SlideShare a Scribd company logo
Scenarios for Discussion:
#1. A Genetic disease “runs” in my family. I want to use IVF to screen for
a baby who will NOT carry this dreaded disease. Why not?
#2. My five year old child has a deadly form of cancer and needs a bone
marrow transplant. I want to have a baby that has exactly the same rare
“tissue type” so they can be a donor and save my beautiful child.
Why not?
#3. I want to have another child. I want this child to be healthy,
physically “stunning”, and have amazing innate musical ability. Why not?
What Technological Advances will make “Designer Babies” Possible?
1. Genomics (understanding of how DNA “programs” life).
- DNA sequencing
- Epigenomic modification
2. In Vitro Fertilization (manipulate embryos outside of the body).
3. Genetic Engineering (engineer novel DNA information in any life form).
- artificial chromosomes
“The Central Dogma”
Life is Programmed by DNA
The Human Genome contains 3 billion base pairs:
3,000,000,000
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCC
TGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACT
GGCAAACTCCTACTCATCCACGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCAGCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTGAGGTTGCAGC
TGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGGAAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCGGCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTC
CCCCCATCCAGCCTCCCTCCCTACACACTCCTCTCAAGGAGGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCATGTC
CTGCTGTGGCATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAGGAGAGCCAAAGGCTGGGT
GTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGGGGCCGGGGCACAGGATACTCCAACCTGCCTGCCCCCATGGTCT
CATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTGCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGG
CTGGACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTGATGGTGTCATGGGACCTGG
CCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGGGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCAC
CCCCAGAGTCCTGCCGCCACCCCCAGATCACACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTGCC
ACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGACCCCTCCCTCACTCCCACTCTCCCACCCC
CACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGG
GGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTGGGGACA
GGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGACAGGGGTGTGGGGACAGGG
GTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGATAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCCCGGGGACAGGGGTG
TGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGACAGGGGTCTGAGGACAGGGGTGTGGGCACAGGGGTCCTGGGGACAGGGGTCCTGGGGACAGGGGTCCTG
GGGACAGGGGTCTGGGGACAGCAGCGCAAAGAGCCCCGCCCTGCAGCCTCCAGCTCTCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGGGCTTTGCTCTCCTGGAG
ACATTTGCCCCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTAATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGAT
CTTCCCACAGACCCAGCACCAGGGAAATGGTCCGGAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCGCCCTAATGGGCCAGGCGGCAGGGGTTG
ACAGGTAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGCCCTCAGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTT
CCAAGGGCCTTTGCGTCAGGTGGGCTCAGGGTTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGG
TGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCC
CCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGA
ACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTG
GCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGAC
CAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAA
ACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGC
CTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGCCTCACGGCAGCTCCATAGTCAGGAGAT
GGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGG
GCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGG
CGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGG
CGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCT
GGAGAACTACTGCAACTAGACGCAGCCTGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTG
TGTGTCTTGGGGGCCCTGGGCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTGCCCACAGGTGCCAACGCCAGGCAGGCC
CAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTTGGCTGCCTGCTGCCCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTTCGGGGGTCTCTGAGGGGCCA
GGGATGGTGGGGCCACTGAGAAGTGACTCTGTCAGTAGCCGACCTGGAGTCCCCAGAGACCTTGTTCAGGAAAGGGAATGAGAACATTCCAGCAATTTTCCCCCCACC
TAGCCCTCCCAGGTTCTATTTTTAGAGTTATTTCTGATGGAGTCCCTGTGGAGGGAGGAGGCTGGGCTGAGGGAGGGGGTCCTGCAGGGCGGGGGGCTGGGAAGGT
GGGGAGAGGCTGCCGAGAGCCACCCGCTATCCCCAGCTCTGGGCAGCCCCGGGACAGTCACACACCCTGGCCTCGCGGCCCAAGCTGGCAGCCGTCTGCAGCCACAG
CTTATGCCAGCCCAGGTCCAGCCAGACACCTGAGGGACCCACTGGTGCCTTGGAGGAAGCAGGAGAGGTCAGATGGCACCATGAGCTGGGGCAGGTGCAGGGACCG
TGG
Genomics
Inheritance of Genetic Disease (eg. Sickle Cell Anemia)
(Mutations change the Genotype)
Genotype  Phenotype (Expressed Trait)
Normal Human Karyotype
(female)
Scenarios for Discussion:
#1. A Genetic disease “runs” in my family. I want to use IVF to screen for
a baby who will NOT carry this dreaded disease. Why not?
#2. My five year old child has a deadly form of cancer and needs a bone
marrow transplant. I want to have a baby that has exactly the same rare
“tissue type” so they can be a donor and save my beautiful child.
Why not?
#3. I want to have another child. I want this child to be healthy,
physically “stunning”, and have amazing innate musical ability. Why not?
http://www.bbc.co.uk/news/science-environment-24398312
“Savior Sister”
Scenarios for Discussion:
#1. A Genetic disease “runs” in my family. I want to use IVF to screen for
a baby who will NOT carry this dreaded disease. Why not?
#2. My five year old child has a deadly form of cancer and needs a bone
marrow transplant. I want to have a baby that has exactly the same rare
“tissue type” so they can be a donor and save my beautiful child.
Why not?
#3. I want to have another child. I want this child to be healthy,
physically “stunning”, and have amazing innate musical ability. Why not?
Phenotypes: Aging
(114 vs 15 years)
Complex “multifactorial” trait versus a
single change in one gene.
Hutchinson-Gilford Progeria syndrome
Genetic Diversity
A Normal Distribution
Broad Sense Heritability:
How we measure the genetic contribution to complex traits in humans.
H2 = S2 Genotypic = S2 Genotypic
S2 Total Phenotypic S2 Genotypic + S2 Environmental
Human Trait H2
Longevity 29
Height 85
Weight 63
Max Heart Rate 84
Verbal Ability 63
Mathematical Ability 76
Temperament Index 58
Human Twin Studies
Beethoven the “Genius”
Genetic Engineering
Cloning Technology
“Dolly”
Scenarios for Discussion:
#1. A Genetic disease “runs” in my family. I want to use IVF to screen for
a baby who will NOT carry this dreaded disease. Why not?
#2. My five year old child has a deadly form of cancer and needs a bone
marrow transplant. I want to have a baby that has exactly the same rare
“tissue type” so they can be a donor and save my beautiful child.
Why not?
#3. I want to have another child. I want this child to be healthy,
physically “stunning”, and have amazing innate musical ability. Why not?
Designer Baby talk 10-9-13

