BecA-ILRI
                                     Bioinformatics Platform
   What is Bioinformatics?

   Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and
   expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities
   and has great potential to underpin biotechnological solutions to agricultural development constraints.

   In short, bioinformatics is the key to understanding the molecule of life, DNA

   DNA - Information flow in the molecule of life

                                                         AT GATTAT G G A CA CTTCTTT G
                                                         AAAAATAAT GAT G G A G CTTTA
                                                         G AA G CT GATAACAAAAATTAT
                                                         CAA GATTATAAA G CT G A G C CT
                                                  Gene   G ATAAAACAA G C G AT GTATTA
                                                         G AT GTTACTAAATATAATTCA
                                                         GT G GTA G ATT GTT G C CATAAA
                                                         AATTATTCAACATTTACATCT
                                                         G AAT G GTATATTAAT GAAA G A
                                                         AAATATAAT GAT GTTC CA G AA
                                                         G G A C CAAAAAAT GATTAT G G
                                                         ACA CTTCTTT GAAAAATAAT G
                                                         AT G G A G CTTTA GAA G CT GAT
                                                         AACAAAAATTATCAA G ATT
           Cell        Chromosome       DNA              DNA sequence                           Protein           Livestock, crops, microorganisms

              Impact of Bioinformatics                                                           BecA-ILRI Bioinformatics Platform
                                                                                                   for eastern and central Africa
Bioinformatics is the application of information technology and
computer science to the field of molecular biology. Its primary
                                                                                         The BecA-ILRI Bioinformatics Platform provides
application has been in genomics involving large-scale DNA
sequencing. Some areas that have been significantly
                                                                                         advanced computational capabilities in bioinformatics to
influenced include:                                                                      all BecA-ILRI scientists and provide training in all aspects
                                                                                         of bioinformatics.
    Crop improvement
    •Nutritional enhancement                                                             The platform provides:
    •Insect pest resistance                                                               access to major sequence databases (USA, EU, etc…)
    •Molecular breeding                                                                   access to specialized hardware and sophisticated
    •Drought tolerance                                                                   commercial and academic software
                                                                                          sophisticated data analysis capabilities
                    Vaccine and diagnostics                                               access to High performance computing services and
                     Livestock diseases                                                  grids (CGIAR, EU, USA, etc …)
                     Human diseases

    Microbial biotechnology                                                                                              Research Institutes
    Design microorganisms for:                                                                                              Universities
     Cleaning up waste
     Alternative energy

                                                                                         European Molecular Biology Network                Web interface
                                                                                         EMBRACE Network of Excellence
Current Projects using Bioinformatics platform                                           e-Infrastructure (EELA, GEANT, EGEE)
                                                                                                                                           Direct access

                                                                                         Advanced Research Institutes (EU, USA)                 Broadband
                                                                                                                                                  Internet
Crop improvement                                                                                           Broadband
 Biotechnology applications to combat Cassava Brown Streak                                                   Internet
Disease
 Development of genetic fingerprints for groundnut and pigeon
pea
 Fine mapping of Striga resistance in sorghum
 Marker assisted breeding for drought resistance in sorghum

Vaccines and diagnostics                                                                                                 Direct access
 Integrated response system for emerging infectious diseases in                                                          Web services
East Africa
 East Coast fever recombinant vaccine development                                                                          Broadband
 Contagious bovine pleuropneumonia (CBPP) diagnostic and                                                                     Internet
vaccine development                                                                       CGIAR – HPC Grid
 Development of new diagnostic assays and epidemiological                                 ILRI – Kenya (64 CPUs)                              BecA-ILRI
surveillance of viral pathogens of livestock in Africa                                    IRRI – Philippines (16 CPUs)                      Bioinformatics
 Bioinformatics capacity building                                                         ICRISAT – India (8CPUs)                              platform
                                                                                          CIP – Peru (8 CPUs)




                                                                                                                                           ILRI
                                                                                                                               INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE

BeCA-ILRI Bioinformatics Platform

  • 1.
    BecA-ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. In short, bioinformatics is the key to understanding the molecule of life, DNA DNA - Information flow in the molecule of life AT GATTAT G G A CA CTTCTTT G AAAAATAAT GAT G G A G CTTTA G AA G CT GATAACAAAAATTAT CAA GATTATAAA G CT G A G C CT Gene G ATAAAACAA G C G AT GTATTA G AT GTTACTAAATATAATTCA GT G GTA G ATT GTT G C CATAAA AATTATTCAACATTTACATCT G AAT G GTATATTAAT GAAA G A AAATATAAT GAT GTTC CA G AA G G A C CAAAAAAT GATTAT G G ACA CTTCTTT GAAAAATAAT G AT G G A G CTTTA GAA G CT GAT AACAAAAATTATCAA G ATT Cell Chromosome DNA DNA sequence Protein Livestock, crops, microorganisms Impact of Bioinformatics BecA-ILRI Bioinformatics Platform for eastern and central Africa Bioinformatics is the application of information technology and computer science to the field of molecular biology. Its primary The BecA-ILRI Bioinformatics Platform provides application has been in genomics involving large-scale DNA sequencing. Some areas that have been significantly advanced computational capabilities in bioinformatics to influenced include: all BecA-ILRI scientists and provide training in all aspects of bioinformatics. Crop improvement •Nutritional enhancement The platform provides: •Insect pest resistance access to major sequence databases (USA, EU, etc…) •Molecular breeding access to specialized hardware and sophisticated •Drought tolerance commercial and academic software sophisticated data analysis capabilities Vaccine and diagnostics access to High performance computing services and Livestock diseases grids (CGIAR, EU, USA, etc …) Human diseases Microbial biotechnology Research Institutes Design microorganisms for: Universities Cleaning up waste Alternative energy European Molecular Biology Network Web interface EMBRACE Network of Excellence Current Projects using Bioinformatics platform e-Infrastructure (EELA, GEANT, EGEE) Direct access Advanced Research Institutes (EU, USA) Broadband Internet Crop improvement Broadband Biotechnology applications to combat Cassava Brown Streak Internet Disease Development of genetic fingerprints for groundnut and pigeon pea Fine mapping of Striga resistance in sorghum Marker assisted breeding for drought resistance in sorghum Vaccines and diagnostics Direct access Integrated response system for emerging infectious diseases in Web services East Africa East Coast fever recombinant vaccine development Broadband Contagious bovine pleuropneumonia (CBPP) diagnostic and Internet vaccine development CGIAR – HPC Grid Development of new diagnostic assays and epidemiological ILRI – Kenya (64 CPUs) BecA-ILRI surveillance of viral pathogens of livestock in Africa IRRI – Philippines (16 CPUs) Bioinformatics Bioinformatics capacity building ICRISAT – India (8CPUs) platform CIP – Peru (8 CPUs) ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE