This document summarizes research conducted to clone and express recombinant tissue plasminogen activator (rt-PA) using the methylotrophic yeast Pichia pastoris. Specifically, the full-length tPA gene was amplified by PCR and cloned into the pICZαA expression vector. This construct was then transformed into Pichia pastoris X33 cells. One transformant, named Pichia tPA-3, showed extracellular expression of rt-PA at 66 kDa on SDS-PAGE after induction with methanol over 144 hours. Size exclusion chromatography of samples from this transformant showed a product peak at the same retention time as a reference tPA standard. Thus, the researchers successfully achieved cloning and extracellular expression of
Canvax™ offers a wide range of high quality Human Recombinant Proteins for several research applications like ELISA, Western Blot, Antibody Production or Protein array.
Canvax™ offers a wide range of high quality Human Recombinant Proteins for several research applications like ELISA, Western Blot, Antibody Production or Protein array.
Cells respond to nutrient deprivation a variety of ways. In addition to global down regulation of cap-dependent protein
synthesis mediated by the GCN2 and mTO RC1 signaling pathways, a catabolic process autophagy is upregulated to
provide internal building blocks and energy needed to sustain viability. It has recently been shown that during nutrient
deprivation tRNAs accumulate in the nucleus, but the functional role of this accumulation remains unknown. This study
investigates whether subcellular localization of tRNAs plays a role in signaling nutritional stress and autophagy. We report
that human fibroblasts that accumulate tRNA in the nucleus due to downregulation of their transportin, Xpo-t, show
reduced mTO RC1 activity and upregulated autophagy. This suggests that sub-cellular localization of tRNAs may regulate
an unicellular response to starvation independently of the cellular nutritional status.
I received a PhD in April of 2007 from the Schultz Lab at the Scripps Research Institute in La Jolla, CA. Here is a PowerPoint presentation of my primary work - a use of functional genomics tools to probe cellular disease problems, notably in cancer models.
Cloning and Expression of Outer Membrane Protein Omp38 Derived from Aeromonas hydrophila in Escherichia coli
http://dx.doi.org/10.21276/SSR-IIJLS.2019.5.3.8
Cells respond to nutrient deprivation a variety of ways. In addition to global down regulation of cap-dependent protein
synthesis mediated by the GCN2 and mTO RC1 signaling pathways, a catabolic process autophagy is upregulated to
provide internal building blocks and energy needed to sustain viability. It has recently been shown that during nutrient
deprivation tRNAs accumulate in the nucleus, but the functional role of this accumulation remains unknown. This study
investigates whether subcellular localization of tRNAs plays a role in signaling nutritional stress and autophagy. We report
that human fibroblasts that accumulate tRNA in the nucleus due to downregulation of their transportin, Xpo-t, show
reduced mTO RC1 activity and upregulated autophagy. This suggests that sub-cellular localization of tRNAs may regulate
an unicellular response to starvation independently of the cellular nutritional status.
I received a PhD in April of 2007 from the Schultz Lab at the Scripps Research Institute in La Jolla, CA. Here is a PowerPoint presentation of my primary work - a use of functional genomics tools to probe cellular disease problems, notably in cancer models.
Cloning and Expression of Outer Membrane Protein Omp38 Derived from Aeromonas hydrophila in Escherichia coli
http://dx.doi.org/10.21276/SSR-IIJLS.2019.5.3.8
Presented by- MD JAKIR HOSSAIN
Doctoral Research Scholar
Department of Agricultural Genetic Engineering ,
Faculty of Agricultural Sciences and Technologies,
Nigde Omer Halisdemir University, Turkey
E. Mail- mjakirbotru@gmail.com
70-80% of people worldwide rely chiefly on traditional, largely herbal, medicines.
The global demand for herbal medicine is not only large but growing.
Various technologies- adopted for enhancing bioactive molecules in medicinal plants.
Biotechnological tools are important for the multiplication and genetic enhancement of medicinal plants.
In vitro regeneration and genetic transformation are the Techniques adopted.
Call for Research Articles - 10th International Conference on Bioinformatics ...bioejjournal
10th International Conference on Bioinformatics & Biosciences (BIOS 2024) is a forum for presenting new advances and research results in the field of biology to increase the understanding of all biological process. The aim of this conference is to publish all the latest and outstanding research articles in all areas of bioinformatics and Biometrics. Researchers and scientists from the fields of biology, computer science, mathematics, statistics, and physics are invited to share their developments and new techniques in the fields of Biometrics and Bioinformatics. .
DE NOVO TRANSCRIPTOME ASSEMBLY OF SOLID SEQUENCING DATA IN CUCUMIS MELObioejjournal
As sequencing technologies progress, focus shifts towards solving bioinformatic challenges, of which
sequence read assembly is the first task. In the present study, we have carried out a comparison of two
assemblers (SeqMan and CLC) for transcriptome assembly, using a new dataset from Cucumis melo.
Between two assemblers SeqMan generated an excess of small, redundant contigs where as CLC generated
the least redundant assembly. Since different assemblers use different algorithms to build contigs, we
followed the merging of assemblies by CAP3 and found that the merged assembly is better than individual
assemblies and more consistent in the number and size of contigs. Combining the assemblies from different
programs gave a more credible final product, and therefore this approach is recommended for quantitative
output
Cloning and Extracellular Expression of Recombinant Tissue Plasminogen Activa...bioejjournal
Tissue plasminogen activator (tPA) has noteworthy application in treatment of acute myocardial
infarctions. This study focuses on expression of rt-PA using microbial systems in order to reduce cost
without compromising on quality as an alternative to commercial (rt-PA)produced by using mammalian
host systems. In the present study, Pichia pastoris X-33strain was used as a host with pICZαA expression
vector to obtain extracellular expression of full length tPA gene. Specific primers were designed in such a
way to get native tPA protein sequence in subsequent purification steps. Further, construct pICZαA-tPA
was developed and electroporated into host to achieve stablert-PA gene by achieving genome integration.
The transformants were screened for phenotypic characters.Mut+
phenotypic colony named Pichia tPA-3
showed expression of rt-PA at 66 kDa on SDS PAGE. Size Exclusion Chromatography (SEC) was
performed, resulting in product peak at same RT as reference standard. (alteplase).Cloning and expression
of rt-PA was successfully achieved in microbial system. Further process optimization at larger scales will
surely provide cost effective alternative to mammalian system forrt-PA production.
ANTIOXIDANT AND ANTIMICROBIAL ACTIVITIES OF ALGERIAN POPULUS NIGRA L. BUDS EX...bioejjournal
This study is part of a goal to investigate chemical composition, antibacterial, antifungal and antioxidant
activities of the flower buds extracts from the Algerian Polulus nigra L., which were collected from Djarifet
- mansourah at Tlemcen city in the West Northern of Algeria.
