بحث د.نيرة 1

1. Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=itxm20
Download by: [King Saud University] Date: 18 April 2016, At: 01:20
Toxicology Mechanisms and Methods
ISSN: 1537-6516 (Print) 1537-6524 (Online) Journal homepage: http://www.tandfonline.com/loi/itxm20
Effect of aliskiren and carvedilol on expression of
Ca
2+
/calmodulin-dependent protein kinase II δ-
subunit isoforms in cardiac hypertrophy rat model
Anfal Fahad Bin-Dayel, Nayira A. Abdel Baky, L. M. Fadda, Raeesa A.
Mohammad & Futwan Al-Mohanna
To cite this article: Anfal Fahad Bin-Dayel, Nayira A. Abdel Baky, L. M. Fadda, Raeesa
A. Mohammad & Futwan Al-Mohanna (2016) Effect of aliskiren and carvedilol on
expression of Ca
2+
/calmodulin-dependent protein kinase II δ-subunit isoforms in cardiac
hypertrophy rat model, Toxicology Mechanisms and Methods, 26:2, 122-131, DOI:
10.3109/15376516.2015.1128035
To link to this article: http://dx.doi.org/10.3109/15376516.2015.1128035
Published online: 16 Mar 2016.
Submit your article to this journal
Article views: 29
View related articles
View Crossmark data

2. http://informahealthcare.com/txm
ISSN: 1537-6516 (print), 1537-6524 (electronic)
Toxicol Mech Methods, 2016; 26(2): 122–131
! 2016 Taylor & Francis. DOI: 10.3109/15376516.2015.1128035
RESEARCH ARTICLE
Effect of aliskiren and carvedilol on expression of
Ca2+
/calmodulin-dependent protein kinase II d-subunit
isoforms in cardiac hypertrophy rat model
Anfal Fahad Bin-Dayel1
, Nayira A. Abdel Baky1,2
, L. M. Fadda1
, Raeesa A. Mohammad3
, and Futwan Al-Mohanna4
1
Department of Pharmacology, Faculty of Pharmacy, King Saud University, Riyadh, Saudi Arabia, 2
Pharmacology and Toxicology Department,
Faculty of Pharmacy, Al-Azhar University, Cairo, Egypt, 3
Anatomy Department, Faculty of Medicine, King Saud University, Riyadh, Saudi Arabia, and
4
Department of Cell Biology, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia
Abstract
Context: The critical role of CaMKIId isoforms in cardiac hypertrophy is well documented.
Objective: This study was aimed to investigate the possible inhibitory effects of aliskiren (ALS)
and/or carvedilol (CAV) on CaMKIId isoforms expression in experimental cardiac hypertrophy.
Materials and methods: Male Wistar albino rats were subcutaneously injected with isoproterenol
(ISO) (5 mg/kg/day) for 4 weeks to induce cardiac hypertrophy. Hypertrophied rats were daily
treated with either ALS (10 mg/kg) and/or CAV (10 mg/kg). At the end of the treatment, rats
were killed; blood and hearts were collected for assessing different biochemical parameters.
Results: ISO treatment significantly increased heart weight to body weight (HW/BW) ratio, serum
creatine kinase MB (CK-MB) and troponin T (Tn-T) levels, and plasma renin activity (PRA) as
compared to control rats. Additionally, ISO treatment produced a significant increase in the
expression of myocardial CaMKIId2 and CaMKIId3 that were associated with significant elevation
in myocardial caspase-3 protein expression. Histopathological examination of rats exposed to
ISO treatment showed severe myocardial cell degeneration. ALS and/or CAV treatment
significantly reduced the altered HW/BW ratio, serum CK-MB and Tn-T levels, PRA, and caspase-
3 protein expression in hypertrophied rats, with maximal improvement in the combination
group. These biochemical findings were supported by the histopathological examination of the
heart tissue. Additionally, treatment with ALS and CAV significantly inhibited ISO-induced
increase in CaMKIId2 and CaMKIId3 expression levels.
Discussion and conclusion: The present study indicated that ALS and CAV treatment ameliorated
ISO-induced hypertrophy via inhibiting the expression and the activity of CaMKIId isoforms and
the associated myocardial apoptosis.
