult. Obtaining another biopsy, using a different section or splitting the sample can be problematic because of tumor heterogeneity. Even adjacent areas of the same tumor tissue can result in different RNA/DNA profiles so the ability to isolate multiple analytes from the same sample offer a number of benefits, which include preserving samples and data consistency eliminating any sample to sample variation. As more tests are developed to simultaneously monitor genetic alterations, there is a strong need to efficiently isolate both DNA and RNA from the same starting sample in a format compatible with high-throughput processing.
Custom AmpliSeq™ Panels for Inherited Disease Research from Optimized, Invent...Thermo Fisher Scientific
Next generation sequencing (NGS) refers to the parallel sequencing of hundreds to
millions of DNA fragments. The consequent increase in throughput and decrease in
price has led to an explosion of genetic information for a variety of organisms. Ion
AmpliSeq™ library preparation is a multiplexed PCR-based method for amplifying
and preparing specific regions of interest in a genome for sequencing on Ion
Torrent™ NGS instruments. This library preparation method can accommodate
from dozens to many thousands of primer pairs in single tube reactions, and can
utilize from one to many primer pools for maximum flexibility. Primers are available
as pre-assembled ready-to-use panels or as custom made-to-order panels.
Tumor Mutational Load assessment of FFPE samples using an NGS based assayThermo Fisher Scientific
Understanding the molecular determinants of response to immune checkpoint blockade inhibitors is a critical unmet need for translational oncology research. Research tools to characterize the mutational landscape of cancers may potentially help identify predictive biomarkers for immuno-therapy that can be tested in future studies. Herein, we describe a targeted Ion AmpliSeq assay to determine the mutational load and signature of cancer research samples.
Insights into the tumor microenvironment and therapeutic T cell manufacture r...Thermo Fisher Scientific
TCRβ immune repertoire analysis by next-generation sequencing is emerging as a valuable tool for research studies of the tumor microenvironment and potential immune responses to cancer immunotherapy1-4. Here we describe a multiplex PCR-based TCRβ sequencing assay (Ion AmpliSeqTM Immune Repertoire Assay Plus – TCRβ) that leverages Ion AmpliSeq library construction chemistry and the long read capability of the Ion S5 530TM chip to provide coverage of all three CDR domains of the human TCRβ chain. We demonstrate use of the assay to evaluate tumor-infiltrating T cell repertoire features and monitor manufacture of therapeutic T cells.
Comparison of Type and Time of Fixation on Tissue DNA Sequencing ResultsThermo Fisher Scientific
The effects of type and duration of tissue fixation were studied using three different
lung (LCa) cancer research samples. Each tissue sample was fixed in five different
fixatives, for three different time points in each fixative. Next generation sequencing
(NGS), tissue morphology analysis (H+E), and antigenicity (IHC) were performed
for each of the resulting samples. The analysis indicates that both time and type of
fixation impact NGS results.
A computational framework for large-scale analysis of TCRβ immune repertoire ...Thermo Fisher Scientific
TCRβ immune repertoire analysis by next-generation sequencing is emerging as a valuable tool for research studies of the tumor microenvironment and potential immune responses to cancer immunotherapy. Generation of insight from immune repertoire profiling often requires comparative analysis of immune repertoires across research sample cohorts representing immune responses to defined antigens or immunomodulatory agents. Here we describe the development of a computational framework enabling large-scale comparative analysis of immune repertoire data on cloud-based infrastructure.
Widespread human T cell receptor beta variable gene polymorphism: implication...Thermo Fisher Scientific
Polymorphism within the TCRB variable gene (TRBV) has been linked to chronic autoimmune diseases such as Type 1 Diabetes, Rheumatoid Arthritis, Psoriatic Arthritis, Multiple Sclerosis and Asthma (1-8), and may also be mechanistically linked to immune mediated adverse events (IMAEs) during immunotherapy (9-11). Here we use the Ion-AmpliSeq™ Immune Repertoire Plus TCRB assay to evaluate TRBV gene polymorphism in a group of 85 Caucasians with melanoma. The assay provides coverage of all three CDR domains to enable detection of TRBV polymorphism. We find evidence of extensive genetic diversity within the TRBV gene, including 15 nonsynonymous variants that are absent from the IMGT database (12). TRBV gene allele typing may provide rich biomarker information for the prediction of IMAEs and chronic autoimmune disease.
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...Thermo Fisher Scientific
Study of genetic Information from cell-free (cf) DNA provide valuable opportunities in cancer research and potentially impact future oncology. As an example, liquid biopsy provide a non-invasive and cost effective solution for future compared to traditional biopsy tests. Here we report the application of research based Ion Torrent™ next-generation sequencing (NGS) Oncomine™ cfDNA assays and associated workflow, which is developed to detect somatic variants at low frequency of 0.1% in cfDNA from plasma.
Orthogonal Verification of Oncomine cfDNA Data with Digital PCR Using TaqMan ...Thermo Fisher Scientific
The discovery of circulating tumor DNA (ctDNA) in blood, urine
and other bodily fluids has led to a new type of non-invasive
method of characterizing cancer-causing mutations, the liquid
biopsy. With NGS technologies becoming increasingly
sensitive, down to a Limit of Detection (LOD) of 0.1%, they are
rapidly gaining traction as a valid assay for cancer genotyping
and have potential to direct cancer treatment plans. The wideangle
view provided by NGS panels, combined with digital
PCR’s zoomed-in precision detection of DNA provide a
comprehensive picture of a cancer’s genetic makeup. By
applying these complementary techniques at the appropriate
time based on the disease type and stage, cancer treatment
becomes quicker, more precise and more cost-effective in the
future. NGS and digital PCR (dPCR) together provide a
complete picture of the cancer genome.
Creating custom gene panels for next-generation sequencing: optimization of 5...Thermo Fisher Scientific
Next-generation sequencing gene panels enable the examination of multiple genes, identifying previously described variants and discovering novel variants, to elucidate genetic disease. The challenges are substantial, including: identification of all genes of interest; assay optimization to create robust, reproducible, multiplex panels; and developing accurate, comprehensive, reproducible analysis pipelines.
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Thermo Fisher Scientific
DNA sequence variants play an important role in the initiation and progression of many different cancer types. The detection of germline variants at a fixed ratio by gold-standard Sanger sequencing has been well established; however, the detection of somatic mutations, especially in heterogeneous tumor samples where variants may be present at a lower level, has been more challenging. Minor Variant Finder Software (MVF) enables calling of low frequency variants at a detection level as low as 5% using Sanger sequencing.
We have developed gene-specific Sanger sequencing panels covering the entire coding region (all exons) of specific genes (e.g., TP53, KRAS, and NRAS) implicated in tumorigenesis. We initially determined variants of TP53 and KRAS from lung tumor FFPE samples by NGS using the Ion PGM™ System. We confirmed the identity and minor allele frequency of these variants by gene-specific Sanger sequencing panels analyzed by MVF.
To demonstrate the robustness and flexibility of using Sanger sequencing for oncology research, we also included variants across many different solid tumor types in a pan-cancer panel. We tested this workflow with lower amounts of DNA input (10ng, 3ng, 1ng, 0.1ng). Additionally, we have built an extended RAS panel including eight amplicons covering the most important codons (12-13, 59-61, 117 and 146) of KRAS and NRAS genes. The entire workflow and data analysis using MVF was validated on thirty-five FFPE samples derived from colon cancer biopsies by OmniSeq LLC, Buffalo, NY.
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
In recent years, advances in next-generation sequencing (NGS) technologies have enabled faster and cheaper methods for uncovering the genetic basis of disease. For cancer, NGS based screening for known tumour subtypes can inform diagnosis and allow the clinician to tailor a specific therapy based on testing outcome. Here we present the validation of one such NGS based kit approved for CE-IVD* use to screen for specific chromosomal translocations in non-small cell lung cancer (NSCLC) samples by targeting specific breakpoints in known fusion transcripts.
The kit tested (Oncomine™ Solid Tumour Fusion Transcript Kit) included a single primer poolcontaining amplicon designs to simultaneously screen for over 75 specific rearrangements involving the receptor tyrosine kinase (RTK) genes ALK, RET and ROS1 as well as NTRK1. The panel was compatible with formalin-fixed paraffin-embedded (FFPE) lung tumour samples and achieved high sensitivity down to 10 ng of RNA input. In addition, amplicon assays designed at the 5’ and 3’ ends the RTK genes provide non-specific evidence that a translocation exists in a sample by comparing expression imbalance between the two ends. Validation testing was carried out at three external clinical laboratories (CLIA, CAP, INAB). In addition to positive and negative control samples, each site contributed FFPE lung tumour samples for which ALK fusion status was known prior to NGS library preparation carried out using the Ion AmpliSeq workflow. For site-specific samples (n=144, 16 samples per sequencing run), high concordance, sensitivity and specificity were measured at 97.2%, 90.5% and 98.4%, respectively.
Global Gene Expression Profiles from Breast Tumor Samples using the Ion Ampli...Thermo Fisher Scientific
Thousands of genes are expressed in a controlled fashion in each eukaryotic cell
determining what a cell can do and dictate normal tissue function. The measurement of
the entire gene expression pattern of a given sample is critical in understanding the
natural homeostatic state of a healthy tissue, as well as providing useful information
when a system is altered due to environmental queues or potentially disease state.
Many technologies have been utilized to measure the entire gene expression profile of a
RNA test sample. DNA microarrays have become a key method to acquire a
comparative snapshot of the gene expression profile from test samples in a high
throughput manner. Quantitative PCR and newer sequencing techniques are popular
alternatives offering highly accurate gene expression measurements, but with limitations
due to cost and complex analysis needs.
To address the challenges of current sequencing based methods of global gene
expression profiling and take advantage of the simplicity of analysis that comes with
defined expression profiling content from technologies such as microarrays, we have
tested the Ion AmpliSeq™ Transcriptome Human Gene Expression Kit using RNA
isolated from invasive ductal tumor samples. This novel approach allows profiling the
global mRNA expression of human RNA in a highly multiplexed fashion using the Ion
Torrent sequencing platform. The results show detection of more genes than popular
microarray platforms with comparable differential gene expression measurements to
quantitative PCR (r = 0.96) and RNA-Seq methods (r = 0.94).
Data presented here demonstrates high on target mapping (>91% of reads) for all
human breast carcinoma libraries. Gene expression values correlated with R>0.99 for
all technical replicates. We saw >64% of the over 22,800 genes in the single pool panel
detected for all libraries. The most highly expressed genes include genes expected to
be over-expressed in breast tumor samples. The Ion AmpliSeq™ Transcriptome Human
Gene Expression Kit is a novel method to measure global gene expression profiles from
human RNA samples in a timely, cost effective, and high throughput manner resulting in
sensitive and accurate gene expression measurements.
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
The tumor microenvironment (TME) is the intersection between tumor cells and
surrounding non-transformed cells. It contains immune cells, signaling molecules,
stromal and extracellular matrix. Research has shown the TME is often associated
with tumor growth. However, the function and regulatory mechanism of each
constituent is still poorly understood. The presence of PD-L1 is a promising marker
to predict positive response for T cell checkpoint therapy. Current IHC methods to
measure PD-L1 are subjective and highly variable. A higher-throughput and
standardized method that can systematically measure gene expression of cells
present in the TME has emerged to be a more desirable solution.
We applied the OncomineTM Immune Response Research Assay to measure the
expression of 395 genes in non-small cell lung cancer (NSCLC) research samples
from 40 matched FFPE and fresh frozen sample types. This assay covers genes
involved in checkpoint pathway, T cell regulation, cytokine and interferon signaling
pathways, and markers of different tumor infiltrating lymphocyte (TIL) subsets, as
well as tumor markers. With an input requirement of 10 ng of total RNA, libraries
were generated, templated on the Ion ChefTM and sequenced on the Ion S5TM
System. Sequencing data was analyzed and mapped with Torrent Suite Software
and differential expression analysis was conducted with AffymetrixTM Transcriptome
Analysis Console.
RNA-Seq To Identify Novel Markers For Research on Neural Tissue DifferentiationThermo Fisher Scientific
Neural tissue differentiated and cultured from derived stem cells is expected to revolutionize the treatment of brain and spinal injuries and diseases. Critical for these cellular therapies is accurate control and monitoring of differentiation but current methods for such cell typing are limited to qPCR and immunocytochemisty (ICC) which is not sufficient to discriminate between the numerous (likely >100,000) possible neural cell-types. Research using RNA sequencing (RNA-Seq) permits the characterization and discovery of much-needed novel markers. To define the temporal transcriptional signature of neural stem cells, cultured human embryonic stem cells (H9) were compared to induced neural stem cells (NSCs) at d0, d7 and d14. Total RNA was isolated over the time course from the undifferentiated and differentiated cells. Ion Torrent™ libraries were created to profile expression of miRNAs and whole transcriptomes for each cell population. Multiplexed Ion Proton™ sequencing and Torrent Suite™ Software analysis yielded ≥2.5 million small RNA reads and ≥29 million whole transcriptome reads per sample. Cluster analysis of the RNA-Seq profiles indicates that the cell populations have characteristic molecular signatures. Among genes that are decreased in induced cells are OCT4 (POU5F1), JARID2, NANOG, consistent with the differentiation of iPSCs into neurons. Among genes that showed increased expressions are NTRK2, POU3F2, and a number of HOX family genes. Recently, Ion AmpliSeq™ Transcriptome Human Gene Expression Kit has been launched, and the results from this analysis corroborated with whole transcriptome RNA-Seq results.
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Thermo Fisher Scientific
Blood screening to track tumor recurrence and
resistance may improve treatment selection and
monitoring. Virtually all tumors carry somatic DNA
mutations, serving as biomarker in blood. Circulating
cell-free DNA (cfDNA) is one source of tumor DNA in
blood. Tumor DNA comes from different tumor
clones, and its abundance in plasma can be very low
at critical stages such as early recurrence or
development of resistance. This enables interest in
detecting mutation biomarkers at very low frequency
from cfDNA. We present a research use only
analysis workflow for detection of low frequency DNA
variants. Our variant calling method enables
sensitive and specific detection of somatic mutations
to 0.1% frequency.
High-throughput processing to maximize genomic analysis through simultaneous ...Thermo Fisher Scientific
As personalized cancer care evolves, the patient’s nucleic acid becomes ever so important to provide valuable information regarding their genetic makeup and disease state. Common sample types for these analyses include biopsies, which can be very limited in material making the downstream measurement of more than one analyte rather difficult. Obtaining another biopsy, using a different section or splitting the sample can be problematic because of tumor heterogeneity. Even adjacent areas of the same tumor tissue can result in different RNA/DNA profiles so the ability to isolate multiple analytes from the same sample offer a number of benefits, which include preserving samples and data consistency eliminating any sample to sample variation. As more tests are developed to simultaneously monitor genetic alterations, there is a strong need to efficiently isolate both DNA and RNA from the same starting sample in a format compatible with high-throughput processing.
Custom AmpliSeq™ Panels for Inherited Disease Research from Optimized, Invent...Thermo Fisher Scientific
Next generation sequencing (NGS) refers to the parallel sequencing of hundreds to
millions of DNA fragments. The consequent increase in throughput and decrease in
price has led to an explosion of genetic information for a variety of organisms. Ion
AmpliSeq™ library preparation is a multiplexed PCR-based method for amplifying
and preparing specific regions of interest in a genome for sequencing on Ion
Torrent™ NGS instruments. This library preparation method can accommodate
from dozens to many thousands of primer pairs in single tube reactions, and can
utilize from one to many primer pools for maximum flexibility. Primers are available
as pre-assembled ready-to-use panels or as custom made-to-order panels.
Tumor Mutational Load assessment of FFPE samples using an NGS based assayThermo Fisher Scientific
Understanding the molecular determinants of response to immune checkpoint blockade inhibitors is a critical unmet need for translational oncology research. Research tools to characterize the mutational landscape of cancers may potentially help identify predictive biomarkers for immuno-therapy that can be tested in future studies. Herein, we describe a targeted Ion AmpliSeq assay to determine the mutational load and signature of cancer research samples.
