SlideShare a Scribd company logo

Blades for HPTC

•Download as ODP, PDF•
•
Guy Coates
Guy Coates

Are blade server suitable for HPTC? This talk covers the pros and cons of building your next cluster using blades. Talk given at International Supercomputing blade workshop in 2007.

Technology
1 of 64
Blades for HPTC ,[object Object],[object Object],[object Object]
Introduction ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Science
The Post Genomic Era ,[object Object],[object Object],TCCTCTCTTTATTTTAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTG GAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAA TTGGAAAGGTATGTTCATGTACATTGTTTAGTTGAAGAGAGAAATTCATATTATTAATTA TTTAGAGAAGAGAAAGCAAACATATTATAAGTTTAATTCTTATATTTAAAAATAGGAGCC AAGTATGGTGGCTAATGCCTGTAATCCCAACTATTTGGGAGGCCAAGATGAGAGGATTGC TTGAGACCAGGAGTTTGATACCAGCCTGGGCAACATAGCAAGATGTTATCTCTACACAAA ATAAAAAAGTTAGCTGGGAATGGTAGTGCATGCTTGTATTCCCAGCTACTCAGGAGGCTG AAGCAGGAGGGTTACTTGAGCCCAGGAGTTTGAGGTTGCAGTGAGCTATGATTGTGCCAC TGCACTCCAGCTTGGGTGACACAGCAAAACCCTCTCTCTCTAAAAAAAAAAAAAAAAAGG AACATCTCATTTTCACACTGAAATGTTGACTGAAATCATTAAACAATAAAATCATAAAAG AAAAATAATCAGTTTCCTAAGAAATGATTTTTTTTCCTGAAAAATACACATTTGGTTTCA GAGAATTTGTCTTATTAGAGACCATGAGATGGATTTTGTGAAAACTAAAGTAACACCATT ATGAAGTAAATCGTGTATATTTGCTTTCAAAACCTTTATATTTGAATACAAATGTACTCC
Deciphering the genome ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Annotation at Sanger ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
TCCTCTCTTTATTTTAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTG GAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAA TTGGAAAGGTATGTTCATGTACATTGTTTAGTTGAAGAGAGAAATTCATATTATTAATTA TTTAGAGAAGAGAAAGCAAACATATTATAAGTTTAATTCTTATATTTAAAAATAGGAGCC AAGTATGGTGGCTAATGCCTGTAATCCCAACTATTTGGGAGGCCAAGATGAGAGGATTGC TTGAGACCAGGAGTTTGATACCAGCCTGGGCAACATAGCAAGATGTTATCTCTACACAAA ATAAAAAAGTTAGCTGGGAATGGTAGTGCATGCTTGTATTCCCAGCTACTCAGGAGGCTG AAGCAGGAGGGTTACTTGAGCCCAGGAGTTTGAGGTTGCAGTGAGCTATGATTGTGCCAC TGCACTCCAGCTTGGGTGACACAGCAAAACCCTCTCTCTCTAAAAAAAAAAAAAAAAAGG AACATCTCATTTTCACACTGAAATGTTGACTGAAATCATTAAACAATAAAATCATAAAAG AAAAATAATCAGTTTCCTAAGAAATGATTTTTTTTCCTGAAAAATACACATTTGGTTTCA GAGAATTTGTCTTATTAGAGACCATGAGATGGATTTTGTGAAAACTAAAGTAACACCATT ATGAAGTAAATCGTGTATATTTGCTTTCAAAACCTTTATATTTGAATACAAATGTACTCC Ensembl Annotation
Ensembl Annotation
Ensembl Annotation
Ensembl Annotation
How is the data generated? ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Genebuild Workflow
System requirements ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
System requirements ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Cluster MK 1 ,[object Object],[object Object]
But... ,[object Object],[object Object],[object Object],[object Object]
Compute demand grows with the data ,[object Object],[object Object],[object Object]
5 clusters in 6 years ,[object Object],[object Object],[object Object],[object Object]
Why are clusters hard?
Scaling ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Clusters Get More Complex ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Manageability is the key ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Cluster Management Life Cycle ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Installation ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Commissioning ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Production ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
How do blades help?
How Do Blades Help? ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Smart Hardware ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Smart software ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
 
 
Web interface
Management Interface ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Why Extend Existing Tools? ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
The Cluster Management Life Cycle Revisited ,[object Object],[object Object]
Cluster MK5 ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Installation ,[object Object],[object Object],[object Object],[object Object]
Installation ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Consolidated networking and power ,[object Object]
Cabling
Commissioning ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Commissioning ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Production ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Blades make large clusters easier ,[object Object],[object Object]
How many admins? ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Can blades help you?
Blade Pros / Cons ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Interconnects ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Conclusions ,[object Object],[object Object],[object Object],[object Object],[object Object]
Acknowledgements ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
 