Keywords
Aliskiren, CaMKIId-isoforms, cardiac
hypertrophy, carvedilol, caspase-3
History
Received 8 September 2015
Revised 2 November 2015
Accepted 1 December 2015
Published online 11 March 2016
Introduction
Cardiac hypertrophy is an independent risk factor for
cardiovascular morbidity and mortality worldwide despite
the availability of significant therapeutic options. The under-
lying pathology of cardiac hypertrophy involves various
molecular and signaling pathways including; neurohormonal
overactivation, increased oxidative stress, genetic alteration,
and inflammatory signaling in the heart (Carreno et al.,
2006). Ca2+
- and CaMKII-dependent protein kinase is one of
the important signaling pathways that are implicated in the
induction of cardiac hypertrophy. Several experimental and
clinical studies have documented that, CaMKIId, the major
CaMKII isoform in the heart, is a critical component in the
development of cardiac hypertrophy (Hagemann et al., 2001;
Maier & Bers, 2002).
Renin–angiotensin aldosterone system (RAAS) and its key
effector, Ang II, play a major role in cardiac remodeling and
in induction of cardiac hypertrophy and fibrosis (Schultz
et al., 2002). Importantly, different cardiac hypertrophy
modules that were associated with RASS exacerbation has
been linked to increased cardiac CaMKII expression (Velez
Rueda et al., 2012; Yoneda et al., 2005). This is might be
related to the effect of Ang II on increasing intracellular
Ca2+
through Gq protein-mediated IP3 and DAG pathway
(Wenzel et al., 2001). Ang II can also enhance intracellular
Ca2+
transients in cardiomyocytes and increase L-type
Ca2+
current that result in CaMKII activation.
Cardiac hypertrophy is also characterized by overactiva-
tion of the sympathetic nervous system, and subsequent
stimulation of cardiac beta-adrenergic receptors (b-ARs). It
has been documented that some of the detrimental effects of
Address for correspondence: Nayira A. Abdel Baky, Department of
Pharmacology, Faculty of Pharmacy, King Saud University, P.O. Box
22452, Riyadh 11495, Saudi Arabia. Tel: +96611 8052731. Fax: +96611
8054590. E-mail: nayira@ksu.edu.sa; nayiraabdelbaky@yahoo.com
Downloadedby[KingSaudUniversity]at01:2018April2016

3. chronic b1-AR stimulation are the result of CaMKII activa-
tion. This may be related in part to CaMKII-dependent
increases of intracellular Ca2+
(Erickson et al., 2008). As
substantial body of literature using different systems and
endpoints has documented the involvement of CaMKII in
mediating effects of b-AR stimulation on phosphorylation of
Ca2+
-handling proteins (Said et al., 2002), Ca2+
release from
the sarcoplasmic reticulum (Ferrero et al., 2007), hyper-
trophic gene expression (Sucharov et al., 2006), and apoptosis
(Zhu et al., 2003).
Pharmacological agents such as: b-blockers, angiotensin-
converting enzyme inhibitors (ACEIs), and Ang II receptor
antagonists (ARBs) are effective in reversing cardiac hyper-
trophy. These drugs also restore CaMKII expression and
activity to normal value (Qu et al., 2009; Zhao et al., 2011).
However, ACEIs and ARBs provide only partial protection
from the disease progression as they silence negative feedback
control of RASS with an increase in plasma renin activity,
PRA, and accelerate the production of Ang I (Nussberger
et al., 2002; Stanton et al., 2003). This increase contributes to
the phenomenon of ‘‘ACE escape’’, that is, the process by
which circulating Ang II levels are restored nearly to baseline
levels in patients receiving chronic therapy with ACEIs or
ARBs. Aliskiren (ALS) is a direct renin inhibitor that acts at
the rate-limiting step of the RAS cascade, inhibiting the
formation of Ang I from angiotensinogen. Therefore, unlike
either ACEIs or ARBs, ALS does not induce a compensatory
increase in PRA, but rather, reduces it (Young, 1990).
Meanwhile, b1-AR blockers are one of the standard thera-
peutic approaches for the treatment of heart failure (HF). But
the mechanisms underlying the therapeutic effects of b-AR
blockers on failing hearts have been poorly understood.
Carvedilol (CAV), a third-generation, nonselective

4. -adre-
noreceptor antagonist that also possesses 1-adrenergic
blocking property, has been shown to provide greater benefit
than traditional

5. -adrenoreceptor antagonists in treating HF
because of its antioxidant, anti-apoptotic, anti-inflammatory,
and anti-fibrotic properties (Packer et al., 1996). Interestingly,
the effect of either ALS or CAV on the expression or the
activity of CaMKII in cardiac hypertrophy has never been
explored.