Insights into the tumor microenvironment and therapeutic T cell manufacture r...Thermo Fisher Scientific
TCRβ immune repertoire analysis by next-generation sequencing is emerging as a valuable tool for research studies of the tumor microenvironment and potential immune responses to cancer immunotherapy1-4. Here we describe a multiplex PCR-based TCRβ sequencing assay (Ion AmpliSeqTM Immune Repertoire Assay Plus – TCRβ) that leverages Ion AmpliSeq library construction chemistry and the long read capability of the Ion S5 530TM chip to provide coverage of all three CDR domains of the human TCRβ chain. We demonstrate use of the assay to evaluate tumor-infiltrating T cell repertoire features and monitor manufacture of therapeutic T cells.
Comparison of Type and Time of Fixation on Tissue DNA Sequencing ResultsThermo Fisher Scientific
The effects of type and duration of tissue fixation were studied using three different
lung (LCa) cancer research samples. Each tissue sample was fixed in five different
fixatives, for three different time points in each fixative. Next generation sequencing
(NGS), tissue morphology analysis (H+E), and antigenicity (IHC) were performed
for each of the resulting samples. The analysis indicates that both time and type of
fixation impact NGS results.
A computational framework for large-scale analysis of TCRβ immune repertoire ...Thermo Fisher Scientific
TCRβ immune repertoire analysis by next-generation sequencing is emerging as a valuable tool for research studies of the tumor microenvironment and potential immune responses to cancer immunotherapy. Generation of insight from immune repertoire profiling often requires comparative analysis of immune repertoires across research sample cohorts representing immune responses to defined antigens or immunomodulatory agents. Here we describe the development of a computational framework enabling large-scale comparative analysis of immune repertoire data on cloud-based infrastructure.
Widespread human T cell receptor beta variable gene polymorphism: implication...Thermo Fisher Scientific
Polymorphism within the TCRB variable gene (TRBV) has been linked to chronic autoimmune diseases such as Type 1 Diabetes, Rheumatoid Arthritis, Psoriatic Arthritis, Multiple Sclerosis and Asthma (1-8), and may also be mechanistically linked to immune mediated adverse events (IMAEs) during immunotherapy (9-11). Here we use the Ion-AmpliSeq™ Immune Repertoire Plus TCRB assay to evaluate TRBV gene polymorphism in a group of 85 Caucasians with melanoma. The assay provides coverage of all three CDR domains to enable detection of TRBV polymorphism. We find evidence of extensive genetic diversity within the TRBV gene, including 15 nonsynonymous variants that are absent from the IMGT database (12). TRBV gene allele typing may provide rich biomarker information for the prediction of IMAEs and chronic autoimmune disease.
Ion Torrent™ Next Generation Sequencing-Oncomine™ Lung cfDNA assay detected 0...Thermo Fisher Scientific
Study of genetic Information from cell-free (cf) DNA provide valuable opportunities in cancer research and potentially impact future oncology. As an example, liquid biopsy provide a non-invasive and cost effective solution for future compared to traditional biopsy tests. Here we report the application of research based Ion Torrent™ next-generation sequencing (NGS) Oncomine™ cfDNA assays and associated workflow, which is developed to detect somatic variants at low frequency of 0.1% in cfDNA from plasma.
Orthogonal Verification of Oncomine cfDNA Data with Digital PCR Using TaqMan ...Thermo Fisher Scientific
The discovery of circulating tumor DNA (ctDNA) in blood, urine
and other bodily fluids has led to a new type of non-invasive
method of characterizing cancer-causing mutations, the liquid
biopsy. With NGS technologies becoming increasingly
sensitive, down to a Limit of Detection (LOD) of 0.1%, they are
rapidly gaining traction as a valid assay for cancer genotyping
and have potential to direct cancer treatment plans. The wideangle
view provided by NGS panels, combined with digital
PCR’s zoomed-in precision detection of DNA provide a
comprehensive picture of a cancer’s genetic makeup. By
applying these complementary techniques at the appropriate
time based on the disease type and stage, cancer treatment
becomes quicker, more precise and more cost-effective in the
future. NGS and digital PCR (dPCR) together provide a
complete picture of the cancer genome.
Creating custom gene panels for next-generation sequencing: optimization of 5...Thermo Fisher Scientific
Next-generation sequencing gene panels enable the examination of multiple genes, identifying previously described variants and discovering novel variants, to elucidate genetic disease. The challenges are substantial, including: identification of all genes of interest; assay optimization to create robust, reproducible, multiplex panels; and developing accurate, comprehensive, reproducible analysis pipelines.
Low Level Somatic Variant Detection by Sanger Sequencing of FFPE Samples for ...Thermo Fisher Scientific
DNA sequence variants play an important role in the initiation and progression of many different cancer types. The detection of germline variants at a fixed ratio by gold-standard Sanger sequencing has been well established; however, the detection of somatic mutations, especially in heterogeneous tumor samples where variants may be present at a lower level, has been more challenging. Minor Variant Finder Software (MVF) enables calling of low frequency variants at a detection level as low as 5% using Sanger sequencing.
We have developed gene-specific Sanger sequencing panels covering the entire coding region (all exons) of specific genes (e.g., TP53, KRAS, and NRAS) implicated in tumorigenesis. We initially determined variants of TP53 and KRAS from lung tumor FFPE samples by NGS using the Ion PGM™ System. We confirmed the identity and minor allele frequency of these variants by gene-specific Sanger sequencing panels analyzed by MVF.
To demonstrate the robustness and flexibility of using Sanger sequencing for oncology research, we also included variants across many different solid tumor types in a pan-cancer panel. We tested this workflow with lower amounts of DNA input (10ng, 3ng, 1ng, 0.1ng). Additionally, we have built an extended RAS panel including eight amplicons covering the most important codons (12-13, 59-61, 117 and 146) of KRAS and NRAS genes. The entire workflow and data analysis using MVF was validated on thirty-five FFPE samples derived from colon cancer biopsies by OmniSeq LLC, Buffalo, NY.
Similar to Doi10.18535ijmsciv7i11.06 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY ihsanalsaimary@gmail.com mobile : 009647801410838 university of basrah - college of medicine - basrah -IRAQ
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
In recent years, advances in next-generation sequencing (NGS) technologies have enabled faster and cheaper methods for uncovering the genetic basis of disease. For cancer, NGS based screening for known tumour subtypes can inform diagnosis and allow the clinician to tailor a specific therapy based on testing outcome. Here we present the validation of one such NGS based kit approved for CE-IVD* use to screen for specific chromosomal translocations in non-small cell lung cancer (NSCLC) samples by targeting specific breakpoints in known fusion transcripts.
The kit tested (Oncomine™ Solid Tumour Fusion Transcript Kit) included a single primer poolcontaining amplicon designs to simultaneously screen for over 75 specific rearrangements involving the receptor tyrosine kinase (RTK) genes ALK, RET and ROS1 as well as NTRK1. The panel was compatible with formalin-fixed paraffin-embedded (FFPE) lung tumour samples and achieved high sensitivity down to 10 ng of RNA input. In addition, amplicon assays designed at the 5’ and 3’ ends the RTK genes provide non-specific evidence that a translocation exists in a sample by comparing expression imbalance between the two ends. Validation testing was carried out at three external clinical laboratories (CLIA, CAP, INAB). In addition to positive and negative control samples, each site contributed FFPE lung tumour samples for which ALK fusion status was known prior to NGS library preparation carried out using the Ion AmpliSeq workflow. For site-specific samples (n=144, 16 samples per sequencing run), high concordance, sensitivity and specificity were measured at 97.2%, 90.5% and 98.4%, respectively.