Storage Concepts
The data problem ,[object Object],[object Object],[object Object],[object Object],[object Object],Data NFS server Bottleneck
Initial Strategy ,[object Object],[object Object],Nodes Disk Data
Data Scaling ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Cluster file systems ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Initial Implementation ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Topology I ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Switch
Topology II: Hybrid ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],SAN Switch
Future implementation ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Lustre Config 10G 10G 4G 4G 2G 2G OST OST OST OST OST OST OST OST MDS ADM
The network is vital. ,[object Object],[object Object],[object Object],[object Object],[object Object]
 

Recommended

Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...
Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...
Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...Severalnines
 
The care and feeding of a MySQL database
The care and feeding of a MySQL databaseThe care and feeding of a MySQL database
The care and feeding of a MySQL databaseDave Stokes
 
intel speed-select-technology-base-frequency-enhancing-performance
intel speed-select-technology-base-frequency-enhancing-performanceintel speed-select-technology-base-frequency-enhancing-performance
intel speed-select-technology-base-frequency-enhancing-performanceDESMOND YUEN
 
Debugging and Configuration Best Practices for Oracle Linux
Debugging and Configuration Best Practices for Oracle LinuxDebugging and Configuration Best Practices for Oracle Linux
Debugging and Configuration Best Practices for Oracle LinuxTerry Wang
 
Samsung SSDs Speed Scientific Discovery
Samsung SSDs Speed Scientific DiscoverySamsung SSDs Speed Scientific Discovery
Samsung SSDs Speed Scientific DiscoverySamsung Business USA
 
How To Set up Home server posted by wired.com
How To Set up Home server posted by wired.comHow To Set up Home server posted by wired.com
How To Set up Home server posted by wired.comSHUBHAM YADAV
 
Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...
Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...
Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...Samsung Business USA
 
Early Benchmarking Results for Neuromorphic Computing
Early Benchmarking Results for Neuromorphic ComputingEarly Benchmarking Results for Neuromorphic Computing
Early Benchmarking Results for Neuromorphic ComputingDESMOND YUEN
 

Recommended

Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...
Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...
Webinar slides: The Holy Grail Webinar: Become a MySQL DBA - Database Perform...Severalnines
 
The care and feeding of a MySQL database
The care and feeding of a MySQL databaseThe care and feeding of a MySQL database
The care and feeding of a MySQL databaseDave Stokes
 
intel speed-select-technology-base-frequency-enhancing-performance
intel speed-select-technology-base-frequency-enhancing-performanceintel speed-select-technology-base-frequency-enhancing-performance
intel speed-select-technology-base-frequency-enhancing-performanceDESMOND YUEN
 
Debugging and Configuration Best Practices for Oracle Linux
Debugging and Configuration Best Practices for Oracle LinuxDebugging and Configuration Best Practices for Oracle Linux
Debugging and Configuration Best Practices for Oracle LinuxTerry Wang
 
Samsung SSDs Speed Scientific Discovery
Samsung SSDs Speed Scientific DiscoverySamsung SSDs Speed Scientific Discovery
Samsung SSDs Speed Scientific DiscoverySamsung Business USA
 
How To Set up Home server posted by wired.com
How To Set up Home server posted by wired.comHow To Set up Home server posted by wired.com
How To Set up Home server posted by wired.comSHUBHAM YADAV
 
Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...
Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...
Samsung Solid-State Drives Enable Ultra-Reliable Point of Sale Terminals for ...Samsung Business USA
 
Early Benchmarking Results for Neuromorphic Computing
Early Benchmarking Results for Neuromorphic ComputingEarly Benchmarking Results for Neuromorphic Computing
Early Benchmarking Results for Neuromorphic ComputingDESMOND YUEN
 
PostgreSQL replication
PostgreSQL replicationPostgreSQL replication
PostgreSQL replicationNTT DATA OSS Professional Services
 
High Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisHigh Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisMike Pittaro
 
Performance Whack A Mole
Performance Whack A MolePerformance Whack A Mole
Performance Whack A Moleoscon2007
 
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster Ceph Community
 
High Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisHigh Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisMike Pittaro
 
Data guard
Data guardData guard
Data guardHitesh Kumar Markam
 
Stellar Drive Tool Box 3
Stellar Drive Tool Box 3Stellar Drive Tool Box 3
Stellar Drive Tool Box 3Stellar Information Systems Ltd.
 
