SlideShare a Scribd company logo
1 of 56
Cloud Experiences ,[object Object]
Wellcome Trust Sanger Institute
[email_address]
The Sanger Institute ,[object Object]
~700 employees.
Based in Hinxton Genome Campus, Cambridge, UK. ,[object Object],[object Object]
We have active cancer, malaria, pathogen and genomic variation / human health studies. ,[object Object],[object Object]
DNA Sequencing  TCTTTATTTTAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTG AAGGTATGTTCATGTACATTGTTTAGTTGAAGAGAGAAATTCATATTATTAATTA TGGTGGCTAATGCCTGTAATCCCAACTATTTGGGAGGCCAAGATGAGAGGATTGC ATAAAAAAGTTAGCTGGGAATGGTAGTGCATGCTTGTATTCCCAGCTACTCAGGAGGCTG TGCACTCCAGCTTGGGTGACACAG  CAACCCTCTCTCTCTAAAAAAAAAAAAAAAAAGG AAATAATCAGTTTCCTAAGATTTTTTTCCTGAAAAATACACATTTGGTTTCA ATGAAGTAAATCG  ATTTGCTTTCAAAACCTTTATATTTGAATACAAATGTACTCC 250 Million * 75-108 Base fragments Human Genome (3GBases)
Moore's Law Compute/disk doubles every 18 months Sequencing doubles every 12 months
Economic Trends: ,[object Object]
23 labs.
$500 Million. ,[object Object],[object Object]
1 machine.
$8,000. ,[object Object],[object Object]
The scary graph Peak Yearly capillary sequencing: 30 Gbase Current weekly sequencing: 6000 Gbase
Our Science
UK 10K Project ,[object Object]
Will improve the understanding of human genetic variation and disease. Genome Research Limited Wellcome Trust launches study of 10,000 human genomes in UK; 24 June 2010 www.sanger.ac.uk/about/press/2010/100624-uk10k.html
New scale, new insights . . . to common disease ,[object Object]
Hypertension
Bipolar disorder
Arthritis
Obesity
Diabetes (types I and II)
Breast cancer
Malaria
Tuberculosis
Cancer Genome Project ,[object Object]
Detailed Changes: ,[object Object]
First Comprehensive look at cancer genomes ,[object Object]
Malignant melanoma
Breast cancer ,[object Object],[object Object]
Development of novel therapies
Targeting of existing therapeutics Lung Cancer and melanoma laid bare; 16 December 2009  www.sanger.ac.uk/about/press/2009/091216.html
IT Challenges
Managing Growth ,[object Object]
1000$ genome*
*Informatics not included
Sequencing data flow. Alignments (200GB) Variation data (1GB) Feature (3MB) Raw data (10 TB) Sequence (500GB) Sequencer Processing/ QC Comparative analysis datastore Structured data (databases) Unstructured data (Flat files) Internet
Data centre ,[object Object]
1.8 MW power draw
1.5 PUE  ,[object Object],[object Object]
Focus on power & space efficient storage and compute.  ,[object Object],[object Object],rack rack rack rack
Our HPC Infrastructure ,[object Object]
10GigE / 1GigE networking. ,[object Object],[object Object]
Lustre filesystem ,[object Object]
Ensembl ,[object Object]
Provides web / programmatic interfaces to genomic data.
10k visitors / 126k page views per day. ,[object Object],[object Object]
Ensembl at Sanger/EBI provides automated analysis for 51 vertebrate genomes. ,[object Object]
Data is free for download.
Sequencing data flow. Alignments (200GB) Variation data (1GB) Feature (3MB) Raw data (10 TB) Sequence (500GB) Sequencer Processing/ QC Comparative analysis datastore Structured data (databases) Unstructured data (Flat files) Internet HPC Compute Pipeline Web / Database  infrastructure
TCCTCTCTTTATTTTAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTG GAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAA TTGGAAAGGTATGTTCATGTACATTGTTTAGTTGAAGAGAGAAATTCATATTATTAATTA TTTAGAGAAGAGAAAGCAAACATATTATAAGTTTAATTCTTATATTTAAAAATAGGAGCC AAGTATGGTGGCTAATGCCTGTAATCCCAACTATTTGGGAGGCCAAGATGAGAGGATTGC TTGAGACCAGGAGTTTGATACCAGCCTGGGCAACATAGCAAGATGTTATCTCTACACAAA ATAAAAAAGTTAGCTGGGAATGGTAGTGCATGCTTGTATTCCCAGCTACTCAGGAGGCTG AAGCAGGAGGGTTACTTGAGCCCAGGAGTTTGAGGTTGCAGTGAGCTATGATTGTGCCAC TGCACTCCAGCTTGGGTGACACAGCAAAACCCTCTCTCTCTAAAAAAAAAAAAAAAAAGG AACATCTCATTTTCACACTGAAATGTTGACTGAAATCATTAAACAATAAAATCATAAAAG AAAAATAATCAGTTTCCTAAGAAATGATTTTTTTTCCTGAAAAATACACATTTGGTTTCA GAGAATTTGTCTTATTAGAGACCATGAGATGGATTTTGTGAAAACTAAAGTAACACCATT ATGAAGTAAATCGTGTATATTTGCTTTCAAAACCTTTATATTTGAATACAAATGTACTCC
Annotation
Annotation
Why Cloud?