Global Gene Expression Profiles from Breast Tumor Samples using the Ion Ampli...Thermo Fisher Scientific
Thousands of genes are expressed in a controlled fashion in each eukaryotic cell
determining what a cell can do and dictate normal tissue function. The measurement of
the entire gene expression pattern of a given sample is critical in understanding the
natural homeostatic state of a healthy tissue, as well as providing useful information
when a system is altered due to environmental queues or potentially disease state.
Many technologies have been utilized to measure the entire gene expression profile of a
RNA test sample. DNA microarrays have become a key method to acquire a
comparative snapshot of the gene expression profile from test samples in a high
throughput manner. Quantitative PCR and newer sequencing techniques are popular
alternatives offering highly accurate gene expression measurements, but with limitations
due to cost and complex analysis needs.
To address the challenges of current sequencing based methods of global gene
expression profiling and take advantage of the simplicity of analysis that comes with
defined expression profiling content from technologies such as microarrays, we have
tested the Ion AmpliSeq™ Transcriptome Human Gene Expression Kit using RNA
isolated from invasive ductal tumor samples. This novel approach allows profiling the
global mRNA expression of human RNA in a highly multiplexed fashion using the Ion
Torrent sequencing platform. The results show detection of more genes than popular
microarray platforms with comparable differential gene expression measurements to
quantitative PCR (r = 0.96) and RNA-Seq methods (r = 0.94).
Data presented here demonstrates high on target mapping (>91% of reads) for all
human breast carcinoma libraries. Gene expression values correlated with R>0.99 for
all technical replicates. We saw >64% of the over 22,800 genes in the single pool panel
detected for all libraries. The most highly expressed genes include genes expected to
be over-expressed in breast tumor samples. The Ion AmpliSeq™ Transcriptome Human
Gene Expression Kit is a novel method to measure global gene expression profiles from
human RNA samples in a timely, cost effective, and high throughput manner resulting in
sensitive and accurate gene expression measurements.
Genomic gene expression changes resulting from Trypanosomiasis: a horizontal study Examining expression changes elucidated by micro arrays in seminal tissues associated with the pathophysiology of Trypanosomiasis during disease progression
understanding of the human immune system, and thereby cancer immunology.
αβT-cells are the primary constituents of human cell-mediated adaptive immunity.
The antigen specificity of each αβT-cell is encoded in the 500-600 bp transcript
encompassing the variable portion of the rearranged TCRα and TCRβ subunits,
which can be read via NGS in a process termed repertoire sequencing. Until now,
the main challenge the field faces is the lack of a technology that can provide a
contiguous read of 600 bp to minimize the complexity of designing bias-prone
primers and informatics challenges of stitching short reads. Here we leverage the
long read capability of Ion 530™ chip to comprehensively sequence all three CDR
domains of the TCRβ chain. The Ion 530™ chip offers greater than 15 M productive
reads, allowing a multiplex of 2-4 samples with sufficient coverage for most repertoire
profiling studies. Initial testing with leukocyte total RNA demonstrates that this
multiplex PCR assay produced repertoires that were much more similar to data
derived from 5’-RACE protocol than the commonly used BIOMED-2 primer set. This
result suggested that the use of long reads minimizes bias by allowing targeting of
less variable regions. To further assess the performance of the assay, we designed a
model system of 30 plasmid controls containing common human T-cell CDR3
sequences. Each plasmid was amplified individually and sequenced to confirm the
detection of a single clonal population. Analytical sensitivity of the assay and
accuracy of the accompanied analysis solution were further evaluated by spiking in
plasmid concentrations from 10 pg to 0.0001 pg (5 million to 50 copies) in a
background of 100 ng cDNA reverse transcribed from leukocyte total RNA. Results
showed the assay offers linearity over 5 orders of magnitude of decreasing input
concentration. In summary, we have demonstrated a NGS workflow for TCRβ
sequencing that offers multiplex flexibility on Ion S5 with sample to answer in less
than 48 hours.
Hotspot mutation and fusion transcript detection from the same non-small cell...Thermo Fisher Scientific
The presence of certain chromosomal Header
rearrangements and the subsequent fusion
gene derived from translocations has been
implicated in a number of cancers. Hundreds of
translocations have been described in the
literature recently but the need to efficiently
detect and further characterize these
chromosomal translocations is growing
exponentially. The two main methods to identify
and monitor translocations, fluorescent in situ
hybridization (FISH) and comparative genomic
hybridization (CGH) are challenging, labor
intensive, the information obtained is limited,
and sensitivity is rather low. Common sample
types for these analyses are biopsies or small
tumors, which are very limited in material
making the downstream measurement of more
than one analyte rather difficult; obtaining
another biopsy, using a different section or
splitting the sample can raise issues of tumor
heterogeneity. The ability to study mutation
status as well as measuring fusion transcript
expression from the same sample is powerful
because you’re maximizing the information
obtained from a single precious sample and
eliminating any sample to sample variation.
Here we describe the efficient isolation of two
valuable analytes, RNA and DNA, from the
same starting sample without splitting, followed
by versatile and informative downstream
analysis. This methodology has been applied to
FFPE and degraded samples as well as fresh
tissues, cells and blood. DNA and RNA were
recovered from the same non-small cell lung
adenocarcinoma sample and both mutation
analysis, as well as fusion transcript detection
was performed using the Ion Torrent PGM™
platform on the same Ion 318™ chip. Using
10ng of DNA and 10ng of RNA input, we
applied the Ion AmpliSeq™ Colon and Lung
Cancer panel to analyze over 500 COSMIC
mutations in 22 genes and the Ion AmpliSeq™
RNA Lung Fusion panel to detect 40 different
fusion transcripts.
The Karolinska Institute (KI) is the largest centre for medical education and research in Sweden and the home of the Nobel Prize in Physiology or Medicine.
KI consists of 22 departments and 600 research groups dedicated to improving human health through research and higher education.
The role of the Kohonen/Grafström team has been to guide the application, analysis, interpretation and storage of so called “omics” technology-derived data within the service-oriented subproject “ToxBank”.
A large amount of data is available on the functional impact of missense mutations in TP53 tumor suppressor gene. and on mutation patterns in many different cancers. TP53 direct sequencing is a time-consuming method with limitations in detection level. Here we describe the development and verification of a TP53 Next Generation Sequencing method based on Ion AmpliSeq technology. Preliminary data demonstrate that the TP53 Ion AmpliSeq panel and Ion Reporter Software analysis solution meets the requirements of clinical research laboratories.
Next generation sequencing of the whole transcriptome enables high resolution measurement of gene expression activity in different tissue and cell types. This methodology provides an in depth study of known transcripts and depending on the data analysis, allows identification of additional transcript types such as transcript variants, fusion transcripts, and small and long ncRNAs.
In this study we performed RNA-Seq using the Ion Torrent™ sequencing platform to compare the expression profile of testicular germ cell cancers (seminoma type, n=3) and normal testis (n=3). Using Partek Flow® 3.0 and TopHat/BowTie or Star aligners, we aligned the reads to the human genome and mapped sequences to the RefSeq database. Differentially expressed genes were identified and screened with additional germ cell tumors.
PCA analysis showed clear separation of the two sample types indicating biological differences. List of differentially expressed genes generated from TopHat/Bowtie and Star were similar. We identified a large number of genes that were up and down regulated with high degree of significance (p<0.01,>2X FC (fold change)). These included genes related to testicular tissue type, stem cell pluripotency (NANOG; POU5F1) and proliferation (KRAS, CCND2).
In addition, a number of differentially expressed noncoding RNAs were identified (SNORD12B, XIST). The method was validated on a small set of genes (n=20) using qPCR (TaqMan® Assays) and were found to be correlated. We used the OpenArray® platform to quickly and quantitatively screen 102 differentially expressed genes and 10 endogenous control genes across a number of different testicular germ cell cancer types.
We used a complete work flow solution from sample prep to NGS to qPCR to compare the expression profile of normal testis and seminoma type germ cell tumors. From the NGS experiments we identified a large number of differentially expressed genes for qPCR screening with samples from different types of germ cell tumors. Results from these screening studies will be presented.