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...Provectus
 
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux AdminsLinuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux AdminsDave Stokes
 
Dumb Simple PostgreSQL Performance (NYCPUG)
Dumb Simple PostgreSQL Performance (NYCPUG)Dumb Simple PostgreSQL Performance (NYCPUG)
Dumb Simple PostgreSQL Performance (NYCPUG)Joshua Drake
 
Disk configtips wp-cn
Disk configtips wp-cnDisk configtips wp-cn
Disk configtips wp-cnActian Corporation
 
Troubleshooting SQL Server
Troubleshooting SQL ServerTroubleshooting SQL Server
Troubleshooting SQL ServerStephen Rose
 
Intro to Azure SQL database
Intro to Azure SQL databaseIntro to Azure SQL database
Intro to Azure SQL databaseSteve Knutson
 
Clouds, Grids and Data
Clouds, Grids and DataClouds, Grids and Data
Clouds, Grids and DataGuy Coates
 
Sharing data: Sanger Experiences
Sharing data: Sanger ExperiencesSharing data: Sanger Experiences
Sharing data: Sanger ExperiencesGuy Coates
 
Sanger HPC infrastructure Report (2007)
Sanger HPC infrastructure Report (2007)Sanger HPC infrastructure Report (2007)
Sanger HPC infrastructure Report (2007)Guy Coates
 
Life sciences big data use cases
Life sciences big data use casesLife sciences big data use cases
Life sciences big data use casesGuy Coates
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesGuy Coates
 
Storage for next-generation sequencing
Storage for next-generation sequencingStorage for next-generation sequencing
Storage for next-generation sequencingGuy Coates
 
Next-generation sequencing: Data mangement
Next-generation sequencing: Data mangementNext-generation sequencing: Data mangement
Next-generation sequencing: Data mangementGuy Coates
 
Next generation genomics: Petascale data in the life sciences
Next generation genomics: Petascale data in the life sciencesNext generation genomics: Petascale data in the life sciences
Next generation genomics: Petascale data in the life sciencesGuy Coates
 
Future Architectures for genomics
Future Architectures for genomicsFuture Architectures for genomics
Future Architectures for genomicsGuy Coates
 

More Related Content

What's hot

High Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisHigh Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisMike Pittaro
 
Performance Whack A Mole
Performance Whack A MolePerformance Whack A Mole
Performance Whack A Moleoscon2007
 
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster Ceph Community
 
High Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisHigh Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisMike Pittaro
 
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...Provectus
 
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux AdminsLinuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux AdminsDave Stokes
 
Dumb Simple PostgreSQL Performance (NYCPUG)
Dumb Simple PostgreSQL Performance (NYCPUG)Dumb Simple PostgreSQL Performance (NYCPUG)
Dumb Simple PostgreSQL Performance (NYCPUG)Joshua Drake
 
Troubleshooting SQL Server
Troubleshooting SQL ServerTroubleshooting SQL Server
Troubleshooting SQL ServerStephen Rose
 
Intro to Azure SQL database
Intro to Azure SQL databaseIntro to Azure SQL database
Intro to Azure SQL databaseSteve Knutson
 

What's hot (13)

PostgreSQL replication
PostgreSQL replicationPostgreSQL replication
PostgreSQL replication
 
High Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisHigh Performance Hardware for Data Analysis
High Performance Hardware for Data Analysis
 
Performance Whack A Mole
Performance Whack A MolePerformance Whack A Mole
Performance Whack A Mole
 
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
Ceph Day Shanghai - CeTune - Benchmarking and tuning your Ceph cluster
 
High Performance Hardware for Data Analysis
High Performance Hardware for Data AnalysisHigh Performance Hardware for Data Analysis
High Performance Hardware for Data Analysis
 
Data guard
Data guardData guard
Data guard
 
Stellar Drive Tool Box 3
Stellar Drive Tool Box 3Stellar Drive Tool Box 3
Stellar Drive Tool Box 3
 
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
[FrontDays'2017] Леонид Блохин (Big Data Engineer): Мист. Сервис для работы с...
 