More Related Content

What's hot

Genetics research project
Genetics research projectGenetics research project
Genetics research project
MorganScience
 
In Vitro Fertilization
In Vitro FertilizationIn Vitro Fertilization
In Vitro Fertilization
Veronica B
 
Book Review of 'The Gene: an Intimate History'
Book Review of 'The Gene: an Intimate History'Book Review of 'The Gene: an Intimate History'
Book Review of 'The Gene: an Intimate History'
Artificial Intelligence Institute at UofSC
 
Organ cloning
Organ cloningOrgan cloning
Organ cloning
MorganScience
 
The Clone Wars
The Clone WarsThe Clone Wars
The Clone Wars
Ryan Huelsmann
 
Synthetic biology with Three parent Baby presentation and legal issues relate...
Synthetic biology with Three parent Baby presentation and legal issues relate...Synthetic biology with Three parent Baby presentation and legal issues relate...
Synthetic biology with Three parent Baby presentation and legal issues relate...
Vikram Jeet Singh
 
OMSI Science Pub - Genetics
OMSI Science Pub - GeneticsOMSI Science Pub - Genetics
OMSI Science Pub - Genetics
OMSI Science Pub
 
Somatic cell cloning
Somatic cell cloning Somatic cell cloning
Somatic cell cloning
PRIYABHATT26
 
1 medical genetics
1 medical genetics1 medical genetics
1 medical geneticshassta12
 
Final cloning endangered species 1 main presentation
Final cloning endangered species 1 main presentationFinal cloning endangered species 1 main presentation
Final cloning endangered species 1 main presentation
somsscience7
 
Nicks final cloning endangered species 1 main presentation
Nicks final cloning endangered species 1 main presentationNicks final cloning endangered species 1 main presentation
Nicks final cloning endangered species 1 main presentation
somsscience7
 