Similar to Doi10.18535ijmsciv7i11.06 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY ihsanalsaimary@gmail.com mobile : 009647801410838 university of basrah - college of medicine - basrah -IRAQ (20)
2021 laboratory diagnosis of infectious diseases dr.ihsan alsaimarydr.Ihsan alsaimary
2021 laboratory diagnosis of infectious diseases
dr. ihsan alsaimary
university of basrah - college of medicine- DEPARTMENT OF MICROBIOLOGY
POBOX 696 ASHAR
BASRAH 42001
IRAQ
Src jbbr-21-125 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL M...dr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Estimation of Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL MICR...dr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Tolerance & autoimmunity and organ specific autoimmune diseasesdr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Pathogenesis of microbial infections dr. ihsan alsaimarydr.Ihsan alsaimary
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
Dr. ihsan edan abdulkareem alsaimary
PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY
ihsanalsaimary@gmail.com
mobile : 009647801410838
university of basrah - college of medicine - basrah -IRAQ
263778731218 Abortion Clinic /Pills In Harare ,sisternakatoto
263778731218 Abortion Clinic /Pills In Harare ,ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group ABORTION WOMEN’S CLINIC +27730423979 IN women clinic we believe that every woman should be able to make choices in her pregnancy. Our job is to provide compassionate care, safety,affordable and confidential services. That’s why we have won the trust from all generations of women all over the world. we use non surgical method(Abortion pills) to terminate…Dr.LISA +27730423979women Clinic is committed to providing the highest quality of obstetrical and gynecological care to women of all ages. Our dedicated staff aim to treat each patient and her health concerns with compassion and respect.Our dedicated group of receptionists, nurses, and physicians have worked together as a teamof receptionists, nurses, and physicians have worked together as a team wwww.lisywomensclinic.co.za/
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
NVBDCP.pptx Nation vector borne disease control programSapna Thakur
NVBDCP was launched in 2003-2004 . Vector-Borne Disease: Disease that results from an infection transmitted to humans and other animals by blood-feeding arthropods, such as mosquitoes, ticks, and fleas. Examples of vector-borne diseases include Dengue fever, West Nile Virus, Lyme disease, and malaria.
Title: Sense of Taste
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the structure and function of taste buds.
Describe the relationship between the taste threshold and taste index of common substances.
Explain the chemical basis and signal transduction of taste perception for each type of primary taste sensation.
Recognize different abnormalities of taste perception and their causes.
Key Topics:
Significance of Taste Sensation:
Differentiation between pleasant and harmful food
Influence on behavior
Selection of food based on metabolic needs
Receptors of Taste:
Taste buds on the tongue
Influence of sense of smell, texture of food, and pain stimulation (e.g., by pepper)
Primary and Secondary Taste Sensations:
Primary taste sensations: Sweet, Sour, Salty, Bitter, Umami
Chemical basis and signal transduction mechanisms for each taste
Taste Threshold and Index:
Taste threshold values for Sweet (sucrose), Salty (NaCl), Sour (HCl), and Bitter (Quinine)
Taste index relationship: Inversely proportional to taste threshold
Taste Blindness:
Inability to taste certain substances, particularly thiourea compounds
Example: Phenylthiocarbamide
Structure and Function of Taste Buds:
Composition: Epithelial cells, Sustentacular/Supporting cells, Taste cells, Basal cells
Features: Taste pores, Taste hairs/microvilli, and Taste nerve fibers
Location of Taste Buds:
Found in papillae of the tongue (Fungiform, Circumvallate, Foliate)
Also present on the palate, tonsillar pillars, epiglottis, and proximal esophagus
Mechanism of Taste Stimulation:
Interaction of taste substances with receptors on microvilli
Signal transduction pathways for Umami, Sweet, Bitter, Sour, and Salty tastes
Taste Sensitivity and Adaptation:
Decrease in sensitivity with age
Rapid adaptation of taste sensation
Role of Saliva in Taste:
Dissolution of tastants to reach receptors
Washing away the stimulus
Taste Preferences and Aversions:
Mechanisms behind taste preference and aversion
Influence of receptors and neural pathways
Impact of Sensory Nerve Damage:
Degeneration of taste buds if the sensory nerve fiber is cut
Abnormalities of Taste Detection:
Conditions: Ageusia, Hypogeusia, Dysgeusia (parageusia)
Causes: Nerve damage, neurological disorders, infections, poor oral hygiene, adverse drug effects, deficiencies, aging, tobacco use, altered neurotransmitter levels
Neurotransmitters and Taste Threshold:
Effects of serotonin (5-HT) and norepinephrine (NE) on taste sensitivity
Supertasters:
25% of the population with heightened sensitivity to taste, especially bitterness
Increased number of fungiform papillae
Tom Selleck Health: A Comprehensive Look at the Iconic Actor’s Wellness Journeygreendigital
Tom Selleck, an enduring figure in Hollywood. has captivated audiences for decades with his rugged charm, iconic moustache. and memorable roles in television and film. From his breakout role as Thomas Magnum in Magnum P.I. to his current portrayal of Frank Reagan in Blue Bloods. Selleck's career has spanned over 50 years. But beyond his professional achievements. fans have often been curious about Tom Selleck Health. especially as he has aged in the public eye.
Follow us on: Pinterest
Introduction
Many have been interested in Tom Selleck health. not only because of his enduring presence on screen but also because of the challenges. and lifestyle choices he has faced and made over the years. This article delves into the various aspects of Tom Selleck health. exploring his fitness regimen, diet, mental health. and the challenges he has encountered as he ages. We'll look at how he maintains his well-being. the health issues he has faced, and his approach to ageing .
Early Life and Career
Childhood and Athletic Beginnings
Tom Selleck was born on January 29, 1945, in Detroit, Michigan, and grew up in Sherman Oaks, California. From an early age, he was involved in sports, particularly basketball. which played a significant role in his physical development. His athletic pursuits continued into college. where he attended the University of Southern California (USC) on a basketball scholarship. This early involvement in sports laid a strong foundation for his physical health and disciplined lifestyle.
Transition to Acting
Selleck's transition from an athlete to an actor came with its physical demands. His first significant role in "Magnum P.I." required him to perform various stunts and maintain a fit appearance. This role, which he played from 1980 to 1988. necessitated a rigorous fitness routine to meet the show's demands. setting the stage for his long-term commitment to health and wellness.
Fitness Regimen
Workout Routine
Tom Selleck health and fitness regimen has evolved. adapting to his changing roles and age. During his "Magnum, P.I." days. Selleck's workouts were intense and focused on building and maintaining muscle mass. His routine included weightlifting, cardiovascular exercises. and specific training for the stunts he performed on the show.
Selleck adjusted his fitness routine as he aged to suit his body's needs. Today, his workouts focus on maintaining flexibility, strength, and cardiovascular health. He incorporates low-impact exercises such as swimming, walking, and light weightlifting. This balanced approach helps him stay fit without putting undue strain on his joints and muscles.
Importance of Flexibility and Mobility
In recent years, Selleck has emphasized the importance of flexibility and mobility in his fitness regimen. Understanding the natural decline in muscle mass and joint flexibility with age. he includes stretching and yoga in his routine. These practices help prevent injuries, improve posture, and maintain mobilit
Knee anatomy and clinical tests 2024.pdfvimalpl1234
This includes all relevant anatomy and clinical tests compiled from standard textbooks, Campbell,netter etc..It is comprehensive and best suited for orthopaedicians and orthopaedic residents.
Ozempic: Preoperative Management of Patients on GLP-1 Receptor Agonists Saeid Safari
Preoperative Management of Patients on GLP-1 Receptor Agonists like Ozempic and Semiglutide
ASA GUIDELINE
NYSORA Guideline
2 Case Reports of Gastric Ultrasound
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
micro teaching on communication m.sc nursing.pdfAnurag Sharma
Microteaching is a unique model of practice teaching. It is a viable instrument for the. desired change in the teaching behavior or the behavior potential which, in specified types of real. classroom situations, tends to facilitate the achievement of specified types of objectives.