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux AdminsLinuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
Linuxfest Northwest Proper Care and Feeding Of a MySQL for Busy Linux Admins
 
Dumb Simple PostgreSQL Performance (NYCPUG)
Dumb Simple PostgreSQL Performance (NYCPUG)Dumb Simple PostgreSQL Performance (NYCPUG)
Dumb Simple PostgreSQL Performance (NYCPUG)
 
Disk configtips wp-cn
Disk configtips wp-cnDisk configtips wp-cn
Disk configtips wp-cn
 
Troubleshooting SQL Server
Troubleshooting SQL ServerTroubleshooting SQL Server
Troubleshooting SQL Server
 
Intro to Azure SQL database
Intro to Azure SQL databaseIntro to Azure SQL database
Intro to Azure SQL database
 

Viewers also liked

Clouds, Grids and Data
Clouds, Grids and DataClouds, Grids and Data
Clouds, Grids and DataGuy Coates
 
Sharing data: Sanger Experiences
Sharing data: Sanger ExperiencesSharing data: Sanger Experiences
Sharing data: Sanger ExperiencesGuy Coates
 
Sanger HPC infrastructure Report (2007)
Sanger HPC infrastructure Report (2007)Sanger HPC infrastructure Report (2007)
Sanger HPC infrastructure Report (2007)Guy Coates
 
Life sciences big data use cases
Life sciences big data use casesLife sciences big data use cases
Life sciences big data use casesGuy Coates
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesGuy Coates
 
Storage for next-generation sequencing
Storage for next-generation sequencingStorage for next-generation sequencing
Storage for next-generation sequencingGuy Coates
 
Next-generation sequencing: Data mangement
Next-generation sequencing: Data mangementNext-generation sequencing: Data mangement
Next-generation sequencing: Data mangementGuy Coates
 
Next generation genomics: Petascale data in the life sciences
Next generation genomics: Petascale data in the life sciencesNext generation genomics: Petascale data in the life sciences
Next generation genomics: Petascale data in the life sciencesGuy Coates
 
Future Architectures for genomics
Future Architectures for genomicsFuture Architectures for genomics
Future Architectures for genomicsGuy Coates
 
Cloud Experiences
Cloud ExperiencesCloud Experiences
Cloud ExperiencesGuy Coates
 

Viewers also liked (10)

Clouds, Grids and Data
Clouds, Grids and DataClouds, Grids and Data
Clouds, Grids and Data
 
Sharing data: Sanger Experiences
Sharing data: Sanger ExperiencesSharing data: Sanger Experiences
Sharing data: Sanger Experiences
 
Sanger HPC infrastructure Report (2007)
Sanger HPC infrastructure Report (2007)Sanger HPC infrastructure Report (2007)
Sanger HPC infrastructure Report (2007)
 
Life sciences big data use cases
Life sciences big data use casesLife sciences big data use cases
Life sciences big data use cases
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomes
 
Storage for next-generation sequencing
Storage for next-generation sequencingStorage for next-generation sequencing
Storage for next-generation sequencing
 
Next-generation sequencing: Data mangement
Next-generation sequencing: Data mangementNext-generation sequencing: Data mangement
Next-generation sequencing: Data mangement
 
Next generation genomics: Petascale data in the life sciences
Next generation genomics: Petascale data in the life sciencesNext generation genomics: Petascale data in the life sciences
Next generation genomics: Petascale data in the life sciences
 
Future Architectures for genomics
Future Architectures for genomicsFuture Architectures for genomics
Future Architectures for genomics
 
Cloud Experiences
Cloud ExperiencesCloud Experiences
Cloud Experiences
 

Similar to Blades for HPTC

Cassandra in Operation
Cassandra in OperationCassandra in Operation
Cassandra in Operationniallmilton
 
SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...
SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...
SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...Fred de Villamil
 
Cluster Computers
Cluster ComputersCluster Computers
Cluster Computersshopnil786
 
Low latency in java 8 v5
Low latency in java 8 v5Low latency in java 8 v5
Low latency in java 8 v5Peter Lawrey
 
How Many Slaves (Ukoug)
How Many Slaves (Ukoug)How Many Slaves (Ukoug)
How Many Slaves (Ukoug)Doug Burns
 
Low level java programming
Low level java programmingLow level java programming
Low level java programmingPeter Lawrey
 
Co question bank LAKSHMAIAH
Co question bank LAKSHMAIAH Co question bank LAKSHMAIAH
Co question bank LAKSHMAIAH veena babu
 
Optimizing elastic search on google compute engine
Optimizing elastic search on google compute engineOptimizing elastic search on google compute engine
Optimizing elastic search on google compute engineBhuvaneshwaran R
 
Running ElasticSearch on Google Compute Engine in Production
Running ElasticSearch on Google Compute Engine in ProductionRunning ElasticSearch on Google Compute Engine in Production
Running ElasticSearch on Google Compute Engine in ProductionSearce Inc
 