Transgenic and genome edited animals
Transgenic and genome edited animalsTransgenic and genome edited animals
Transgenic and genome edited animals
TamannaAntil1
 
Dolly-The Cloned Sheep
Dolly-The Cloned SheepDolly-The Cloned Sheep
Dolly-The Cloned Sheep
Vidya Kalaivani Rajkumar
 
Cloning - #Scichallenge2017
Cloning - #Scichallenge2017Cloning - #Scichallenge2017
Cloning - #Scichallenge2017
Ondřej Volejník
 
Cloning ethical issues
Cloning   ethical issuesCloning   ethical issues
Cloning ethical issuesAnkur Verma
 
Biotechnology in livestock improvement
Biotechnology in livestock improvementBiotechnology in livestock improvement
Biotechnology in livestock improvement
Rameswar Panda
 
Pre-Implantation Genetic Testing (BABI) During IVF
Pre-Implantation Genetic Testing (BABI) During IVFPre-Implantation Genetic Testing (BABI) During IVF
Pre-Implantation Genetic Testing (BABI) During IVF
Yosok Pun
 
Human genetic technologies
Human genetic technologiesHuman genetic technologies
Human genetic technologies
Aparna Chaudhary
 

What's hot (20)

Genetics research project
Genetics research projectGenetics research project
Genetics research project
 
In Vitro Fertilization
In Vitro FertilizationIn Vitro Fertilization
In Vitro Fertilization
 
Cloning3603
Cloning3603Cloning3603
Cloning3603
 
Book Review of 'The Gene: an Intimate History'
Book Review of 'The Gene: an Intimate History'Book Review of 'The Gene: an Intimate History'
Book Review of 'The Gene: an Intimate History'
 
Genetec Engineering
Genetec EngineeringGenetec Engineering
Genetec Engineering
 
Organ cloning
Organ cloningOrgan cloning
Organ cloning
 
The Clone Wars
The Clone WarsThe Clone Wars
The Clone Wars
 
Synthetic biology with Three parent Baby presentation and legal issues relate...
Synthetic biology with Three parent Baby presentation and legal issues relate...Synthetic biology with Three parent Baby presentation and legal issues relate...
Synthetic biology with Three parent Baby presentation and legal issues relate...
 
OMSI Science Pub - Genetics
OMSI Science Pub - GeneticsOMSI Science Pub - Genetics
OMSI Science Pub - Genetics
 
Somatic cell cloning
Somatic cell cloning Somatic cell cloning
Somatic cell cloning
 
1 medical genetics
1 medical genetics1 medical genetics
1 medical genetics
 
Final cloning endangered species 1 main presentation
Final cloning endangered species 1 main presentationFinal cloning endangered species 1 main presentation
Final cloning endangered species 1 main presentation
 
Nicks final cloning endangered species 1 main presentation
Nicks final cloning endangered species 1 main presentationNicks final cloning endangered species 1 main presentation
Nicks final cloning endangered species 1 main presentation
 
Transgenic and genome edited animals
Transgenic and genome edited animalsTransgenic and genome edited animals
Transgenic and genome edited animals
 
Dolly-The Cloned Sheep
Dolly-The Cloned SheepDolly-The Cloned Sheep
Dolly-The Cloned Sheep
 
Cloning - #Scichallenge2017
Cloning - #Scichallenge2017Cloning - #Scichallenge2017
Cloning - #Scichallenge2017
 
Cloning ethical issues
Cloning   ethical issuesCloning   ethical issues
Cloning ethical issues
 
Biotechnology in livestock improvement
Biotechnology in livestock improvementBiotechnology in livestock improvement
Biotechnology in livestock improvement
 
Pre-Implantation Genetic Testing (BABI) During IVF
Pre-Implantation Genetic Testing (BABI) During IVFPre-Implantation Genetic Testing (BABI) During IVF
Pre-Implantation Genetic Testing (BABI) During IVF
 
Human genetic technologies
Human genetic technologiesHuman genetic technologies
Human genetic technologies
 

Viewers also liked

Designer Babies
Designer BabiesDesigner Babies
Designer Babies
somsscience7
 
Designer babies
Designer babiesDesigner babies
Designer babies
somsscience7
 
1.22.medine dönemi islam tarihi il üniversitesi
1.22.medine dönemi islam tarihi il üniversitesi1.22.medine dönemi islam tarihi il üniversitesi
1.22.medine dönemi islam tarihi il üniversitesi
Colorado Theology University
 