Up to date, no information is available on the effects of
ALS when compared with CAV, in inhibiting CaMKIId
isoforms expression, and in treatment of cardiac hypertro-
phy. Our objectives in the present study were to examine
the possibility of ameliorating isoproterenol (ISO)-induced
cardiac hypertrophy utilizing ALS and/or CAV. Second
and most important, is to shed light on the possible
potential inhibitory effects of ALS, alone and along with
CAV on the expression of CaMKIId isoforms in experi-
mental cardiac hypertrophy, a phenomenon that is not yet
shown.
Materials and methods
Drugs
ISO was obtained from Santa Cruz Biotechnology (Santa
Cruz, CA). CAV was purchased from Roche Ltd. (Basel,
Switzerland). ALS was purchased from Novartis Pharma AG
(Basel, Switzerland).
Chemicals and kits
All chemicals used in this study were of highest analytical
grade (Sigma, St. Louis, MO). Rat creatine kinase MB (CK-
MB) enzyme-linked immunosorbent assay (ELISA) kit and
rat troponin T (Tn-T) ELISA kits were purchased from Wuhan
EIAab Science Co. Ltd. (Wuhan, China). PRA was purchased
from DiaSorin Inc. (Stillwater, MN).
Animals
Male Wistar albino rats weighing 250–270 g were obtained
from Experimental of Animal Care Center, College of
pharmacy, King Saud University, Riyadh, Kingdom of
Saudi Arabia. The animals were housed in stainless steel
cages. Rats were acclimatized with free access to tap water
and standard pellet diet (Purina Chow) in a facility with
controlled temperature (22
C) and 12-h light/12-h dark cycle,
for 1 week before the experiments. The protocol of this study
has been approved by Research Ethics Committee of College
of Pharmacy, King Saud University, Riyadh, Saudi Arabia.
Establishment of cardiac hypertrophy model
Cardiac hypertrophy was developed according to the method
of Kumar et al. (2009). In this study, cardiac hypertrophy was
induced in rats by daily subcutaneous (S.C.) injection of ISO
(5 mg/kg/day) for 4 weeks.
Experimental design
To achieve the ultimate goals of this study, a total of 125 adult
male Wistar albino rats were randomly divided into 5 groups
of 25 animals each as follows:
Group 1: Rats were injected S.C. with normal saline (0.9%
NaCl) daily for 4 weeks and served as normal control group.
Group 2: Rats were injected S.C. with ISO (5 mg/kg/day)
daily for 4 weeks and served as cardiac hypertrophy group,
according to Kumar et al. (2009).
Group 3: Rats were injected S.C. with ISO concurrently
with oral administration of ALS 10 mg/kg/day for 4 weeks
(Connelly et al., 2013).
Group 4: Rats were injected S.C. with ISO concurrently
with oral administration of CAV 10 mg/kg/day for 4 weeks
(Yuan et al., 2004).
Group 5: Rats were injected S.C. with ISO concurrently
with oral administration of ALS and CAV, in the same
regimen as that previously mentioned in groups 3 and 4.
Twenty-four hours after the administration of last dose of
the treatment protocol, rats were killed; part of the blood was
collected into a prechilled microtube containing 2.6 mM
EDTA. The blood was centrifuged at 2000 Â g for 10 min in
4
C cooling centrifuge, and plasma samples were immedi-
ately frozen at À20
C until used for PRA assay. The rest of
the collected blood samples were centrifuged at 3000 rpm for
15 min, and serum samples were stored at À80
C for
determination of other serum biochemical parameters. After
collection of blood samples, hearts were quickly removed,
rinsed in ice-cold 0.9% saline, blotted dry, and weighed. After
that, left ventricle of each heart was excised, half of these left
ventricles tissues were placed in Eppendorf tubes, snap frozen
in liquid nitrogen, and stored at À80
C for subsequent protein
DOI: 10.3109/15376516.2015.1128035 Expression of Ca2+
/calmodulin-dependent protein kinase II 123
Downloadedby[KingSaudUniversity]at01:2018April2016

6. extraction and enzymatic assay. The remaining excised left
ventricles tissues were fixed in 10% formalin for subsequent
histopathological examination.