In organic extracts, tanins, flavonoïds, coumarins, alkaloids and terpenoïds were the principals secondary
metabolites identified from the flower buds of black poplar. Antibacterial and antifungal activities of
extracts were tested using agar-well diffusion method and micro-well determination of MIC assay against
eleven bacteria and two Candida species. It was found that extracts of black poplar buds exhibit
antibacterial and anticandidal activities with agar disk diffusion (7 to 43mm) and MIC methods (MIC=
90.33 µg/ml against several strains of bacteria and MIC=45.16 µg/ml against Candida albicans). The
antioxidant effect of hydroalcoholic extract was evaluated using DPPH and FRAP assays. It was showed
good and similar activity than ascorbic acid and BHA by DPPH method: IC50= 220µg/mL for
hydroethanol extract.
10th International Conference on Bioinformatics & Biosciences (BIOS 2024)bioejjournal
10th International Conference on Bioinformatics & Biosciences (BIOS 2024) is a forum for presenting new advances and research results in the field of biology to increase the understanding of all biological process. The aim of this conference is to publish all the latest and outstanding research articles in all areas of bioinformatics and Biometrics. Researchers and scientists from the fields of biology, computer science, mathematics, statistics, and physics are invited to share their developments and new techniques in the fields of Biometrics and Bioinformatics. .
Bioscience & Engineering: An International Journal (BIOEJ)bioejjournal
Bioscience & Engineering: An International Journal (BIOEJ) is a peer-reviewed, open access journal that addresses the impacts and challenges of Bioscience, Bioengineering and Applications. The journal documents practical and theoretical results which make a fundamental contribution for the development of Bioscience & Engineering.
LOW POWER CLASS AB SI POWER AMPLIFIER FOR WIRELESS MEDICAL SENSOR NETWORKbioejjournal
The objective of this research was to design a 2.4 GHz class AB Power Amplifier (PA), with 0.18um
Semiconductor Manufacturing International Corporation (SMIC) CMOS technology by using Cadence
software, for health care applications. The ultimate goal for such application is to minimize the trade-offs
between performance and cost, and between performance and low power consumption design. This paper
introduces the design of a 2.4GHz class AB power amplifier which consists of two stage amplifiers. This
power amplifier can transmit 10dBm output power to a 50Ω load. The power added efficiency is 7.5% at
1dB compression point and the power gain is 10dB, the total power consumption is 0.135W. The
performance of the power amplifier meets the specification requirements of the desired.
Bioscience & Engineering: An International Journal (BIOEJ)bioejjournal
Bioscience & Engineering: An International Journal (BIOEJ) is a peer-reviewed, open access journal that addresses the impacts and challenges of Bioscience, Bioengineering and Applications. The journal documents practical and theoretical results which make a fundamental contribution for the development of Bioscience & Engineering.
Phonocardiogram Based Diagnosis Using Machine Learning : Parametric Estimatio...bioejjournal
The heart sound signal, Phonocardiogram (PCG) is difficult to interpret even for experienced
cardiologists. Interpretation are very subjective depending on the hearing ability of the physician. mHealth
has been the adopted approach towards quick diagnosis using mobile devices. However, it has been
challenging due to the required high quality of data, high computation load, and high-power consumption.
The aim of this paper is to diagnose the heart condition based on Phonocardiogram analysis using
Machine Learning techniques assuming limited processing power to be encapsulated later in a mobile
device. The cardiovascular system is modelled in a transfer function to provide PCG signal recording as it
would be recorded at the wrist. The signal is, then, decomposed using filter bank and the analysed using
discriminant function. The results showed that PCG with a 19 dB Signal-to-Noise-Ratio can lead to 97.33%
successful diagnosis.
Call for Papers - Bioscience & Engineering: An International Journal (BIOEJ)bioejjournal
Bioscience & Engineering: An International Journal (BIOEJ) is a peer-reviewed, open access journal that addresses the impacts and challenges of Bioscience, Bioengineering and Applications. The journal documents practical and theoretical results which make a fundamental contribution for the development of Bioscience & Engineering.
NANO BIONIC SWIMMING ROBOTICS ANDAPPLICATIONS IN ENVIRONMENTALENGINEERINGbioejjournal
As microscopic swimmers survive in nature, they have evolved unique structures and swimmingpatterns under the water, which has special advantages. The movement of bacteria at lowReynolds number (Re) environment has aroused extensive research interest. The two typical
swimming methods of bacteria are introduced in this paper. Based on this, we are inspired to design the bionic robot on a micro-scale, which is an artificial
structure that imitates the external shape, movement principle and behavior mode of organisms innature. Compared with traditional robots, nano bionic robots are easier to miniaturize[1]. Theyalso have higher maneuverability so that they can move continuously and flexibly. We expect tosimulate its motion at low Reynolds number (Re) fluids and explore complex future applicationsin dif erent fields
Consistent Relationship of Both Watercontent and Activity With Maize Seed Qua...bioejjournal
Seed quality can be explained using a range of indices that are acceptable within the standards set by the
International Seed Testing Association. There is a need to improve existing models to explain the wellknown variations in seed quality within and between crop species. The objective of this study was to
determine the consistency of using grain water occurrence to explain seed quality in terms of viability and
vigour in maize (Zea mays L.). Four sites were used over two seasons to grow three cultivars in order to
monitor changes in water content, water activity, dry mass and total starch observed in different cob
sections (tip, medium and bottom) at 30, 60 and 90 days after pollination. Seed quality was determined
based on the germination and vigour of physiologically mature kernels. It is concluded that grains that
seed quality is linked to the water activity and position on the cob.
Next Generation Sequencing in Detecting Oral Cancer Due to Tobacco Consumptionbioejjournal
DNA sequence DNA Sequencing is the first step in establishing phylogenetic trees, protein structure
prediction, diagnosis of cancer, discovery of drugs and hence its importance cannot be underestimated.
DNA sequencing finds its use in the diagnosis of oral squamous cell carcinoma (OSCC). Oral Cancer is
the most common occurring malignancies in the world, especially in India where the prevalence for
smoking, Areca nut chewing coupled with a lifestyle that encourages these two activities as fashion are left
many people diagnosed with OSCC. Patients with this OSCC are more likely unaware of its side effects
and over time might suffer from facial deformity. The importance to understanding the symptoms,
prevention and treatment of oral cancer is very much essential today. In this paper, we looked at over 2000
odd papers published and look at the correlation between the next Generation DNA sequencing algorithms
(NGS) play an important role in diagnosis of OSCC. This is a further study on some of the papers which
have highlighted NGS role in OSCC Diagnosis. We did like to see a comprehensive review on the papers
published so far. In the discussion, we will see frequently mutated genes in the OSCC, recent discoveries
and OSCC treatment based on the findings.
Role of Computational Biology in Oral Sciencebioejjournal
DNA sequence Cigarette Smoking, Betel leaf chewing, and alcohol consumption are major cause of oral
cancer in Asia. The difficulty in quitting, coupled with patients’ economic conditions affects the inability to
get diagnosed early, driving death rate higher. There has been major advancement in molecular sciences,
computational biology, and other fields today, but we are not still able to pinpoint the causes of oral
cancer, also known as Squamous Cell Carcinoma (OSCC). Early detection leads to better survival rate,
therefore, education on yearly check-ups plays a vital role. Computational analysis at the genomic (DNA
sequence) can help patients with targeted cellular treatment and hopefully a cure. In this paper, we would
look at computation tools used in detecting OSCC and various analysis. Analysis includes detecting
abnormality in the cell and other molecular reactions which later morph into a cancerous cell. Later, we
investigate all computational tools or techniques from local and global sequence alignment, protein
structure, gene, functional structure analysis which help medical staff detect cancer, which in turn can help
with oral cancer treatment, prognosis and hopefully a cure.