Table to Turbine_PRESENTATION
Table to Turbine_PRESENTATIONTable to Turbine_PRESENTATION
Table to Turbine_PRESENTATIONJerod Costner
 
Хэллоуин - Halloween
Хэллоуин - HalloweenХэллоуин - Halloween
Хэллоуин - Halloween
Ruslan Lyashchuk
 
Encuesta a touroperadores
Encuesta a touroperadoresEncuesta a touroperadores
Encuesta a touroperadores
María Dolores Ortiz Montero
 
Mobile - Mobile Marketing
Mobile  -  Mobile MarketingMobile  -  Mobile Marketing
Mobile - Mobile Marketing
Felipe Martinez Alvarez
 
Write up for Web site for Whizz Travels_ Bangla_broucher Makeup Final
Write up for Web site for Whizz Travels_ Bangla_broucher    Makeup FinalWrite up for Web site for Whizz Travels_ Bangla_broucher    Makeup Final
Write up for Web site for Whizz Travels_ Bangla_broucher Makeup FinalMozammel Haque
 
EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...
EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...
EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...
Buenas Noticias Ilimitadas BNIL
 
48645219 o-poder-do-sangue-de-jesus-andrew-murray
48645219 o-poder-do-sangue-de-jesus-andrew-murray48645219 o-poder-do-sangue-de-jesus-andrew-murray
48645219 o-poder-do-sangue-de-jesus-andrew-murray
Gisele Natal
 
Designer babies
Designer babiesDesigner babies
Designer babies
Sneha Mathew
 
designer babies
designer babiesdesigner babies
designer babies
rajendra dangol
 
El Arte de la Edad Media
El Arte de la Edad MediaEl Arte de la Edad Media
El Arte de la Edad Media
DavidProfeSoc
 

Viewers also liked (16)

Designer Babies
Designer BabiesDesigner Babies
Designer Babies
 
Designer babies
Designer babiesDesigner babies
Designer babies
 
1.22.medine dönemi islam tarihi il üniversitesi
1.22.medine dönemi islam tarihi il üniversitesi1.22.medine dönemi islam tarihi il üniversitesi
1.22.medine dönemi islam tarihi il üniversitesi
 
Math1mar48
Math1mar48Math1mar48
Math1mar48
 
College to Career
College to CareerCollege to Career
College to Career
 
BA Thesis
BA ThesisBA Thesis
BA Thesis
 
Table to Turbine_PRESENTATION
Table to Turbine_PRESENTATIONTable to Turbine_PRESENTATION
Table to Turbine_PRESENTATION
 
Хэллоуин - Halloween
Хэллоуин - HalloweenХэллоуин - Halloween
Хэллоуин - Halloween
 
Encuesta a touroperadores
Encuesta a touroperadoresEncuesta a touroperadores
Encuesta a touroperadores
 
Mobile - Mobile Marketing
Mobile  -  Mobile MarketingMobile  -  Mobile Marketing
Mobile - Mobile Marketing
 
Write up for Web site for Whizz Travels_ Bangla_broucher Makeup Final
Write up for Web site for Whizz Travels_ Bangla_broucher    Makeup FinalWrite up for Web site for Whizz Travels_ Bangla_broucher    Makeup Final
Write up for Web site for Whizz Travels_ Bangla_broucher Makeup Final
 
EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...
EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...
EbooK: Manual del ministerio Buenas Noticias Ilimitadas BNIL – Teología de la...
 