Evaluation of experimental cardiac hypertrophy in
rats
Determination of the survival rate and body weight changes
The number of survivors in each group was recorded daily
until the end of study, while body weights were recorded
every week.
Determination of the heart weight and heart weight/body
weight ratio
Rats were weighed before being killed. Hearts were weighed
immediately after dissection. Cardiac hypertrophy index was
calculated by dividing the heart weight by final body weight
(HW/BW) (mg/g).
Biochemical assay
Determination of serum creatine kinase MB and troponin T
levels
Serum Tn-T and CK-MB levels were measured using ELISA
kits (Wuhan EIAab Science Co. Ltd.).
Determination of plasma renin activity
Measurements of PRA depend on quantitative determination
of generated angiotensin I from endogenous angiotensinogen
in the tested plasma samples at 37
C over a period of 3 h.
Concentrations of generated angiotensin I were measured by
radioimmunoassay using a commercially available
GammaCoat Plasma Renin Activity 125
I-Ang I
Radioimmunoassay kit (DiaSorin Inc., Shanghai, China).
The results are expressed in terms of mass of Ang I generated
per volume of plasma in unit time (ng/ml/hr).
Real-time PCR analyses
Total RNA was isolated using TRIzol reagent (Invitrogen,
Carlsbad, CA). Synthesis of CaMKIId Isoforms cDNA were
performed (Promega, Madison, WI). Real-time polymerase
chain reaction RT-PCR was performed using a Light cyclerÕ
SYBR Green I Master (Roche Ltd, Basel, Switzerland).
Table 1 shows the CaMKIId isoform and GAPDH specific
primers used in semi-quantitative RT-PCR, where all primer
sequences were selected based on the previous work of
Hagemann et al. (1999).
Western blot analysis
Left ventricular tissue was subjected to Western blotting
according to the method of Towbin et al. (1979), using
primary antibodies to CaMKIId (Santa Cruz Biotechnology),
and anti-caspase 3 (Cell Signaling Technology, Danvers,
MA).
Histopathological examination of heart tissues
Heart specimens from each group were excised to examine
histopathologically. The excised hearts were fixed in 10%
buffered formalin at 4
C for 24 h. After fixation left ventricle
tissues were dehydrated in ascending grades of alcohol and
then embedded in paraffin. Paraffin sections were deparaffi-
nized and rehydrated to stain with hematoxylin and eosin, for
examination of the heart cellular structure. Masson’s tri-
chrome stain to detect the collagen deposition (Smith
Bruton, 1978).
Statistical analysis
Data were expressed as mean ± SD (n ¼ 6). Differences
among treated groups were tested by one-way analysis of
variance (ANOVA) followed by Bonferroni as a post-ANOVA
test. A value of p50.05 was considered significant.
Results
Effect of aliskiren and/or carvedilol treatment on
survival and macroscopic changes in isoproterenol-
hypertrophied rats
At the end of treatment period, all animals of ISO-treated
groups (5 mg/kg/day/S.C.) looked weaker and lethargic.
However, in the combination-treated group, animals showed
as much as minimal of these symptoms. ALS and/or CAV
treatment of hypertrophied rats did not significantly affect the
BW gain, as compared to normal control animals during the
whole study. However, at the end of the experiment, ISO-
treated rats showed a significant increase in their HW
compared to normal animals (p50.001). Either ALS
(10 mg/kg/day/P.O.) or CAV (10 mg/kg/day/P.O.) treatment
significantly suppressed this increase in heart weight
compared to ISO-hypertrophied rats. Interestingly, the com-
bination regimen showed more significant reduction
(p50.01) in HW as compared to ISO-treated group. HW/
BW ratio was significantly increased after 4 weeks of ISO
treatment by 62.1% as compared to normal control group.
Treatment of ISO-treated rats with either ALS or CAV
significantly reduced the increase in HW/BW ratio by about
12% and 16%, respectively as compared to that of ISO-
hypertrophied rats. Hypertrophied rats treated with ALS and
CAV showed more significant reduction (23%) in HW/BW
ratio as compared ISO group (Figure 1). On the other hand,
ISO treatment significantly decreased the survival rate of
treated animals to 40% as compared to normal untreated rats
(Table 2). However, concurrent treatment of ISO-hypertro-
phied rats with ALS preserved the survival rate up to
approximately 53%. Meanwhile, CAV treatment alone or in
Table 1. CaMKIId isoform and GAPDH-specific primers used in semi-
quantitative RT-PCR.
Primer Sequence
CaMKIId2 forward primer CCGGATGGGGTAAAGGAGTC
AACTGAGAGCT
CaMKIId2 reverse primer TCAGATGTTTTGCCACAAAGA
GGTGCCTCCT
CaMKIId3 forward primer AAAAGGAAGTCCAGTTCGAG
TGTTCAGATGAT
CaMKIId3 reverse primer TCAGATGTTTTGCCACAAAGA
GGTGCCTCCT
GAPDH forward primer CAGTCCATGCCATCACTGCC
GAPDH reverse primer GGGTCTGGGATGGAATTGTG
124 A. F. Bin-Dayel et al. Toxicol Mech Methods, 2016; 26(2): 122–131
Downloadedby[KingSaudUniversity]at01:2018April2016

7. combination with ALS increased the survival rate in hyper-
trophied rats up to73%.
Effect of aliskiren and/or carvedilol treatment on
serum creatine kinase MB and troponin T level in
isoproterenol-hypertrophied rats
As shown in Figure 2, serum CK-MB activity and Tn-T level
were significantly increased by 44% and 45% upon ISO
treatment for 4 weeks as compared to control group
(p50.05). Concomitant treatment of hypertrophied rats with
either ALS or CAV significantly decreased serum CK-MB
activity by 19% and 21.31% respectively, as compared to
hypertrophied rats. The combination protocol with nearly
reversed the increase in serum CK-MB level to a normal
value. Meanwhile, concomitant treatment of hypertrophied
animals with any form of single treatment protocol, ALS or
CAV significantly reduced the levels of serum Tn-T by 20%
and 17%, respectively, as compared to hypertrophied rats.
Additionally, treatment of hypertrophied rats with ALS and
CAV resulted in more significant decrease 21.34% in serum
Tn-T level when compared with ISO-treated group.
Effect of aliskiren and/or carvedilol treatment on
plasma renin activity in isoproterenol-hypertrophied
rats
PRA was significantly increased after 4 weeks of ISO
treatment as compared with the respective value in normal
control group. Treatment of ISO-hypertrophied rats with
either ALS or CAV significantly decreased PRA by 34.59%
and 32.42%, respectively as compared with ISO-treated
group. A further marked significant reduction in PRA was
seen with ISO-hypertrophied rats, which received the com-
bination protocol (44.14%), as compared with hypertrophied
untreated rats. Moreover, this combination regimen reversed
the increase in PRA in hypertrophied rats to normal level in a
manner similar to control value (Figure 3).
Effect of aliskiren and/or carvedilol treatment on
myocardial caspase-3 protein level in isoproterenol-
hypertrophied rats
The level of caspase-3 protein expression was significantly
increased by 3-fold in cardiac tissues of hypertrophied rats as
compared with the respective values in normal control hearts
(Figure 4). Concomitant treatment of ISO-hypertrophied
animals with either ALS or CAV significantly reduced
caspase-3 protein expression by 44.87% and 19.58%, respect-
ively, as compared with ISO-treated group. The combination
protocol resulted in significant reversal of the increase in
cardiac caspase-3 protein expression by 80% when compared
with ISO-treated group, thus nearly restored the expression of
caspase-3 to a normal control value.
Effect of aliskiren and/or carvedilol treatment on
myocardial CaMKIId2 and CaMKIId3 mRNA level in
isoproterenol-hypertrophied rats
Cardiac CaMKIId2 and CaMKIId3 mRNA expression levels
were significantly increased by 4.8- and 2-folds, respectively
in ISO-hypertrophied rats as compared with respective value
in normal control animals (Figure 5). ALS treatment signifi-
cantly reduced the increase in CaMKIId2 and CaMKIId3
mRNA expression level in hypertrophied rats by 45.82% and
34%, respectively (p50.05). Whereas, concurrent treatment
of ISO-treated rats with CAV reduced the increase in
CaMKIId2 and CaMKIId3 mRNA expression level in hyper-
trophied rats by 56.71% and 40%, respectively. Combined
treatment of ISO-hypertrophied rats with ALS and CAV
resulted in a significant reversal of the increase in cardiac
Table 2. Effects of concurrent treatment with aliskiren, carvedilol, and their combination on isoproterenol-induced changes on body weight, heart
weight, and mortality percentage in hypertrophied rats.