More Related Content

What's hot

Clouds, Grids and Data
Clouds, Grids and DataClouds, Grids and Data
Clouds, Grids and DataGuy Coates
 
Challenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data GenomicsChallenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data GenomicsYasin Memari
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesGuy Coates
 
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...Amazon Web Services
 
Spark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van HamSpark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van HamSpark Summit
 
PUC Masterclass Big Data
PUC Masterclass Big DataPUC Masterclass Big Data
PUC Masterclass Big DataArjen de Vries
 
My other computer_is_a_datacentre
My other computer_is_a_datacentreMy other computer_is_a_datacentre
My other computer_is_a_datacentreSteve Loughran
 
Empowering Transformational Science
Empowering Transformational ScienceEmpowering Transformational Science
Empowering Transformational ScienceChelle Gentemann
 
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...Bonnie Hurwitz
 
The Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific DiscoveryThe Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific DiscoveryIntel IT Center
 
Roots tech 2013 Big Data at Ancestry (3-22-2013) - no animations
Roots tech 2013 Big Data at Ancestry (3-22-2013) - no animationsRoots tech 2013 Big Data at Ancestry (3-22-2013) - no animations
Roots tech 2013 Big Data at Ancestry (3-22-2013) - no animationsWilliam Yetman
 
VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...Denis C. Bauer
 
Hadoop for Bioinformatics: Building a Scalable Variant Store
Hadoop for Bioinformatics: Building a Scalable Variant StoreHadoop for Bioinformatics: Building a Scalable Variant Store
Hadoop for Bioinformatics: Building a Scalable Variant StoreUri Laserson
 
Whitepaper : CHI: Hadoop's Rise in Life Sciences
Whitepaper : CHI: Hadoop's Rise in Life Sciences Whitepaper : CHI: Hadoop's Rise in Life Sciences
Whitepaper : CHI: Hadoop's Rise in Life Sciences EMC
 
Utility HPC: Right Systems, Right Scale, Right Science
Utility HPC: Right Systems, Right Scale, Right ScienceUtility HPC: Right Systems, Right Scale, Right Science
Utility HPC: Right Systems, Right Scale, Right ScienceChef Software, Inc.
 
A Survey on Approaches for Frequent Item Set Mining on Apache Hadoop
A Survey on Approaches for Frequent Item Set Mining on Apache HadoopA Survey on Approaches for Frequent Item Set Mining on Apache Hadoop
A Survey on Approaches for Frequent Item Set Mining on Apache HadoopIJTET Journal
 
White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...
White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...
White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...EMC
 
Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...
Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...
Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...Databricks
 
How novel compute technology transforms life science research
How novel compute technology transforms life science researchHow novel compute technology transforms life science research
How novel compute technology transforms life science researchDenis C. Bauer
 

What's hot (20)

Clouds, Grids and Data
Clouds, Grids and DataClouds, Grids and Data
Clouds, Grids and Data
 
Challenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data GenomicsChallenges and Opportunities of Big Data Genomics
Challenges and Opportunities of Big Data Genomics
 
Cluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomesCluster Filesystems and the next 1000 human genomes
Cluster Filesystems and the next 1000 human genomes
 
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
A Step to the Clouded Solution of Scalable Clinical Genome Sequencing (BDT308...
 
Spark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van HamSpark Summit EU talk by Erwin Datema and Roeland van Ham
Spark Summit EU talk by Erwin Datema and Roeland van Ham
 
PUC Masterclass Big Data
PUC Masterclass Big DataPUC Masterclass Big Data
PUC Masterclass Big Data
 
My other computer_is_a_datacentre
My other computer_is_a_datacentreMy other computer_is_a_datacentre
My other computer_is_a_datacentre
 
Empowering Transformational Science
Empowering Transformational ScienceEmpowering Transformational Science
Empowering Transformational Science
 
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
iMicrobe and iVirus: Extending the iPlant cyberinfrastructure from plants to ...
 
The Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific DiscoveryThe Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
The Gordon Data-intensive Supercomputer. Enabling Scientific Discovery
 
Roots tech 2013 Big Data at Ancestry (3-22-2013) - no animations
Roots tech 2013 Big Data at Ancestry (3-22-2013) - no animationsRoots tech 2013 Big Data at Ancestry (3-22-2013) - no animations
Roots tech 2013 Big Data at Ancestry (3-22-2013) - no animations
 
VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...VariantSpark: applying Spark-based machine learning methods to genomic inform...
VariantSpark: applying Spark-based machine learning methods to genomic inform...
 
Hadoop for Bioinformatics: Building a Scalable Variant Store
Hadoop for Bioinformatics: Building a Scalable Variant StoreHadoop for Bioinformatics: Building a Scalable Variant Store
Hadoop for Bioinformatics: Building a Scalable Variant Store
 
Whitepaper : CHI: Hadoop's Rise in Life Sciences
Whitepaper : CHI: Hadoop's Rise in Life Sciences Whitepaper : CHI: Hadoop's Rise in Life Sciences
Whitepaper : CHI: Hadoop's Rise in Life Sciences
 
Utility HPC: Right Systems, Right Scale, Right Science
Utility HPC: Right Systems, Right Scale, Right ScienceUtility HPC: Right Systems, Right Scale, Right Science
Utility HPC: Right Systems, Right Scale, Right Science
 
A Survey on Approaches for Frequent Item Set Mining on Apache Hadoop
A Survey on Approaches for Frequent Item Set Mining on Apache HadoopA Survey on Approaches for Frequent Item Set Mining on Apache Hadoop
A Survey on Approaches for Frequent Item Set Mining on Apache Hadoop
 
White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...
White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...
White Paper: Life Sciences at RENCI, Big Data IT to Manage, Decipher and Info...
 
Redis
RedisRedis
Redis
 
Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...
Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...
Apache Spark NLP for Healthcare: Lessons Learned Building Real-World Healthca...
 
How novel compute technology transforms life science research
How novel compute technology transforms life science researchHow novel compute technology transforms life science research
How novel compute technology transforms life science research
 

Similar to Cloud Experiences

Clouds: All fluff and no substance?
Clouds: All fluff and no substance?Clouds: All fluff and no substance?
Clouds: All fluff and no substance?Guy Coates
 
Coates bosc2010 clouds-fluff-and-no-substance
Coates bosc2010 clouds-fluff-and-no-substanceCoates bosc2010 clouds-fluff-and-no-substance
Coates bosc2010 clouds-fluff-and-no-substanceBOSC 2010
 
Accelerating Analytics for the Future of Genomics
Accelerating Analytics for the Future of GenomicsAccelerating Analytics for the Future of Genomics
Accelerating Analytics for the Future of GenomicsAmazon Web Services
 
Farms, Fabrics and Clouds
Farms, Fabrics and CloudsFarms, Fabrics and Clouds
Farms, Fabrics and CloudsSteve Loughran
 
Blades for HPTC
Blades for HPTCBlades for HPTC
Blades for HPTCGuy Coates
 
So Long Computer Overlords
So Long Computer OverlordsSo Long Computer Overlords
So Long Computer OverlordsIan Foster
 
Rpi talk foster september 2011
Rpi talk foster september 2011Rpi talk foster september 2011
Rpi talk foster september 2011Ian Foster
 
E Science As A Lens On The World Lazowska
E Science As A Lens On The World   LazowskaE Science As A Lens On The World   Lazowska
E Science As A Lens On The World Lazowskaguest43b4df3
 
E Science As A Lens On The World Lazowska
E Science As A Lens On The World   LazowskaE Science As A Lens On The World   Lazowska
E Science As A Lens On The World LazowskaWCET
 
2015 04 bio it world
2015 04 bio it world2015 04 bio it world
2015 04 bio it worldChris Dwan
 
Business Continuity Presentation
Business Continuity PresentationBusiness Continuity Presentation
Business Continuity Presentationperry57123
 
Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...
Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...
Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...Amazon Web Services
 
Web Speed And Scalability
Web Speed And ScalabilityWeb Speed And Scalability
Web Speed And ScalabilityJason Ragsdale
 
Computing Outside The Box September 2009
Computing Outside The Box September 2009Computing Outside The Box September 2009
Computing Outside The Box September 2009Ian Foster
 
Petascale Analytics - The World of Big Data Requires Big Analytics
Petascale Analytics - The World of Big Data Requires Big AnalyticsPetascale Analytics - The World of Big Data Requires Big Analytics
Petascale Analytics - The World of Big Data Requires Big AnalyticsHeiko Joerg Schick
 
Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010
Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010 Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010
Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010 ryancox
 
seed block algorithm
seed block algorithmseed block algorithm
seed block algorithmDipak Badhe
 

Similar to Cloud Experiences (20)

Clouds: All fluff and no substance?
Clouds: All fluff and no substance?Clouds: All fluff and no substance?
Clouds: All fluff and no substance?
 
Coates bosc2010 clouds-fluff-and-no-substance
Coates bosc2010 clouds-fluff-and-no-substanceCoates bosc2010 clouds-fluff-and-no-substance
Coates bosc2010 clouds-fluff-and-no-substance
 
Accelerating Analytics for the Future of Genomics
Accelerating Analytics for the Future of GenomicsAccelerating Analytics for the Future of Genomics
Accelerating Analytics for the Future of Genomics
 
Farms, Fabrics and Clouds
Farms, Fabrics and CloudsFarms, Fabrics and Clouds
Farms, Fabrics and Clouds
 
Blades for HPTC
Blades for HPTCBlades for HPTC
Blades for HPTC
 
So Long Computer Overlords
So Long Computer OverlordsSo Long Computer Overlords
So Long Computer Overlords
 
Rpi talk foster september 2011
Rpi talk foster september 2011Rpi talk foster september 2011
Rpi talk foster september 2011
 
Deploying On EC2
Deploying On EC2Deploying On EC2
Deploying On EC2
 
E Science As A Lens On The World Lazowska
E Science As A Lens On The World   LazowskaE Science As A Lens On The World   Lazowska
E Science As A Lens On The World Lazowska
 
E Science As A Lens On The World Lazowska
E Science As A Lens On The World   LazowskaE Science As A Lens On The World   Lazowska
E Science As A Lens On The World Lazowska
 
2015 04 bio it world
2015 04 bio it world2015 04 bio it world
2015 04 bio it world
 
Big Data and OSS at IBM
Big Data and OSS at IBMBig Data and OSS at IBM
Big Data and OSS at IBM
 
Business Continuity Presentation
Business Continuity PresentationBusiness Continuity Presentation
Business Continuity Presentation
 
Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...
Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...
Lessons from WuXi NextCODE Scales Up To Accelerate Data Sequencing in Their D...
 