48645219 o-poder-do-sangue-de-jesus-andrew-murray
48645219 o-poder-do-sangue-de-jesus-andrew-murray48645219 o-poder-do-sangue-de-jesus-andrew-murray
48645219 o-poder-do-sangue-de-jesus-andrew-murray
 
Designer babies
Designer babiesDesigner babies
Designer babies
 
designer babies
designer babiesdesigner babies
designer babies
 
El Arte de la Edad Media
El Arte de la Edad MediaEl Arte de la Edad Media
El Arte de la Edad Media
 

Similar to Designer Baby talk 10-9-13

Genetics research project
Genetics research projectGenetics research project
Genetics research project
MorganScience
 
Genetics research project
Genetics research projectGenetics research project
Genetics research project
MorganScience
 
GENETIC ENGINEERING.pptx
GENETIC ENGINEERING.pptxGENETIC ENGINEERING.pptx
GENETIC ENGINEERING.pptx
LieLanieNavarro
 
selective breeding and genetic engineering
selective breeding and genetic engineeringselective breeding and genetic engineering
selective breeding and genetic engineering
Buhle Lukhele
 
Sept_18_22_Lesson
Sept_18_22_LessonSept_18_22_Lesson
Sept_18_22_Lesson
prattdianna
 
Genetic engineering-stem-cells-and-cloning-
Genetic engineering-stem-cells-and-cloning-Genetic engineering-stem-cells-and-cloning-
Genetic engineering-stem-cells-and-cloning-
lolaceituno
 
Genetics research
Genetics researchGenetics research
Genetics research
MorganScience
 
Organ cloning
Organ cloningOrgan cloning
Organ cloning
MorganScience
 
Organ cloning
Organ cloningOrgan cloning
Organ cloning
MorganScience
 
Genetics project (2)
Genetics project (2)Genetics project (2)
Genetics project (2)
somsscience7
 
Most recent 3
Most recent 3Most recent 3
Most recent 3
MorganScience
 
Cure and Treatment of Diseases and Disorders
Cure and Treatment of Diseases and DisordersCure and Treatment of Diseases and Disorders
Cure and Treatment of Diseases and Disorders
MorganScience
 
Transgenic organisms and methods of their production.
Transgenic organisms and methods of their production.Transgenic organisms and methods of their production.
Transgenic organisms and methods of their production.
Garima
 
Genetic Research Project
Genetic Research ProjectGenetic Research Project
Genetic Research Project
MorganScience
 
Extinct Animal Cloning
Extinct Animal CloningExtinct Animal Cloning
Extinct Animal Cloning
somsscience7
 
Genetics MeaghanMcKiernanPd1
Genetics MeaghanMcKiernanPd1Genetics MeaghanMcKiernanPd1
Genetics MeaghanMcKiernanPd1somsscience7
 

Similar to Designer Baby talk 10-9-13 (16)

Genetics research project
Genetics research projectGenetics research project
Genetics research project
 
Genetics research project
Genetics research projectGenetics research project
Genetics research project
 
GENETIC ENGINEERING.pptx
GENETIC ENGINEERING.pptxGENETIC ENGINEERING.pptx
GENETIC ENGINEERING.pptx
 
selective breeding and genetic engineering
selective breeding and genetic engineeringselective breeding and genetic engineering
selective breeding and genetic engineering
 
Sept_18_22_Lesson
Sept_18_22_LessonSept_18_22_Lesson
Sept_18_22_Lesson
 
Genetic engineering-stem-cells-and-cloning-
Genetic engineering-stem-cells-and-cloning-Genetic engineering-stem-cells-and-cloning-
Genetic engineering-stem-cells-and-cloning-
 
Genetics research
Genetics researchGenetics research
Genetics research
 
Organ cloning
Organ cloningOrgan cloning
Organ cloning
 
Organ cloning
Organ cloningOrgan cloning
Organ cloning
 
Genetics project (2)
Genetics project (2)Genetics project (2)
Genetics project (2)
 
Most recent 3
Most recent 3Most recent 3
Most recent 3
 
Cure and Treatment of Diseases and Disorders
Cure and Treatment of Diseases and DisordersCure and Treatment of Diseases and Disorders
Cure and Treatment of Diseases and Disorders
 
Transgenic organisms and methods of their production.
Transgenic organisms and methods of their production.Transgenic organisms and methods of their production.
Transgenic organisms and methods of their production.
 
Genetic Research Project
Genetic Research ProjectGenetic Research Project
Genetic Research Project
 
Extinct Animal Cloning
Extinct Animal CloningExtinct Animal Cloning
Extinct Animal Cloning
 
Genetics MeaghanMcKiernanPd1
Genetics MeaghanMcKiernanPd1Genetics MeaghanMcKiernanPd1
Genetics MeaghanMcKiernanPd1
 

Designer Baby talk 10-9-13