NEXT GENERATION SEQUENCING IN DETECTING ORAL CANCER DUE TO TOBACCO CONSUMPTIONbioejjournal
DNA sequence DNA Sequencing is the first step in establishing phylogenetic trees, protein structure
prediction, diagnosis of cancer, discovery of drugs and hence its importance cannot be underestimated.
DNA sequencing finds its use in the diagnosis of oral squamous cell carcinoma (OSCC). Oral Cancer is
the most common occurring malignancies in the world, especially in India where the prevalence for
smoking, Areca nut chewing coupled with a lifestyle that encourages these two activities as fashion are left
many people diagnosed with OSCC. Patients with this OSCC are more likely unaware of its side effects
and over time might suffer from facial deformity. The importance to understanding the symptoms,
prevention and treatment of oral cancer is very much essential today. In this paper, we looked at over 2000
odd papers published and look at the correlation between the next Generation DNA sequencing algorithms
(NGS) play an important role in diagnosis of OSCC. This is a further study on some of the papers which
have highlighted NGS role in OSCC Diagnosis. We did like to see a comprehensive review on the papers
published so far. In the discussion, we will see frequently mutated genes in the OSCC, recent discoveries
and OSCC treatment based on the findings.
ROLE OF COMPUTATIONAL BIOLOGY IN ORAL SCIENCEbioejjournal
DNA sequence Cigarette Smoking, Betel leaf chewing, and alcohol consumption are major cause of oral
cancer in Asia. The difficulty in quitting, coupled with patients’ economic conditions affects the inability to
get diagnosed early, driving death rate higher. There has been major advancement in molecular sciences,
computational biology, and other fields today, but we are not still able to pinpoint the causes of oral
cancer, also known as Squamous Cell Carcinoma (OSCC). Early detection leads to better survival rate,
therefore, education on yearly check-ups plays a vital role. Computational analysis at the genomic (DNA
sequence) can help patients with targeted cellular treatment and hopefully a cure. In this paper, we would
look at computation tools used in detecting OSCC and various analysis. Analysis includes detecting
abnormality in the cell and other molecular reactions which later morph into a cancerous cell. Later, we
investigate all computational tools or techniques from local and global sequence alignment, protein
structure, gene, functional structure analysis which help medical staff detect cancer, which in turn can help
with oral cancer treatment, prognosis and hopefully a cure.
Statistical Based Media Optimization and Production of Clavulanic Acid By Sol...bioejjournal
Statistics based optimization, Plackett–Burman design (PBD) and response surface methodology
(RSM) were employed to screen and optimize the media components for the production of
clavulanic acid from Streptomyces clavuligerus MTCC 1142, using solid state fermentation. jackfruit
seed powder was used as both the solid support and carbon source for the growth of Streptomyces
clavuligerus MTCC 1142. Based on the positive influence of the Pareto chart obtained from PBD on
clavulanic acid production, five media components – yeast extract, beef extract, sucrose, malt extract
and ferric chloride were screened. Central composite design (CCD) was employed using these five
media components- yeast extract 2.5%, beef extract 0.5%, sucrose 2.5%, malt extract 0.25% and ferric
chloride nutritional factors at three levels, for further optimization, and the second order polynomial
equation was derived, based on the experimental data. Response surface methodology showed that
the concentrations of yeast extract 2.5%, beef extract 0.5%, sucrose 2.5%, malt extract 0.25% and ferric
chloride 2.5% were the optimal levels for maximal clavulanic acid production (19.37 mg /gds) which
were validated through experiments.
A New Low-Complexity Algorithm for the Pulse Transit Time Evaluationbioejjournal
The pulse transit time (PTT) is a physiological parameter commonly derived from Electrocardiogram
(ECG) and Photoplethysmogram (PPG) signal. It is defined as the time taken for the arterial pulse to
travel from the heart to a peripheral site, and can be used as a direct indicator of Cardiovascular Diseases
(CVD). In this study, we propose a new low-complexity algorithm for the (PTT) estimation. The (PTT) is
calculated as the interval between the peak of the ECG R-wave and a time point on the PPG. We
considered a dataset of 37 subjects containing a simultaneous recording of the (ECG) and the (PPG). The
computation of the (PTT) consists of detecting the peak and foot points of a (PPG) and the R peak of the
(ECG) signal. Our algorithm is improved by a temporal analysis by windowing. The results obtained are
promising. The average sensitivity (SEN) and accuracy (ACC) obtained are respectively (97.5%, and
96.82%) for the detection of R peaks and (97.77%, and 97.64%) for the detection of PPG peaks. The
sensitivity (SEN) and accuracy (ACC) of the foot (PPG) detection were 98.33% and 94.14%.
ANTIOXIDANT AND ANTIMICROBIAL ACTIVITIES OF ALGERIAN POPULUS NIGRA L. BUDS EX...bioejjournal
This study is part of a goal to investigate chemical composition, antibacterial, antifungal and antioxidant
activities of the flower buds extracts from the Algerian Polulus nigra L., which were collected from Djarifet
- mansourah at Tlemcen city in the West Northern of Algeria.
In organic extracts, tanins, flavonoïds, coumarins, alkaloids and terpenoïds were the principals secondary
metabolites identified from the flower buds of black poplar. Antibacterial and antifungal activities of
extracts were tested using agar-well diffusion method and micro-well determination of MIC assay against
eleven bacteria and two Candida species. It was found that extracts of black poplar buds exhibit
antibacterial and anticandidal activities with agar disk diffusion (7 to 43mm) and MIC methods (MIC=
90.33 µg/ml against several strains of bacteria and MIC=45.16 µg/ml against Candida albicans). The
antioxidant effect of hydroalcoholic extract was evaluated using DPPH and FRAP assays. It was showed
good and similar activity than ascorbic acid and BHA by DPPH method: IC50= 220µg/mL for
hydroethanol extract.
NEW SEQUENCE ALIGNMENT ALGORITHM USING AI RULES AND DYNAMIC SEEDSbioejjournal
DNA sequence alignment is important today as it is usually the first step in finding gene mutation,
evolutionary similarities, protein structure, drug development and cancer treatment. Covid-19 is one
recent example. There are many sequencing algorithms developed over the past decades but the sequence
alignment using expert systems is quite new. To find DNA sequence alignment, dynamic programming was
used initially. Later faster algorithms used small DNA sequence length of fixed size to find regions of
similarity, and then build the final alignment using these regions. Such systems were not sensitive but were
fast. To improve the sensitivity, we propose a new algorithm which is based on finding maximal matches
between two sequences, find seeds between them, employ rules to find more seeds of varying length, and
then employ a new stitching algorithm, and weighted seeds to solve the problem.
Student information management system project report ii.pdfKamal Acharya
Our project explains about the student management. This project mainly explains the various actions related to student details. This project shows some ease in adding, editing and deleting the student details. It also provides a less time consuming process for viewing, adding, editing and deleting the marks of the students.