Body weight (g)
Groups Initial Final Heart weight (g) Mortality percentage
Control 250 ± 8.851 271.6 ± 23.73 0.906 ± 0.034 0
ISO 247.5 ± 22.37 310 ± 24.41 1.532 ± 0.035* 60
ISO + ALS 246.8 ± 22.85 305 ± 24.45 1.294 ± 0.131* 47
ISO + CAV 253 ± 24.46 295.5 ± 25.64 1.307 ± 0.108* 27
ISO + ALS + CAV 252.16 ± 19.9 306 ± 23.38 1.171 ± 0.095* 27
Data are presented as mean ± SD.
*p50.001, compared to normal control group,
p50.01, compared to ISO group using ANOVA followed by Bonferroni as a post-ANOVA test.
Figure 1. Effects of aliskiren and/or carvedilol treatment on iso-
proterenol-induced changes in heart weight/body weight ratio in rats.
Data are presented as mean ± SD. a
p50.001, b
p50.01, compared to
normal control group, *p50.05, **p50.01, ***p50.001, compared to
ISO control group, using ANOVA followed by Bonferroni as a post-
ANOVA test.
DOI: 10.3109/15376516.2015.1128035 Expression of Ca2+
/calmodulin-dependent protein kinase II 125
Downloadedby[KingSaudUniversity]at01:2018April2016

8. CaMKIId2 and CaMKIId3 mRNA expression level as
compared to ISO-treated group.
Effect of aliskiren and/or carvedilol on myocardial
CaMKIId protein level in isoproterenol-hypertrophied
rats
As shown in Figure 6, the total cardiac CaMKIId protein level
was significantly increased by 4.5-fold after ISO-treatment for
4 weeks as compared to normal control group (p50.05).
Concomitant treatment of ISO-hypertrophied rats with ALS
alone-reduced cardiac CaMKIId protein expression by 40% as
compared to ISO-treated group. Meanwhile, either of CAV or
the combined treatment of ISO-treated rats caused a signifi-
cant reversal in the increase of CaMKIId protein expression
by 73.33% and 48.88%, respectively, when compared
with the respective values of ISO-hypertrophied rats.
Additionally, concurrent treatment of ISO-treated group
with either CAV or the combination protocol resulted in
reversal of cardiac CaMKIId protein expression nearly to a
normal control value.
Figure 2. Effects of aliskiren and/or carvedilol treatment on serum (a) creatine kinase MB and (b) troponin T in isoproterenol-hypertrophied rats. Data
are presented as mean ± SD. *p50.05, compared to normal control group, p50.05 compared to ISO-hypertrophied group, up50.05, compared to
combination group, respectively, using ANOVA followed by Bonferroni as a post-ANOVA test.
Figure 4. Effects of concurrent treatment with aliskiren, carvedilol, and
their combination on isoproterenol-induced changes of myocardial
caspase-3 protein expression in rats. Caspase-3 protein expression level
was quantified using western blot analysis and normalized to b-actin
housekeeping gene. Then, was detected using the enhanced chemilu-
minescence method. The intensity of the bands was normalized to
b-actin signal using Image J, one of the three representative experiments
is shown. Data are presented as mean ± SD (n ¼ 6). *p50.05, compared
to normal control group, p50.05 compared to ISO-hypertrophied
group, up50.05, compared to combination group, respectively, using
ANOVA followed by Bonferroni as a post-ANOVA test.
Figure 3. Effects of aliskiren and/or carvedilol treatment on plasma
renin activity in isoproterenol-hypertrophied rats. Data are presented as
mean ± SD. *p50.05, compared to normal control group, p50.05
compared to ISO-hypertrophied group, up50.05, compared to combin-
ation group, respectively, using ANOVA followed by Bonferroni as a
post-ANOVA test.