Flu Vaccine Alert in Bangalore Karnatakaaddon Scans
As flu season approaches, health officials in Bangalore, Karnataka, are urging residents to get their flu vaccinations. The seasonal flu, while common, can lead to severe health complications, particularly for vulnerable populations such as young children, the elderly, and those with underlying health conditions.
Dr. Vidisha Kumari, a leading epidemiologist in Bangalore, emphasizes the importance of getting vaccinated. "The flu vaccine is our best defense against the influenza virus. It not only protects individuals but also helps prevent the spread of the virus in our communities," he says.
This year, the flu season is expected to coincide with a potential increase in other respiratory illnesses. The Karnataka Health Department has launched an awareness campaign highlighting the significance of flu vaccinations. They have set up multiple vaccination centers across Bangalore, making it convenient for residents to receive their shots.
To encourage widespread vaccination, the government is also collaborating with local schools, workplaces, and community centers to facilitate vaccination drives. Special attention is being given to ensuring that the vaccine is accessible to all, including marginalized communities who may have limited access to healthcare.
Residents are reminded that the flu vaccine is safe and effective. Common side effects are mild and may include soreness at the injection site, mild fever, or muscle aches. These side effects are generally short-lived and far less severe than the flu itself.
Healthcare providers are also stressing the importance of continuing COVID-19 precautions. Wearing masks, practicing good hand hygiene, and maintaining social distancing are still crucial, especially in crowded places.
Protect yourself and your loved ones by getting vaccinated. Together, we can help keep Bangalore healthy and safe this flu season. For more information on vaccination centers and schedules, residents can visit the Karnataka Health Department’s official website or follow their social media pages.
Stay informed, stay safe, and get your flu shot today!
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
Doi10.18535ijmsciv7i11.06 Dr. ihsan edan abdulkareem alsaimary PROFESSOR IN MEDICAL MICROBIOLOGY AND MOLECULAR IMMUNOLOGY ihsanalsaimary@gmail.com mobile : 009647801410838 university of basrah - college of medicine - basrah -IRAQ
2. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5096 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
and Poltoraka, et al., 1998), TLR10 is so far an
orphan receptor and highly expressed in the human
spleen and B cells. (Hasan, et al., 2005).
Role of tlrs in the defense against prostate
infections is the most evolutionarily conserved role
of tlrs in host defense is the regulation of
antimicrobial responses by epithelial cells, the first
line of defense at mucosal sites such as the
respiratory, gastrointestinal and genitourinary
tracts and the skin. Nevertheless, the widely
accepted hypothesis is that non-sterile sites (i.e.
Mouth, colon, or vagina) would require a response
system different from that of sterile sites (bladder,
kidney, prostate and testis). It is conceivable that
the pattern of expression of tlrs would then differ
at sterile versus non-sterile sites and that at non-
sterile sites epithelial cells might be less efficient
reactive than at sterile sites where even a low load
of deleterious microorganisms should be rapidly
detected and eliminated. (Quayle 2002).
Materials and methods:
Sampling
During collection process data about each patient
were reported in the paper questionnaire for each
one, which included age, marital status, infertility,
family history, personal information and clinical
finding of the diseases. Blood samples were
collected from peoples that are symptomatic and
asymptomatic patient in various hospitals of
Basrah and Missan province. From a total number
of (135) patients with prostatitis were taken from
two provinces from the Basrah teaching hospital
and Missan teaching hospital that included in the
present study and the age of patients was between
40 - >70 years and (50) individuals regarded as a
control group without any urological problems
were also studied.
Molecular Study
The molecular expression includes extracting DNA
from blood cells of prostatitis patients and the
control group by using specific primers for
Conventional PCR and Real Time PCR.
Genomic DNA Extraction
The quality and purity of extracting DNA from
blood samples of prostatitis patients by using a
Favogren DNA Extraction kit was high and every
DNA for each sample was separately extracted and
the results confirm throughout gel electrophoresis,
DNA-based techniques have been further
simplified benefiting from the introduction of
PCR. Various strategies have been adopted in
attempting to use PCR for genome analysis and
specification purposes. (Fairbrother et al., 1998)
as seen in the figure (1).
Figure (1) Show Agarose 1% gel electrophoresis image
(100vlotage for 30min). That show quality and purity of
DNA products extracted from blood samples by commercial
DNA extraction Kit.
Polymerase chain reaction technique
PCR is a very effective method to amplify a
particular DNA as many copies of a specific DNA
(Bartlett 2003), all samples were assayed for the
presence of the TLR1 and TLR2 genes by PCR
using previously described primers, for PCR used
diluted forward and reverse primers and the
primers working solution were prepared by
diluting the stock solution with TE buffer to get
final working solution ( 10 pmole/ µl ) for each
primer.
Table-1 PCR Master mix Volume:
3. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5097 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
Table (2) Oligonucleotide sequence and
Amplicon Size for each gene used in this study
Table (3) the thermal cycler programs used in
this study
Statistical analysis
Statistical analysis is performed with SAS JMP Pro
statistical program version 13.2.1 and Microsoft
Excel 2013. Numerical data were described as
mean, standard deviation of the mean. Logistic
regression was used for comparison between
various groups. The lowest level of accepted
statistical significant difference is below or equal
to 0.0001.
Results:
The results of amplification of extracted DNA
from blood samples was preform and confirm by
using electrophoresis , in this analysis the resulted
DNA bands that came from a successful binding
between the extracted DNA and the target specific
primers for each one of toll like receptors , and the
bands will appear under UV light as a compact
band by using ethidium bromide stain as indicator
DNA stain ,also electrophoresis allow to estimate
the size of molecular DNA by using (100-1500bp
DNA ladder) and (100- 1000bp DNA ladder ) as
DNA marker , the results will show the amplified
DNA ( PCR products ) for each tlrs.
Toll like Receptor 4
The result of PCR amplification which was
performed on the extracted DNA was confirmed
by electrophoresis as the strands of the DNA,
which result from the successful binding, appear as
a single band under U.V illuminator using
ethidium bromide as a specific DNA stain. Only
the bands with expected size 227bp (TLR4 -
specific primer) were observed. As seen in figure
(2). In real time polymerase chain reaction for toll
like receptor 1 for 20 samples the starting time of
amplification was begun after 20 cycles / min, and
the quantitative account of the amplification line
was between 700 - 1100ΔR. As seen in the figure
(3).
Figure (2) Positive and Negative results of PCR
amplification; Lane (1) ladder marker; Lane
(1,2,3,4.5) positive TLR4- specific gene (227bp);
on 1% agarose, (50voltage for 1hour).
Figure (3) Real-Time PCR amplification plot of
target gene for TLR4.
DNA Sequence of FTLR4 gene
Figure (4) showed a DNA sequence of FTLR4
4. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5098 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
Figure (4) DNA sequence of FTLR4
Alignment of FTLR4 gene
Homo sapiens toll like receptor 4 forward (F
TLR4), transcript variant 3, mRNA Sequence ID:
NM_003266.4 Length: 12797Number of Matches:
1, Range 1: 3825 to 4014.