Industrial Training at Shahjalal Fertilizer Company Limited (SFCL)MdTanvirMahtab2
This presentation is about the working procedure of Shahjalal Fertilizer Company Limited (SFCL). A Govt. owned Company of Bangladesh Chemical Industries Corporation under Ministry of Industries.
About
Indigenized remote control interface card suitable for MAFI system CCR equipment. Compatible for IDM8000 CCR. Backplane mounted serial and TCP/Ethernet communication module for CCR remote access. IDM 8000 CCR remote control on serial and TCP protocol.
• Remote control: Parallel or serial interface.
• Compatible with MAFI CCR system.
• Compatible with IDM8000 CCR.
• Compatible with Backplane mount serial communication.
• Compatible with commercial and Defence aviation CCR system.
• Remote control system for accessing CCR and allied system over serial or TCP.
• Indigenized local Support/presence in India.
• Easy in configuration using DIP switches.
Technical Specifications
Indigenized remote control interface card suitable for MAFI system CCR equipment. Compatible for IDM8000 CCR. Backplane mounted serial and TCP/Ethernet communication module for CCR remote access. IDM 8000 CCR remote control on serial and TCP protocol.
Key Features
Indigenized remote control interface card suitable for MAFI system CCR equipment. Compatible for IDM8000 CCR. Backplane mounted serial and TCP/Ethernet communication module for CCR remote access. IDM 8000 CCR remote control on serial and TCP protocol.
• Remote control: Parallel or serial interface
• Compatible with MAFI CCR system
• Copatiable with IDM8000 CCR
• Compatible with Backplane mount serial communication.
• Compatible with commercial and Defence aviation CCR system.
• Remote control system for accessing CCR and allied system over serial or TCP.
• Indigenized local Support/presence in India.
Application
• Remote control: Parallel or serial interface.
• Compatible with MAFI CCR system.
• Compatible with IDM8000 CCR.
• Compatible with Backplane mount serial communication.
• Compatible with commercial and Defence aviation CCR system.
• Remote control system for accessing CCR and allied system over serial or TCP.
• Indigenized local Support/presence in India.
• Easy in configuration using DIP switches.
Hierarchical Digital Twin of a Naval Power SystemKerry Sado
A hierarchical digital twin of a Naval DC power system has been developed and experimentally verified. Similar to other state-of-the-art digital twins, this technology creates a digital replica of the physical system executed in real-time or faster, which can modify hardware controls. However, its advantage stems from distributing computational efforts by utilizing a hierarchical structure composed of lower-level digital twin blocks and a higher-level system digital twin. Each digital twin block is associated with a physical subsystem of the hardware and communicates with a singular system digital twin, which creates a system-level response. By extracting information from each level of the hierarchy, power system controls of the hardware were reconfigured autonomously. This hierarchical digital twin development offers several advantages over other digital twins, particularly in the field of naval power systems. The hierarchical structure allows for greater computational efficiency and scalability while the ability to autonomously reconfigure hardware controls offers increased flexibility and responsiveness. The hierarchical decomposition and models utilized were well aligned with the physical twin, as indicated by the maximum deviations between the developed digital twin hierarchy and the hardware.
Final project report on grocery store management system..pdfKamal Acharya
In today’s fast-changing business environment, it’s extremely important to be able to respond to client needs in the most effective and timely manner. If your customers wish to see your business online and have instant access to your products or services.
Online Grocery Store is an e-commerce website, which retails various grocery products. This project allows viewing various products available enables registered users to purchase desired products instantly using Paytm, UPI payment processor (Instant Pay) and also can place order by using Cash on Delivery (Pay Later) option. This project provides an easy access to Administrators and Managers to view orders placed using Pay Later and Instant Pay options.
In order to develop an e-commerce website, a number of Technologies must be studied and understood. These include multi-tiered architecture, server and client-side scripting techniques, implementation technologies, programming language (such as PHP, HTML, CSS, JavaScript) and MySQL relational databases. This is a project with the objective to develop a basic website where a consumer is provided with a shopping cart website and also to know about the technologies used to develop such a website.
This document will discuss each of the underlying technologies to create and implement an e- commerce website.
Water scarcity is the lack of fresh water resources to meet the standard water demand. There are two type of water scarcity. One is physical. The other is economic water scarcity.
Immunizing Image Classifiers Against Localized Adversary Attacksgerogepatton
This paper addresses the vulnerability of deep learning models, particularly convolutional neural networks
(CNN)s, to adversarial attacks and presents a proactive training technique designed to counter them. We
introduce a novel volumization algorithm, which transforms 2D images into 3D volumetric representations.
When combined with 3D convolution and deep curriculum learning optimization (CLO), itsignificantly improves
the immunity of models against localized universal attacks by up to 40%. We evaluate our proposed approach
using contemporary CNN architectures and the modified Canadian Institute for Advanced Research (CIFAR-10
and CIFAR-100) and ImageNet Large Scale Visual Recognition Challenge (ILSVRC12) datasets, showcasing
accuracy improvements over previous techniques. The results indicate that the combination of the volumetric
input and curriculum learning holds significant promise for mitigating adversarial attacks without necessitating
adversary training.
Cloning and Extracellular Expression of Recombinant Tissue Plasminogen Activator (RT-PA) Using a Methylotrophic Yeast Pichia Pastoris
1. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
1
CLONING AND EXTRACELLULAR
EXPRESSION OF RECOMBINANT TISSUE
PLASMINOGEN ACTIVATOR (RT-PA) USING
A METHYLOTROPHIC YEAST PICHIA
PASTORIS
Atul M. Vhanmarathi, Rekha Matlani and Arvind M.Lali
DBT-ICT-Centre for Biosciences, Institute of chemical Technology, Mumbai
atulmv4biotech@gmail.com, rekkhushim@gmail.com
ABSTRACT
Tissue plasminogen activator (tPA) has noteworthy application in treatment of acute myocardial
infarctions. This study focuses on expression of rt-PA using microbial systems in order to reduce cost
without compromising on quality as an alternative to commercial (rt-PA)produced by using mammalian
host systems. In the present study, Pichia pastoris X-33strain was used as a host with pICZαA expression
vector to obtain extracellular expression of full length tPA gene. Specific primers were designed in such a
way to get native tPA protein sequence in subsequent purification steps. Further, construct pICZαA-tPA
was developed and electroporated into host to achieve stablert-PA gene by achieving genome integration.
The transformants were screened for phenotypic characters.Mut+
phenotypic colony named Pichia tPA-3
showed expression of rt-PA at 66 kDa on SDS PAGE. Size Exclusion Chromatography (SEC) was
performed, resulting in product peak at same RT as reference standard. (alteplase).Cloning and expression
of rt-PA was successfully achieved in microbial system. Further process optimization at larger scales will
surely provide cost effective alternative to mammalian system forrt-PA production.
KEYWORDS
Tissue plasminogen activator, acute myocardial infarctions, Pichia pastoris, pICZαA, FactorXa protease,
SDS PAGE, Size Exclusion Chromatography etc.