126 A. F. Bin-Dayel et al. Toxicol Mech Methods, 2016; 26(2): 122–131
Downloadedby[KingSaudUniversity]at01:2018April2016

9. Effect of aliskiren and/or carvedilol treatment on
isoproterenol induced histopathological changes in
rats cardiac tissues
Hematoxylin and eosin stain of left ventricles from normal
control rats showed normal muscle cell size, cytoplasmic
reaction, and normal healthy nuclei. Meanwhile, muscle cells
of rats received ISO showed marked cellular degeneration in a
form of increased cell size, cytoplasmic acidophilic reaction,
and most of nuclei showed pyknosis. Also, there are large
areas of inflammatory cell infiltrations. Administration of
ALS, CAV, or their combination with hypertrophied rats
decreased both cellular degeneration and cellular infiltration
(Figure 7). On the other hand, Masson’s trichrome stain of the
ventricles walls in normal rats showed normal few collagen
depositions that was restricted to the wall of the blood vessels.
Meanwhile, ventricles of rats exposed to ISO, showed
multiple large foci of fibrosis in between cardiac muscle
cells. Heart from treated rats with ALS, CAV, or their
combination showed marked decrease in collagen deposition
as well as decrease in fibrosis (Figure 8).
Discussion
Activation and overexpression of CaMKIId2 and CaMKIId3
plays a potential role in cardiac hypertrophy progression
(Zhang et al., 2002, 2003), and constitutes one of the main
steps in the signaling cascade that leads to myocardial cell
apoptosis (Palomeque et al., 2009; Vila-Petroff et al., 2007;
Zhu et al., 2007). Our study demonstrated that ISO treatment
for 4 weeks induced cardiac hypertrophy as indicated by the
significant increase in the indices of cardiac hypertrophy,
markers for cardiac muscle injury, and mortality % in ISO-
treated animals. Most importantly, ISO-induced cardiac
hypertrophy was associated with a significant increase in
CaMKIId2 and CaMKIId3 mRNA expression, total CaMKIId
protein expression, and the apoptotic marker, caspase 3
protein expression.
The observed significant increase in HW and consequently
the HW/BW% of ISO-treated rats represent evidences for
hypertrophic response. Increased mechanical work due to
activation of b-ARs by ISO causes the muscle cells within the
Figure 5. Effects of concurrent treatment with aliskiren, carvedilol, and their combination on isoproterenol-induced changes in myocardial (a)
CaMKIId2 and (b) CaMKIId3 mRNA expression in rats. CaMKIId2 mRNA level was quantified using RT-PCR and normalized to GAPDH
housekeeping gene. Triplicate reactions were performed for each experiment, and values presented are the means of three independent experiments.
Data are presented as mean ± SD (n ¼ 6). *p50.05, compared to normal control group, p50.05 compared to ISO-hypertrophied group, up50.05
compared to combination group respectively, using ANOVA followed by Bonferroni as a post-ANOVA test.
Figure 6. Effects of concurrent treatment with aliskiren, carvedilol, and
their combination on isoproterenol-induced changes in myocardial
CaMKIId protein expression in rats. CaMKIId protein expression level
was quantified using western blot analysis and normalized to b-actin
housekeeping gene. Then, was detected using the enhanced chemilu-
minescence method. The intensity of the bands was normalized to
b-actin signal using Image J, one of the three representative experiments
is shown. Data are presented as mean ± SD (n ¼ 3). *p50.05, compared
to normal control group, p50.05 compared to ISO-hypertrophied
group, respectively, using ANOVA followed by Bonferroni as a post-
ANOVA test.
DOI: 10.3109/15376516.2015.1128035 Expression of Ca2+
/calmodulin-dependent protein kinase II 127
Downloadedby[KingSaudUniversity]at01:2018April2016

10. heart to enlarge leading to an increase in size and mass
(Sugden Clerk, 1998). In line with our findings, Kumar and
co-workers (2009) have reported that ISO treatment in the
same regimen as in our study (5 mg/kg/day/S.C. for 4 weeks)
caused a significant increase in HW/BW ratio in male Wistar
rats by about 50% with additional significant increase
in relative wall thickness. This observed increase in the
HW in ISO-hypertrophied rats may also be due to increase in
cell size, total collagen (Leenen et al., 2001), fibrosis (Yeh
et al., 2010), and inflammation (Fernandez et al., 2012).
These observations are in line with the histopathological
findings of the present study, in which the ventricles of rats
exposed to ISO showed sever myocardial cell degeneration in
a form of increased cell size, cytoplasmic acidophilic
reaction, and most of the nuclei showed pyknosis, accom-
panied with large areas of inflammatory cell infiltrations.