Score
Expect Identities Gaps Strand
335
bits(181)
6e-88 187/190(98%) 0/190(0%) Plus/Plus
Query 1
GCCGGGCGGACTACGTGTGAAGGTATTCAAGGCAGGGAGTATACA
TTGCTGTTTCCTGTT 60
||| || |
|||||||||||||||||||||||||||||||||||||||||||||
||||||
Sbjct 3825
GCCAGGAGAACTACGTGTGAAGGTATTCAAGGCAGGGAGTATACA
TTGCTGTTTCCTGTT 3884
Query 61
GGGCAATGCTCCTTGACCACATTTTGGGAAGAGTGGATGTTATCA
TTGAGAAAACAATGT 120
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 3885
GGGCAATGCTCCTTGACCACATTTTGGGAAGAGTGGATGTTATCA
TTGAGAAAACAATGT 3944
Query 121
GTCTGGAATTAATGGGGTTCTTATAAAGAAGGTTCCCAGAAAAGA
ATGTTCATCCAGCCT 180
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 3945
GTCTGGAATTAATGGGGTTCTTATAAAGAAGGTTCCCAGAAAAGA
ATGTTCATCCAGCCT 4004
Query 181 CCTCAGAAAC 190
||||||||||
Sbjct 4005 CCTCAGAAAC 4014
Figure (5) shows Alignment of FTLR4 gene
Figure (6) showed a DNA sequence of RTLR4
Alignment of RTLR4 gene
Homo sapiens toll like receptor 4 reverse (R
TLR4), transcript variant 3, mRNA Sequence ID:
NM_003266.4, Length: 12797Number of Matches:
1, Range 1: 3793 to 3988
Score Expect Identities Gaps Strand
322 bits
(174)
5e-84 190/197(96%) 3/197(1%) Plus/Minus
Query 5 CTTCTTCTGGG-A-
CTTCTTTATAAGAACCCCATTAATTCCAGACACATTGTTTTCTCA
A 62
||| ||||||| |
|||||||||||||||||||||||||||||||||||||||||||||
|
Sbjct 3988 CTT-
TTCTGGGAACCTTCTTTATAAGAACCCCATTAATTCCAGACACAT
TGTTTTCTCAA 3930
Query 63
TGATAACATCCACTCTCCCCAAAAAGGGGTCAAGGAGCATTGCCC
AACAGGAAACAGCAA 122
|||||||||||||||| ||||||| |
|||||||||||||||||||||||||||||||||
Sbjct 3929
TGATAACATCCACTCTTCCCAAAATGTGGTCAAGGAGCATTGCCC
AACAGGAAACAGCAA 3870
Query 123
TGTATACTCCCTGCCTTGAATACCTTCACACGTAGTTCTCCTGGC
AGTGAGAAGGGTACA 182
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 3869
TGTATACTCCCTGCCTTGAATACCTTCACACGTAGTTCTCCTGGC
AGTGAGAAGGGTACA 3810
Query 183 GGGGAGGGATCCCAACC 199
|||||||||||||| ||
Sbjct 3809 GGGGAGGGATCCCAGCC 3793
Figure (7) shows Alignment of RTLR4 gene
Phylogenetic tree analysis for TLR4
Phylogenetic analysis of the TLR4 isolates were
analyzed by macrogen and compared with
sequences of different TLR4 available in a Gen
Bank database, show a clear convergence between
our TLR4isolates and that of the Gen Bank
database. As seen in the figure (8).
5. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5099 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
Figure (8) Phylogenetic tree analysis for TLR4
Toll like Receptor 10
The result of PCR amplification which was
performed on the extracted DNA was confirmed
by electrophoresis as the strands of the DNA,
which result from the successful binding appear as
a single band under U.V illuminator using
ethidium bromide as a specific DNA stain. Only
the bands with expected size 279bp (TLR10 -
specific primer) were observed. Figure (9).
Figure (9) Positive and Negative results of PCR
amplification; Lane (1) ladder marker; Lane
(1,2,3,4,6,7,9,10,11,12,13,14,15,16,17,18,20)
positive TLR10- specific gene (279bp); Lane
(5,8,19) Negative TLR7- specific primer on 1%
agarose, (50voltage for 1hour).
In real time polymerase chain reaction for toll like
receptor 1 for 20 samples the starting time of
amplification was begun after 20 cycles / min, and
the quantitative account of the amplification line
was between 1200 - 2500ΔR. As seen in the figure
(10).
Figure (10) Real-Time PCR amplification plot of
target gene for TLR10.
DNA sequencing for (FTLR10)
Figure (11) DNA sequence of FTLR10
Alignment of FTLR10 gene
Homo sapiens toll like receptor 10 forward (F
TLR10), mRNA, Sequence ID: NM_001195108.2,
Length: 3705Number of Matches: 1, Range 1: 473
to 705
Score Expect Identities Gaps Strand
431 bits
(233)
9e-117 233/233(100%) 0/233(0%) Plus/Plus
Query 16
AAGGTTCCCGCAGACTTGACCCCAGCCACAACGACACTGGATTTA
TCCTATAACCTCCTT 75
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 473
AAGGTTCCCGCAGACTTGACCCCAGCCACAACGACACTGGATTTA
TCCTATAACCTCCTT 532
Query 76
TTTCAACTCCAGAGTTCAGATTTTCATTCTGTCTCCAAACTGAGA
6. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5100 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
GTTTTGATTCTATGC 135
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 533
TTTCAACTCCAGAGTTCAGATTTTCATTCTGTCTCCAAACTGAGA
GTTTTGATTCTATGC 592
Query 136
CATAACAGAATTCAACAGCTGGATCTCAAAACCTTTGAATTCAAC
AAGGAGTTAAGATAT 195
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 593
CATAACAGAATTCAACAGCTGGATCTCAAAACCTTTGAATTCAAC
AAGGAGTTAAGATAT 652
Query 196
TTAGATTTGTCTAATAACAGACTGAAGAGTGTAACTTGGTATTTA
CTGGCAGG 248
|||||||||||||||||||||||||||||||||||||||||||||
||||||||
Sbjct 653
TTAGATTTGTCTAATAACAGACTGAAGAGTGTAACTTGGTATTTA
CTGGCAGG 705
Figure (12) shows Alignment of FTLR4 gene
DNA sequencing for (R TLR10)
Figure (13) DNA sequence of RTLR10
Alignment of RTLR4 gene
Homo sapiens toll like receptor 10 (TLR10),
transcript variant 1, mRNA, Sequence ID:
NM_030956.4, Length: 3991Number of Matches:
1
Range 1: 712 to 944.
Score
Expect Identities Gaps Strand
425
bits(230)
4e-115 233/234(99%) 1/234(0%) Plus/Minus
Query 17
ATCTAAATATCTTAACTCCTTGTTGAATTCAAAGGTTTTGAGATC
CAGCTGTTGAATTCT 76
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 944
ATCTAAATATCTTAACTCCTTGTTGAATTCAAAGGTTTTGAGATC
CAGCTGTTGAATTCT 885
Query 77
GTTATGGCATAGAATCAAAACTCTCAGTTTGGAGACAGAATGAAA
ATCTGAACTCTGGAG 136
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 884
GTTATGGCATAGAATCAAAACTCTCAGTTTGGAGACAGAATGAAA
ATCTGAACTCTGGAG 825
Query 137
TTGAAAAAGGAGGTTATAGGATAAATCCAGTGTCGTTGTGGCTGG
GGTCAAGTCTGCGGG 196
|||||||||||||||||||||||||||||||||||||||||||||
|||||||||||||||
Sbjct 824
TTGAAAAAGGAGGTTATAGGATAAATCCAGTGTCGTTGTGGCTGG
GGTCAAGTCTGCGGG 765
Query 197
AACCTTTCTTAGAGACATGTTGGAGCAGTTGGTCATCAGTTCCCC
TTTCTTCTG 250
||||||||||||||||||||||||||||||||||||||||||||
|||||||||
Sbjct 764
AACCTTTCTTAGAGACATGTTGGAGCAGTTGGTCATCAGTTCCC-
TTTCTTCTG 712
Figure (14) shows Alignment of RTLR4 gene
Phylogenetic tree analysis for TLR10
Phylogenetic analysis of the TLR10 isolates were
analyzed by macrogen and compared with
sequences of different TLR10 available in a Gen
Bank database, there is no convergence between
our TLR10 isolates and that of the Gen Bank
database. As seen in figure (15).
Figure (15) Phylogenetic tree analysis for TLR10.
7. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5101 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
Discussion:
Findings obtained by this study showed that after
the amplification of all extracted DNA from blood
samples was preform and confirm by using
electrophoresis with (100volt/30min) , the result of
this estimation revealed that the amplified
DNA(PCR product) was 135bp for
TLR1(50voltage for 1hour) and the presence of
TLR1 was 75% from total samples , (PCR product)
was 125bp for TLR2 on agarose gel(1%)
,(50volt/1hour) with a presence of 95% , there are
few reports concerning TLR expression by the
prostate (Konig , et al.,2004) , which is an organ
usually neglected by immunologists, in spite of the
many pathologies that affect it and the tremendous
health impact that.