1. INTRODUCTION
Proteins are being extensively used in therapeutics because of their high specificity and
immunologically acceptability over small drug molecules. Globally, therapeutic proteins had a
compound annual growth rate (CAGR) of 16.4% from 2002 to 2010 whereas, the market forecast
is to grow at a CAGR of 6.2% from 2010-2017, to reach $141.5 billion in 2017. (GBI market
report, 2011)
Therapeutic proteins are very popular because of their following advantages over small drug
molecules: 1) Proteins often serve as a highly specific and complex set of functions that cannot be
2. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
2
mimicked by simple chemical compounds 2) The action of proteins is highly specific, there is
often less potential for protein therapeutics to interfere with normal biological processes and
cause adverse effects 3) The body naturally produces many of the proteins that are used as
therapeutics these agents are often well tolerated and are less likely to elicit immune
responses.The clinical development and FDA approval time of protein therapeutics may be faster
than that of small-molecule drugs [8]. There are many examples of therapeutic proteins that have
been successfully commercialized such as Insulin (Hormone), Factor VIII, IX (Blood coagulation
factor), thrombolytic agents like Alteplase and Reteplase[17].
Tissue plasminogen activator (tPA) is an important component of fibrinolytic system to maintain
the proper blood flow in the body. Thrombolytic therapy is a major treatment for cardio-vascular
diseases such as acute myocardial infarction (AMI), cerebrovascular disease and deep vein
thrombosis, are major causes of death and disability [22]. Tissue plasminogen activator is a serine
protease having thrombolytic activity. It has advantage of causing no side effects such as
systemic hemorrhaging and fibrinogen depletion over other types of plasminogen activators
[14].Human tissue-type plasminogen activator is a 562 amino acid glycoprotein, having 67 KDa
molecular weight. Tissue plasminogen activator consist of 17 disulfide bonds in 34 cysteine
residues contributing to the characteristic folding of the chain. Structure of tPA protein comprises
of five distinct domains: a fibrin binding ‘finger’ region, an ‘epidermal growth factor’ like sub
domain, two disulphide looped ‘kringle’ domains and a carboxy-terminal serine protease
‘catalytic’ domain [18].
Initially, bowes melanoma cells were the primary source of tPA production for medical purposes.
As the importance of therapeutics increased drastically, scientists made effortless experiments for
cost effective abundant tPA production using mammalian and microbial host systems. However
as time progressed, Pichia pastoris has emerged as the most compatible and successful host for
expression of heterologous recombinant proteins. Now-a-days, more than 500 proteins have been
cloned and expressed using this methylotrophic yeast system [5]. Several factors has contributed
for its rapid acceptance as unique and highly useful over other microbial host systems; 1) a strong
tendency for respiratory growth instead of fermentative growth, 2) ability to grow on minimal
medium at very high cell densities, 3) as easy as E. coli for even genetic manipulation, 4)highly
compatible to fermentation processes with no virus and endotoxins production, 5) secretes very
minimal levels of host cell proteins and also avoids hyper-glycosylation [3]. But the most
important characteristic of the Pichia pastoris is existence of very strong and tightly regulated
promoter from alcohol oxidase 1 gene (PAOX1).
Alcohol oxidase is the first enzyme of the methanol assimilation pathway which catalyses the
oxidation of methanol to formaldehyde[2]. There are two alcohol oxidase genes in P. pastoris
which code for the alcohol oxidase enzyme, the alcohol oxidase 1 gene (AOX1), which is
responsible for greater than 90% of the enzyme in the cell, and the alcohol oxidase 2 (AOX2) for
less than 10%. There are three types of P. pastoris host strains available that vary with regard to
their ability to utilize methanol. The wild type or methanol utilization plus phenotype (Mut+
), and
those resulting from deletions in the AOX1 gene (methanol utilization slow Muts
) or both AOX
genes (methanol utilization minus Mut-
)[5].
In this study, for the first time Pichia pastoris X33 host cell system was used for cloning and
expression of full length tissue plasminogen activator protein using novel primer design strategy.
3. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
3
2. MATERIALSANDMETHODS
2.1.MATERIALS
Tissue plasminogen activator cDNA clone was purchased (Thermo Scientific open biosystems)
and used as a source of gene for PCR amplification. Escherichia coli TOP10F’ and Pichia
pastoris X33 strains were used for cloning and expression of tPA gene respectively. Both strains
were obtained from Pichia expression kit (Invitrogen, USA). PlasmidspTZ57R/T (Fermentas Inc.
Vilnius, Lithuania) as cloning vector and pICZαA (Invitrogen, USA) as an expression vector
were used in this study.Luria-Bertani media for E. coli and YPD media for P.pastoris were used
to support growth of both strains (Hi-media Ltd, India). Buffered complex medium, containing
glycerol (BMGY) was used for growing the host cells before induction, and buffered complex
medium, containing methanol (BMMY) was used as an induction medium (Invitrogen, USA).
2.2. METHODS
2.2.1. Primers Design
Specially designed primers were used in this study. Both primers were designed with
incorporation of restriction site.Additionally, forward primer named PPFortPA was also having
FactorXa specific endo-protease recognition site (5’-ATTGAAGGTAGA-3’). Expression cascade
of pPICZαA vector is represented in Figure 1. This vector has α factor secretion signal sequence
which allows efficient secretion of recombinant protein from Pichia host cell. The C- terminal
poly histidine tag permits purification of protein on metal-chelating resin. Restriction enzyme
Xho I and Xba I were selected from MCS and restriction sites incorporated in PPFortPA and
reverse primer named PPRevtPA respectively. This design helped to maintain open reading frame
of the gene after successful cloning into vector. After expression, during polishing steps, use of
FactorXa protease enzyme facilitates cleavage at C-terminal of Arginine present in recognition
site eventually providing the native tissue plasminogen activator protein with no unwanted amino
acid stretch.
Figure 1: Expression cascade of pPICZαA vector which includes α-factor secretion signal sequence
originally from saccharomyces cerevisiae, multiple cloning site (MCS) facilitating cloning and C-terminal
tags for ease of purification.
4. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
4
2.2.2.PCR amplification and cloning of tissue plasminogen activator gene
Tissue plasminogen activator cDNA clone (Gene bank accession number BC013968.2) was used
as PCR template (source of GOI) while, PPFortPA (5’-
CTCGAGATTGAAGGTAGAATGGATGCAATGA AGAGAGGGCTC -3’) and PPRevtPA (5’-
TCTAGAACTCACGGTCGCATGTTGTCACGAATCCAGT CTAG -3’) were used to amplify
full length tPA gene. The tPA gene was amplified using high fidelity PCR (Thermal cycler
C1000, Bio-Rad Laboratories, USA). All PCR reactions were subjected to 34°C thermal cycles of
denaturation for 1 min at 95°C followed by temperature gradient for annealing at 64°C to 71°C
for 1 min and then extended for 2 min at 72°C, with initial 1 cycle of denaturation for 5 min at
95°C and final extension for 10 min at 72°C. Then, 1710 bp PCR product was further purified
using Pure link- PCR purification kit (Invitrogen, USA) and purified amplicon (PCR product)
was confirmed by restriction enzyme analysis done using 1% agarose gel electrophoresis.