6monitor_NYMIIS
6monitor_NYMIIS6monitor_NYMIIS
6monitor_NYMIIS
 
Web Speed And Scalability
Web Speed And ScalabilityWeb Speed And Scalability
Web Speed And Scalability
 
Computing Outside The Box September 2009
Computing Outside The Box September 2009Computing Outside The Box September 2009
Computing Outside The Box September 2009
 
Petascale Analytics - The World of Big Data Requires Big Analytics
Petascale Analytics - The World of Big Data Requires Big AnalyticsPetascale Analytics - The World of Big Data Requires Big Analytics
Petascale Analytics - The World of Big Data Requires Big Analytics
 
Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010
Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010 Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010
Brian O'Connor HBase Talk - Triangle Hadoop Users Group Dec 2010
 
seed block algorithm
seed block algorithmseed block algorithm
seed block algorithm
 

Recently uploaded

Pigging Solutions in Pet Food Manufacturing
Pigging Solutions in Pet Food ManufacturingPigging Solutions in Pet Food Manufacturing
Pigging Solutions in Pet Food ManufacturingPigging Solutions
 
Pigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping ElbowsPigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping ElbowsPigging Solutions
 
How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?XfilesPro
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountPuma Security, LLC
 
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024BookNet Canada
 
Snow Chain-Integrated Tire for a Safe Drive on Winter Roads
Snow Chain-Integrated Tire for a Safe Drive on Winter RoadsSnow Chain-Integrated Tire for a Safe Drive on Winter Roads
Snow Chain-Integrated Tire for a Safe Drive on Winter RoadsHyundai Motor Group
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking MenDelhi Call girls
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxOnBoard
 
Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsMark Billinghurst
 
Unblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesUnblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesSinan KOZAK
 
Key Features Of Token Development (1).pptx
Key  Features Of Token  Development (1).pptxKey  Features Of Token  Development (1).pptx
Key Features Of Token Development (1).pptxLBM Solutions
 
Advanced Test Driven-Development @ php[tek] 2024
Advanced Test Driven-Development @ php[tek] 2024Advanced Test Driven-Development @ php[tek] 2024
Advanced Test Driven-Development @ php[tek] 2024Scott Keck-Warren
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Patryk Bandurski
 
AI as an Interface for Commercial Buildings
AI as an Interface for Commercial BuildingsAI as an Interface for Commercial Buildings
AI as an Interface for Commercial BuildingsMemoori
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 

Recently uploaded (20)

Pigging Solutions in Pet Food Manufacturing
Pigging Solutions in Pet Food ManufacturingPigging Solutions in Pet Food Manufacturing
Pigging Solutions in Pet Food Manufacturing
 
Pigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping ElbowsPigging Solutions Piggable Sweeping Elbows
Pigging Solutions Piggable Sweeping Elbows
 
How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path Mount
 
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
#StandardsGoals for 2024: What’s new for BISAC - Tech Forum 2024
 
Snow Chain-Integrated Tire for a Safe Drive on Winter Roads
Snow Chain-Integrated Tire for a Safe Drive on Winter RoadsSnow Chain-Integrated Tire for a Safe Drive on Winter Roads
Snow Chain-Integrated Tire for a Safe Drive on Winter Roads
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptx
 
Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR Systems
 
Unblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesUnblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen Frames
 
Key Features Of Token Development (1).pptx
Key  Features Of Token  Development (1).pptxKey  Features Of Token  Development (1).pptx
Key Features Of Token Development (1).pptx
 
Advanced Test Driven-Development @ php[tek] 2024
Advanced Test Driven-Development @ php[tek] 2024Advanced Test Driven-Development @ php[tek] 2024
Advanced Test Driven-Development @ php[tek] 2024
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
 
AI as an Interface for Commercial Buildings
AI as an Interface for Commercial BuildingsAI as an Interface for Commercial Buildings
AI as an Interface for Commercial Buildings
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 

Cloud Experiences