They have on human population. Although only a
small percentage of men suffer of infectious
chronic or acute prostatitis [National Institutes of
Health (NIH) Categories I and II], chronic,
noninfectious prostatitis (NIH Category III) is a
highly prevalent disease among young adults.
Chronic, nonbacterial prostatitis is an
inflammatory state of the prostate with direct
impact on the quality of life of the patients. Yet, its
etiology is unknown. Furthermore, prostate cancer
is one of the major causes of death in Western
population, being the most commonly diagnosed
cancer in men in industrialized countries. There is
an expanding body of literature suggesting a link
between chronic inflammation and cancer (Gatti ,
et al.,2006) , (Fan , et al.,2019) agree with our
results in expression of TLR2and TLR10 his study
found that prostate tissues expressed TLR2 and
TLR10 in both epithelial and stromal cells and that
TLR2 and TLR10 were co expressed on plasma
membrane and in cytosol of prostate epithelial
cells (RWPE-1). (Alsaimary, 2014). In addition,
TLR10 expressed in the RWPE-1 cells consisted
predominantly of its isoform type.
In the research of (Nagashima, et al.,2015)
microarray analysis of gastric biopsy specimens
from Helicobacter pylori (H. Pylori) -positive and
uninfected subjects showed that TLR2, TLR4, and
TLR6–10 were upregulated >2-fold in infected
subjects. They then used H. Pylori to infect NCI-
87 gastric epithelial cells for 24 h and found
increases in TLR1, TLR2, TLR6, and TLR10 mrna
levels.( Amer, et al.,2014) As far as their studies
and our findings are concerned, the expression of
all tlrs should undoubtedly increase with
inflammatory grades.( Tajalli , et al.,2019) their
review focused on aspects of TLR signaling during
acute neuropathological challenges in the brain and
highlighted the potential neuroprotective capacity
of estrogen, progesterone and vitamin D3 and their
putative interactions with TLR signaling pathways
after cerebral ischemia and TBI. In particular,
TLR2 and TLR4 signaling appeared to be pivotal
for controlling pathogenic immune responses
following stroke. All three hormones were able to
modulate TLR2 and TLR4 signal transduction.
Thus, these steroids and the vitamin can be
considered as therapeutic options for stroke
therapy. The results of our study of sequencing of
TLR4 and TLR10 were shown as following there
are clear convergence between our TLR4 isolates
and that of the Gen Bank database. Where there
were single mutation appeared in forward TLR4 as
A to G 317 1,2. And for reverse TLR4 showed
five mutations when we compared with a Gen
Bank database as T to C 822 1, 2. T to A 296
1,2. T to G 298 1,2. A to C 301 2. G to A
406 1,2. And there is no convergence between
our TLR10 isolates and that of the Gen Bank
database.
There are no studies interested with sequencing of
tlrs with the relation of prostatitis so we will
compare our results with studies on other diseases.
(Kim, et al., 2012) suggested in their study that
polymorphisms of the TLR4 gene might be
associated with the risk of prostate cancer in
Korean men because their results showed a
significant association with the risk of prostate
cancer (P (Corr) = 0.005, OR = 1.81). One
common haplotype (ht2) was also significantly
associated with the risk of prostate cancer (P (Corr)
= 0.009, OR = 1.77). Also (Sun, et al., 2005) said
The TLR6-TLR1-TLR10 gene cluster may play a
role in prostate cancer risk, although further
functional studies are needed to pinpoint the
disease-associated variants in this gene cluster.
(Zhou, et al., 2016) found there were no
association between TLR4 and coronary artery
disease.
References:
[1.] Arango, g and descoteaux a. (2014).
Macrophage cytokines: involvement in
immunity and infectious diseases. Front
immunol, 5(11):491.
[2.] Kais k.a. Alhadrawi, siham j. M. Al-kaabi,
ihsan e.al-saimary. (2015) a study of
bacterial types associated with male’s
infertility in al-najaf al-ashraf governorate.
Kufa biology journal.
8. Ihsan E. AlSaimary et all. / Molecular Gene Expression of Toll-Like Receptors 4 & 10 in Cellular Subsets of Human
Peripheral Blood among Patients with Prostatitis: Conventional, Real Time Pcr and DNA Sequencing Techniques
5102 International Journal of Medical Science and Clinical Invention, vol. 07, Issue 11, Novembe 2020
[3.] Alsaimary ihsan e., Vera h. A. Tossonian,
lina m. M. Al-nahi, Mohammad n. A. Al-
abass, Hussein a. A. Al-hilfi and ibrahim e.
S. Albaldawi. (2014).occurrence of
multidrug resistant bacteria (mdrb) among
oporative theatres in various hospitals of al-
basrah province. Donnish journal of
microbiology and biotechnology research.
Vol 1(2) pp. 035-041 December.
[4.] Kais k.a. Alhadrawi, siham j. M. Al-kaabi,
ihsan e.al-saimary.
(2014).evaluationofimmunoglobulins (iga,
igg, igm) levels in theseraof
patientsoverallandassociatedcases of male
infertilityin al-najaf al-ashraf
governorate.basrah j o urnal o f veteri nar y r
esear ch, vol. 1 1, 4 , pp:67-86 .
[5.] Brede, c and shoskes, d. (2011). The etiology
and management of acute prostatitis. Nat rev
urol 8, 207–212.
[6.] Fan, y; yang, l., Wei, q., ding, y., tang, z.,
tan, p. And qiu, s. (2019). Toll-like receptor
10 (tlr10) exhibits suppressive effects on
inflammation of prostate epithelial
cells. Asian journal of andrology, 21 (4),
393.
[7.] Gatti, g; rivero, v., motrich, r. D., &
maccioni, m. (2006). Prostate epithelial cells
can act as early sensors of infection by up‐
regulating tlr4 expression and
proinflammatory mediators upon lps
stimulation. Journal of leukocyte
biology, 79(5), 989-998.
[8.] Hasan, u ; chaffois, c., gaillard, c., saulnier,
v., merck, e., tancredi, s., guiet, c., brière, f.,
vlach, j., lebecque, s., trinchieri, g., and
bates, e. E. (2005). Human tlr10 is a
functional receptor, expressed by b cells and
plasmacytoid dendritic cells, which activates
gene transcription through myd88. Journal of
immunology (baltimore, md. : 1950), 174(5),
2942–2950.
[9.] Heil, f; hemmi, h., hochrein, h.,
ampenberger, f., kirschning, c., Akira, s. And
bauer, s. (2004). Species-specific recognition
of single-stranded RNA via toll-like receptor
7 and 8. Science, 303(5663), 1526-1529.
[10.] Konig, j. E; senge, t., allhoff, e. P and konig,
w. (2004) analysis of the inflammatory
network in benign prostate hyperplasia and
prostate cancer. Prostate 58, 121–129.
[11.] Nagashima, h; iwatani, s., Cruz, m., jiménez
abreu, j. A., uchida, t., mahachai, v. And
yamaoka, y. (2015). Toll-like receptor 10 in
helicobacter pylori infection. The journal of
infectious diseases, 212(10), 1666-1676.
[12.] Poltorak, a; he, x., smirnova, i., liu, m. Y.,
van huffel, c., du, x., & freudenberg, m.
(1998). Defective LPs signaling in c3h/hej
and c57bl/10sccr mice: mutations in tlr4
gene. Science, 282 (5396), 2085-2088.
[13.] Quayle, a. J. (2002). The innate and early
immune response to pathogen challenge in
the female genital tract and the pivotal role
of epithelial cells. Journal of reproductive
immunology, 57 (1-2), 61-79.
[14.] Takeda. K; kaisho. T and Akira. S. (2003),
toll-like receptors.
Annurevimmunol21:33576.
[15.] Tajalli-nezhad, s; karimian, m., beyer, c.,
atlasi, m. A., & tameh, a. A. (2019). The
regulatory role of toll-like receptors after
ischemic stroke: neurosteroids as tlr
modulators with the focus on tlr2/4. Cellular
and molecular life sciences, 76(3), 523-537.