Modern processor art
Modern processor artModern processor art
Modern processor artwaqasjadoon11
 
KEY CONCEPTS FOR SCALABLE STATEFUL SERVICES
KEY CONCEPTS FOR SCALABLE STATEFUL SERVICESKEY CONCEPTS FOR SCALABLE STATEFUL SERVICES
KEY CONCEPTS FOR SCALABLE STATEFUL SERVICESMykola Novik
 
Modern processor art
Modern processor artModern processor art
Modern processor artwaqasjadoon11
 
Deep Dive on Amazon EC2 instances
Deep Dive on Amazon EC2 instancesDeep Dive on Amazon EC2 instances
Deep Dive on Amazon EC2 instancesAmazon Web Services
 
Networking and Computer Troubleshooting
Networking and Computer TroubleshootingNetworking and Computer Troubleshooting
Networking and Computer TroubleshootingRence Montanes
 

Similar to Blades for HPTC (20)

Processors
ProcessorsProcessors
Processors
 
Cassandra in Operation
Cassandra in OperationCassandra in Operation
Cassandra in Operation
 
SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...
SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...
SUE 2018 - Migrating a 130TB Cluster from Elasticsearch 2 to 5 in 20 Hours Wi...
 
Cluster Computing
Cluster ComputingCluster Computing
Cluster Computing
 
Cluster Computers
Cluster ComputersCluster Computers
Cluster Computers
 
Embedded Systems
Embedded SystemsEmbedded Systems
Embedded Systems
 
Low latency in java 8 v5
Low latency in java 8 v5Low latency in java 8 v5
Low latency in java 8 v5
 
How Many Slaves (Ukoug)
How Many Slaves (Ukoug)How Many Slaves (Ukoug)
How Many Slaves (Ukoug)
 
Low level java programming
Low level java programmingLow level java programming
Low level java programming
 
Co question bank LAKSHMAIAH
Co question bank LAKSHMAIAH Co question bank LAKSHMAIAH
Co question bank LAKSHMAIAH
 
Optimizing elastic search on google compute engine
Optimizing elastic search on google compute engineOptimizing elastic search on google compute engine
Optimizing elastic search on google compute engine
 
Running ElasticSearch on Google Compute Engine in Production
Running ElasticSearch on Google Compute Engine in ProductionRunning ElasticSearch on Google Compute Engine in Production
Running ElasticSearch on Google Compute Engine in Production
 
Modern processor art
Modern processor artModern processor art
Modern processor art
 
processor struct
processor structprocessor struct
processor struct
 
KEY CONCEPTS FOR SCALABLE STATEFUL SERVICES
KEY CONCEPTS FOR SCALABLE STATEFUL SERVICESKEY CONCEPTS FOR SCALABLE STATEFUL SERVICES
KEY CONCEPTS FOR SCALABLE STATEFUL SERVICES
 
Modern processor art
Modern processor artModern processor art
Modern processor art
 
Danish presentation
Danish presentationDanish presentation
Danish presentation
 
Mysql talk
Mysql talkMysql talk
Mysql talk
 
Deep Dive on Amazon EC2 instances
Deep Dive on Amazon EC2 instancesDeep Dive on Amazon EC2 instances
Deep Dive on Amazon EC2 instances
 
Networking and Computer Troubleshooting
Networking and Computer TroubleshootingNetworking and Computer Troubleshooting
Networking and Computer Troubleshooting
 

Recently uploaded

Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxOnBoard
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking MenDelhi Call girls
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure servicePooja Nehwal
 
Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)Allon Mureinik
 
Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024BookNet Canada
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Servicegiselly40
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
Google AI Hackathon: LLM based Evaluator for RAG
Google AI Hackathon: LLM based Evaluator for RAGGoogle AI Hackathon: LLM based Evaluator for RAG
Google AI Hackathon: LLM based Evaluator for RAGSujit Pal
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsMaria Levchenko
 
Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101Paola De la Torre
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j
 
My Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 PresentationMy Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 PresentationRidwan Fadjar
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024BookNet Canada
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 

Recently uploaded (20)

Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptx
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
 
Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)Injustice - Developers Among Us (SciFiDevCon 2024)
Injustice - Developers Among Us (SciFiDevCon 2024)
 
Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
Transcript: #StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Service
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Google AI Hackathon: LLM based Evaluator for RAG
Google AI Hackathon: LLM based Evaluator for RAGGoogle AI Hackathon: LLM based Evaluator for RAG
Google AI Hackathon: LLM based Evaluator for RAG
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed texts
 
Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
 
My Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 PresentationMy Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 Presentation
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 

Blades for HPTC