PCR amplification of tPA gene was performed using Taq-DNA polymerase which has an
advantageous terminal transferase activity. This enzyme adds a single 3’-A overhang to both ends
of the PCR product. This structure favors direct cloning into a linearized cloning vector with
single 3’-ddT overhangs. Using this principle, purified amplicon was ligated with pTZ57R/T
cloning vector maintaining GOI to vector ratio 3:1 as per below formula;
݊݅ݐܽݎݐ݊݁ܿ݊ܥ ݂ ܫܱܩ ሺ݊݃ሻ =
݊݅ݐܽݎݐ݊݁ܿ݊ܥ ݂ ܸ݁ܿݎݐ ሺ݊݃ሻ × ݁ݖ݅ݏ ݂ ܫܱܩ ሺܾܭሻ
ܵ݅݁ݖ ݂ ܸ݁ܿݎݐ ሺܾܭሻ
Thus, an intermediate construct pTZ57RtPA was developed using InsT/Aclone PCR cloning kit
(Fermentas Inc. Vilnius, Lithuania). Construct was transformed successfully into E. coli TOP10F’
and transformants were screened using blue white screening technique. Restriction mapping was
also performed to check the correct orientation of the insert into an intermediate vector of positive
transformants. Further confirmation was done by performing bidirectional sequencing of the
intermediate construct.
Preparation of final construct was started with restriction digestion of both pTZ57RtPA and
pICZαA vectorusing Xho I and Xba I enzymes. This step provided full length tPA gene with
FactorXa protease recognition site on N-terminal available for cloning into expression vector.
Thus, Final construct was developed and named as pICZαAtPA. Successful cloning was
confirmed by three distinctive test such as; 1) Colony PCR of screened transformants, 2)
Restriction analysis using same set of restriction enzymes and 3) Bidirectional sequencing was
performed using primers 5’AOX promoter (5’- GACTGGTTCCAATTGACAAGC-3’) and
3’AOX terminator (5’-GCAAATGGCATTCTGACATCC-3’) to ensure reading frame of the
gene prior to expression.
2.2.3.Transformation of construct into Pichia pastoris X33 cells
Nucleotide sequence of final construct pICZαAtPA was subjected again to NEB cutter web tool
analysis which resulted in to use Pme Irestriction enzyme for linearization of construct. This
enzyme provides a single cut at 414 bp into AOX promoter region to linearize the construct. This
linearized construct upon transformation, integrates into Pichia pastoris genome by homologous
recombination at AOX1 promoter locus thus providing stability to insert gene of interest. Five µl
5. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
5
of Pme Irestriction enzyme was used to achieve complete linearization of the construct. Further
chemically competent Pichia pastoris X33 cells were prepared using material and procedure
provided into Pichia expression kit (Invitrogen, USA). Linearized construct pICZαAtPA was
transformed into the active cells using standard protocol provided by the manufacturer
(Invitrogen, USA). Transformation reactions were spread and allowed to grow on YEPD agar
plates containing 100 µg/ml zeocin antibiotic. Colony PCR was performed to confirm the
transformation and stability of final construct using a pair of primers of AOX promoter locus.
Homologous recombination of AOX promoter locus of linearized vector with Pichia genome can
provide two possibilities; either the AOX1 promoter locus will remain intact representing Mut+
phenotypic character (Methanol utilization plus), or theAOX1 promoter locus gets disrupted
resulting in pseudo AOX1 i.e. AOX2 promoter which will be represent MutS
phenotypic
character (Methanol utilization slow). Thus, after successful transformation of construct into
Pichia pastoris X33 host cells, screening of positive transformants were done for phenotypic
character determination. Transformants were streaked on both minimal dextrose with histidine
(MDH) and minimal methanol with histidine (MMH) agar plates. Plates were incubated at 30°C
for minimum 3 days and growth of isolated colonies was monitored.
2.2.4.The expression of recombinant Pichia pastoris X33 strain
Single colony was inoculated in 100 ml of BMGY medium, incubated at 30°C in a shaker
incubator at 230 rpm. The cells at OD600 = 4 were harvested by centrifugation at 2000 ×g for 5
min at RT and re-suspended in 200 ml of BMMY medium for induction at 30°C. Every 24 hours,
100% methanol to a final concentration of 0.5% was used to maintain the induction phase till log
144 h.
2.2.5.SDS PAGE and Size Exclusion chromatography
Perday 1sample were collected from age of 24 h,48h, 72h, 96h, and 120htill 144 h and
centrifuged to get the supernatant required for further expression analysis. Analysis was done by
10% SDS PAGE with positive control reference standard tPA protein (Alteplase) against pre
stained protein molecular marker. Same set of samples were further injected sequentially into a
size exclusion chromatography (SEC) system in comparison to a reference standard tPA protein
(Alteplase). Samples were filtered with 0.22 µm filter and 5 µl sample volume was injected for
each sample. System was run at 0.75 mL/min flow rate at room temperature with run time of 60
minute each.
3. RESULTS
3.1.CLONINGOFTISSUEPLASMINOGEN ACTIVATOR
Restriction mapping analysis of pTZ57RtPA showed a successful cloning of the full length tPA gene into
cloning vector with correct orientation. Full length tPA gene was subjected to NEB cutter tool web tool
analysis resulting in use of SacI restriction enzyme. Itcutat only one site in between tPA gene sequence at
1337/1341 bp providing two distinct bands of 1.3 Kb and 400bp when analyzed on agarose gel
electrophoresis. Thus, it is prominent from the results that the concept of restriction mapping was used
6. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
6
successfully to identify the intermediate clone with a correct orientation of the tPA gene (insert) into vector
(Figure 2).
After Restriction mapping of intermediate construct, sub cloning of tPA gene into expression
vector was achieved. Colony PCR was performed for positive transformants of pICZαAtPA
expression construct, which showed successful ligation of tPA gene into pPICZαA expression
vector (Figure 3). All 6 positive transformants (colonies) selected showed PCR amplicon of 1.7
Kb comparing with (positive control) reference tPA cDNA PCR amplicon and molecular marker.
Furthermore, as 2nd
distinctive test, restriction analysis of final construct pICZαAtPA reflected
successful sub cloning of tPA gene from cloning vector to expression vector. The size of final
expression construct was 5303 bp and digestion of this construct with Xho I and Xba I restriction
Figure 2Agarose gel electrophoresis of restriction digestion of PCR positive
recombinants, Lane 1; 1 kb DNA molecular marker, Lane 2 & 3; PCR
positive recombinants
Figure 3Agarose gel electrophoresis of Colony PCR of tPA-pICZαA transformants, Lane 2;
PCR positive control, Lane 8; 1 kb DNA molecular marker and Lanes 1, 3-7; Colony PCR
positive tPA- pICZαA transformants
7. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
7
sites resulted into two different fragments of linearized pICZαA vector (3593 bp) and tPA clone
(1710 bp) respectively compared with (negative control) expression vector without insert. (Figure
4)
Bidirectional sequencing was performed as 3rd
distinctive test. NCBI blast of both forward and
reverse primer query sequences with reference tPA cDNA clone sequence (Gene bank accession
number BC013968.2) proved successful cloning of full length tPA gene into an expression
vector maintaining it’s open reading frame such as to express recombinant tPA protein with
native sequence. Sequencing resulted with 100% similarity with the reference, thus finally
delivering desired pICZαAtPA expression construct. Thus after these tests it was proved that,
pICZαAtPA expression construct was developed successfully with correct orientation of the
insert into vector maintaining open reading frame for protein translation.
3.2. TRANSFORMATION OFCONSTRUCT
Prior to transformation, expression construct was linearized using Pme I enzyme and transformed
successfully into chemically competent Pichia pastoris X33 cells. Further, experiment to identify
phenotypic character was conducted. Isolated colonies on MMH plates were observed resulting in
Mut+
phenotype of Pichia pastoris X33 cell containing pICZαAtPA construct. Positive
transformants were screened and colony named PichiatPA3was further taken up for expression
analysis.
3.3. SDSPAGEAND SECANALYSIS
Daily samples collected from expression study were centrifuged before SDS PAGE analysis. In
Figure 5, Lane 1 to 4 are samples collected at 48 h, 72h, 96h and 120 h respectively. Lane 5
represents to pre-stained protein standard molecular marker (Bio-Rad Laboratories, USA) while
lane 6 is showing band of positive control (Alteplase – commercial recombinant tPA protein, at
66kDa). Thus in SDS PAGE analysis, expression of recombinant tPA protein was observed
successfully compared with positive control and pre stained protein molecular marker.
Figure 4Agarose gel electrophoresis of restriction digestion of tPA-pICZαA PCR
positive recombinants, Lane 1-3; tPA- pICZαA Colony PCR positive recombinants,
Lane 4; pICZαA vector w/o insert, Lane 5; 1 kb DNA molecular marker.
8. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
8
Further size exclusion chromatography was performed for the same set of samples. Sample at 120
h showed same retention time as of positive control i.e. standard commercial r-tPA (Alteplase) at
7.6 min. similar pattern was observed for both samples during chromatographic run, thus
concluding successful expression of full length recombinant tissue plasminogen protein using
Pichia pastoris X33 cells.
4. DISCUSSION
Tissue plasminogen activator is one of the important therapeutics with growing demand in
biotechnology market. Initially, tPA produced from bowes melanoma was costing $22000 for 100
mg dosage which was very costly and limited too. Thus, use of mammalian host system was
started for tPA production. Tissue plasminogen activator is the first therapeutic protein been
commercialized and produced using recombinant CHO cell lines. As per current market scenario,
Alteplase (r-tPA) produced by recombinant CHO cells cost approximately $350 per 20 mg of
dosage (Boehringer Ingelheim, Germany). Production cost of therapeutics with use of
mammalian host system is very high compared to microbial hosts, thus efforts were taken to
produce tPA using microbial host systems [19].
The enteric bacterium Escherichia coli is one of the most extensively studied and used
prokaryotic organisms for the commercial production of therapeutic proteins. Compared with
other established expression systems, E. coli offers several advantages, including growth on
inexpensive carbon sources, rapid biomass accumulation, amenability to high cell-density
fermentations, simple process scale-up and availability of large number of cloning and expression
vectors along with respective host strains. Considering these advantages, various attempts were
made to produce tPA using E. coli resulted to identify requirement of disulfide bond formation
machinery. Thus, first attempt to produce full length tPA was done by co-overexpressing
enzymes which supported disulfide bond formation into cytoplasm [13]. But co-overexpression
lead to formation of inclusion bodies, thus extracellular secretion of only biologically active part
of tPA (K2S domain) was further attempted by researchers. OmpA secretion signal was used and
Figure 5tPA expression analysis using SDS PAGE; Lane 1 to 4: are samples drawn
at 48h, 72h, 96h, and 120h respectively. Lane 5: Pre-stained standard protein
molecular marker, Lane 6: Positive control (Alteplase).
9. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
9
approximately 68% recombinant K2S secreted in supernatant found to be active [14]. Reteplase -
a deletion mutein of tPA was also produced by E. coli, but major disadvantages of this form was
its weaken affinity for fibrin compared to full length tPA, causing more fibrinogen depletion thus
resulting in higher frequency of bleeding complications [22].
However, native human gene expression in bacterial systems require extra cellular machinery for
post translational modifications (PTM). Also bacteria produce endotoxins and there is potential
for protein degradation[18]. To overcome such problems yeasts have been focused upon. These
organisms do not produce endotoxin and are capable of performing ‘Post Translational
Modifications’ (PTM) of proteins up to a certain extent like mammalian cells so as to deliver
functional recombinant proteins. They are easier and less expensive to work with than insect or
mammalian cells, and are easily adapted to fermentation processes. Yeasts such as
Saccharomyces cerevisiae, Hansenullapolymorpha, and Pichia pastoris are among the simplest
eukaryotes that have been used for the production of FDA-approved therapeutic proteins [6].
Attempts were also made using Aspergilusniger[12], Aspergilusnidulans[20]but heterogenicity
were observed in the produced recombinant tPA protein. Saccharomyces cerevisiae[8],[15] used
for r-tPA production lead to hyperglycosylation and despite presence of native yeast secretion
signal produced r-tPA was found to be intracellular leading to cell disruption for product
recovery.
In last two decade, researches have focused on Pichia pastoris to use as host for heterologous
proteins production. Pichia has been used to successfully produce proteins across a broad
spectrum of functional types, including enzymes, antigens and engineered antibody fragments, for
example: human angiogenin[11], xylanase, rHSA fusion protein [23], rIL-3[10] and many more.
Therefore in present study,Pichia pastoris was used as host for r-tPA production. Specific
primers were designed using FactorXa protease recognition site incorporated in forward primer
which would help in finishing steps of purification. FactorXa cleaves protein at specific
recognized site removing unwanted amino acid stretch delivering native tPA protein sequence.
Earlier literature has reported on expression of tPA using Pichia pastoris GS115 with three extra
amino acids at N-terminus of protein by researchers [12]. This might interfere with proteins
function or can also explicit allergic responses in body. Such problems were addressed by
designing specific primers with incorporated FactorXa protease coding site.
Full length tPA gene was amplified using specially designed primers and Purified PCR amplicon
was cloned into pICZαA expression vector. Native α-factor secretion signal sequence
incorporated into vector allows extracellular expression of protein. The expression construct
pICZαAtPA was linearized and transformed Pichiapastoris X-33 strain to achieve genome
integration and stability of tPA gene. Isolated colonies grown on zeocin containing medium were
screened for positive transformants. Pichiapastoris X-33 is a wild type strain that has both AOX1
and AOX2 promoter locus intact to achieve higher levels of expression with methanol induction.
Pichia pastoris GS115 is a mutated strain in histidinol dehydrogenase gene (his4) that prevents it
from synthesizing histidine. Positive transformants were screened for Mut+
or MutS
phenotypic
characters. Among, the 24 positive transformants screened, 10 were found to be Mut+
. One of the
colonies named PichiatPA3 showed expression at 66 kDa on SDS PAGE after 120 hrs of
induction with 0.5% v/v of 100% methanol. Previously, scientists have also cloned and expressed
full length tissue plasminogen activator in Pichia pastoris GS115 strain which is His-
mutant and
transformants obtained was Muts
[12].
10. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
10
Here in this study, we represented successful cloning and expression of Recombinant tPA protein
using Pichia pastoris X33 strain.Enzyme activity quantification of recombinant tissue
plasminogen activator protein needs to be done and further process optimization at larger scales
will surely provide a cost effective alternative to use of mammalian system for rt-PA production.
REFERENCES
[1] M. Ahmad, M. Hirz, H. Pichler, and H. Schwab, (2014) “Protein expression in Pichiapastoris: recent
achievements and perspectives for heterologous protein production,” Applied Microbiology
Biotechnology, vol. 98, no. 12, pp. 5301–17.
[2] D. B. Baruah, R. N. Dash, M. R. Chaudhari, and S. S. Kadam, (2006) “Plasminogen activators: a
comparison,” Vascuar Pharmacology, vol. 44, no. 1, pp. 1–9.
[3] J. L. Cereghino and J. M. Cregg, (2000) “Heterologous protein expression in the methylotrophic yeast
Pichia pastoris,” FEMS Microbiology reviews, vol. 24, pp. 45-66.
[4] D. Collen and H. R. Lijnen, (2009) “The tissue-type plasminogen activator story,” Arterioscler.
Thromb. Vasc. Biol., vol. 29, no. 8, pp. 1151–55.
[5] O. Cos, R. Ramón, J. L. Montesinos, and F. Valero, (2006) “Operational strategies, monitoring and
control of heterologous protein production in the methylotrophic yeast Pichia pastoris under different
promoters: a review.” Microbial Cell Factories, vol. 5, pp. 17.
[6] J. M. Cregg, I. Tolstorukov, and A. Kusari, (2009) Expression in the Yeast Pichia pastoris, 1st ed.,
vol. 463, no. 09. Elsevier Inc., pp. 169–189.
[7] R. Daly and M. T. W. Hearn, (2005) “Expression of heterologous proteins in Pichia pastoris: a useful
experimental tool in protein engineering and production,” Journal of Molecular Recognition, vol. 18,
no. 2, pp. 119–38.
[8] B. Leader, Q. J. Baca, and D. E. Golan, (2008) “Protein therapeutics: a summary and pharmacological
classification,” Nature reviews, vol. 7, pp. 21–39.
[9] J. F. Lemontt, C. M. Wei, and W. R. Dackowski, (1985) “Expression of active human uterine tissue
plasminogen activator in yeast,” DNA, vol. 4, no. 6, pp. 419–28.
[10] H. Li, N. Li, X. Gao, X. Kong, S. Li, A. Xu, S. Jin, and D. Wu, (2011) “High level expression of
active recombinant human interleukin-3 in Pichia pastoris.,” Protein Expression and Purification, vol.
80, no. 2, pp. 185–93.
[11] P. Li, A. Anumanthan, X.-G. Gao, K. Ilangovan, V. V. Suzara, N. Düzgüneş, and V.
Renugopalakrishnan, (2007) “Expression of Recombinant Proteins in Pichia Pastoris,” Applied
Biochemical and Biotechnology, vol. 142, no. 2, pp. 105–124.
[12] K. Majidzadeh-A, V. Khalaj, D. Fatemeh, H. Mahdi, B. Farzaneh, A. Ahmad, and F. Mahboudi,
(2010) “Cloning and expression of functional full-length human tissue plasminogen activator in
Pichia pastoris.,” Applied Biochemical Biotechnology, vol. 162, no. 7, pp. 2037–48.
[13] K. Majidzadeh-A, F. Mahboudi, M. Hemayatkar, F. Davami, F. Barkhordary, A. Adeli, M. Soleimani,
N. Davoudi, and V. Khalaj, (2010) “Human Tissue Plasminogen Activator Expression in Escherichia
coli using Cytoplasmic and Periplasmic Cumulative Power.,” Avicenna Journal of Medical
Biotechnology, vol. 2, no. 3, pp. 131–6.
[14] J. Manosroi, C. Tayapiwatana, F. Götz, R. G. Werner, and A. Manosroi, (2001) “Secretion of Active
Recombinant Human Tissue Plasminogen Activator Derivatives in Escherichia coli.” Applied and
environmental Microbiology, vol. 67, no. 6, pp. 2657-64.
[15] E. Martegani, N. Forlani, I. Mauri, D. Porro, W. D. Schleuning, L. Alberghina, (1992) “Expression of
high levels of human tissue plasminogen activator in yeast under the control of an inducible GAL
promoter,”Applied Microbiology and Biotechnology,vol. 37, pp. 604–608.
[16] A. Masoumiasl, F. Mahboudi, and H. Alizadeh, (2010) “Cloning and expression of tissue
plasminogen activator (t-pa) gene in tobacco plants,” Scientific research and Essays, vol. 5, no. 9, pp.
917–922.
[17] A. K. Pavlou and J. M. Reichert, (2004) “Recombinant protein therapeutics — success rates, market
trends and values to 2010,”Nature Reviews, vol. 22, no. 12, pp. 1513–1519.
11. Bioscience & Engineering: An International Journal (BIOEJ), Vol.2, No.1, January 2015
11
[18] J. Qiu, J. R. Swartz, G. Georgiou, and J. I. Qiu, (1998) “Expression of Active Human Tissue-Type
Plasminogen Activator in Escherichia coli,” vol. 64, no. 12, pp. 4891-96.
[19] S. A. Rouf and Y. Chisti, (1996) “Tissue type plasminogen activator: Characteristics, Applications
and Production technology” Biotechnology Advances, vol. 14, no. 3, pp. 239–266.
[20] A. Upshell, A. A. Kumar, M. C. Bailey, (1987) “Secretion of active human tissue plasminogen
activator from the filamentous fungus Aspergillus Nidulans”, Nature Biotechnology, vol. 5, pp. 1301-
04.
[21] K. F. Wlaschin and M. G. S. Yap, (2007) “Recombinant Protein Therapeutics from CHO Cells — 20
Years and Counting,” Society for Biological Engineering, SBE special section, pp. 40–47.
[22] Y. Zhao, G. Wang, K. Yang and Z. Changkai, (2003) “Cloning, Expression and Renaturation studies
of Reteplase”, Journal of microbiology and Biotechnology, vol. 13, no. 6, pp. 989-992.
[23] Y. Zhou, Y. Lin, X. Wu, F. Xiong, Y. Lv, T. Zheng, P. Huang, and H. Chen, (2012) “The high-level
expression of human tissue plasminogen activator in the milk of transgenic mice with hybrid gene
locus strategy.,” Molecular Biotechnology, vol. 50, no. 2, pp. 137–44.
AUTHOR BIOGRAPHY
This is Atul, currently working in Biocon Ltd as Senior Scientist. I have done my M.
Tech Form Institute of Chemical Technology, Mumbai in Bioprocess Technology. I
have interest and working experience in Molecular Biology and Fermentation
technology sectors. It’s vast field and I am really passionate about exploring the
unreached glory of biotechnology.