ISO-induced hypertrophy has been shown to be associated
with a high mortality rate (up to 80%) (Balakumar et al.,
2007), which is in accordance with our data. The majority of
authors dealing with ISO toxicity thought that myocardial
damage via the increase in catecholamines and subsequent
imbalance of energy supply and cardiac hyperactivity is the
most important contributors to the mortality after ISO
treatment.
ALS and/or CAV treatment significantly reduced the
altered HW/BW ratio and increased the survival of the
treated hypertrophied rats. Azhar et al. (2012) showed that,
ALS treatment significantly restored HW/BW ratio in a
chronic murine model of doxorubicin-induced cardiomyop-
athy in rats, a result that is keeping with ours. Ma and co-
workers (2012) also documented that ALS can inhibit
deoxycorticosterone induced myocardial fibrosis and pro-
duced significant reduction in inflammation and cardiac
remodeling. Meanwhile, CAV was demonstrated to signifi-
cantly decrease HW and even restored LV weight to control
levels in ISO-hypertrophied rats (Hanada et al., 2008). CAV
also significantly reduced myocardial collagen, cardiomyo-
cyte size, and interstitial fibrosis in experimental cardiac
hypertrophy (Wei et al., 2000; Ye-Jing et al., 2006).
Moreover, the United States CAV Program Trials has also
documented CAV efficacy in reducing mortality and hospi-
talizations in patients with HF (Bristow et al., 1995; Colucci
et al., 1996).
The release of cellular cardiac enzymes into the blood
stream is correlated with changes in plasma membrane
integrity and/or permeability as a response to b-adrenergic
stimulation. This might be due to damage inflicted upon the
sarcolemma by the b-agonist ISO, rendering it leaky (Ahmad
et al., 2004). This hypothesis is supported by the results of our
study, as we have observed a significant increase in serum
level of cardiotoxicity enzymatic indices (CK-MB andTn-T)
in hypertrophied rats. Selvaraj Pugalendi (2010) demon-
strated that, different cardiac markers indices including
CK-MB, cardiac Tn-T, and Tn-I were significantly elevated
Figure 7. Light photomicrographs of sections
of rats left ventricles stained with hema-
toxylin and eosin (scale bar, 100 mm). (A)
Left ventricle of normal control rat showing
normal sized and architecture of myocardial
cells and normal amount and content of
endomysium in between muscle cells. (B)
Left ventricle of rat exposed to ISO as
cardiotoxic drug showing sever myocardial
cell degeneration (arrow) in which the muscle
cells are swollen with deep acidophilic cyto-
plasm and pyknotic nuclei. Also there are
large foci of inflammatory cellular infiltra-
tion (star). (C) Left ventricular muscle of rat
received ISO and ALS for protections show-
ing obvious decrease of cellular degeneration
(arrow) while still there is inflammatory
cellular infiltration (star). (D) Left ventricular
muscle of rat received ISO and CAV showing
marked decrease in myocardial degeneration
(arrow) and diminishing of the foci of
inflammatory cells (star). (E) Left ventricle
of rat received ISO and combination of ALS
and CAV showing apparently normal myo-
cardium and absence of abnormal inflam-
matory cells.
128 A. F. Bin-Dayel et al. Toxicol Mech Methods, 2016; 26(2): 122–131
Downloadedby[KingSaudUniversity]at01:2018April2016

11. after ISO induced myocardial ischemia in rats. Treatment
with ALS, CAV and most interestingly their combination
significantly reduced the elevation in serum CK-MB and Tn-T
level in ISO-hypertrophied rats. Our biochemical findings
were supported by the improvement in histological architec-
ture of ventricular tissues in all treated groups, with maximal
improvement in the combination regimen. Rashikh et al.’s
(2012) data are in line with our results, where ALS
significantly reduced serum CK levels in murine model of
cardiomyopathy. On the other hand, Nahar et al. (2004) have
found that CAV significantly reduced serum CK-MB level in
rats with myocardial infarction. Also, El-Shitany et al. (2012)
reported that CAV treatment have reduced the level of Tn-T in
children with acute lymphoblastic leukemia treated with
adriamycin.
Plasma renin concentration and activity are major compo-
nents and indicator for RAAS activation that occur in
response to cardiovascular diseases including cardiac hyper-
trophy (Vergaro et al., 2008). ISO-induced cardiac hypertro-
phy model has been proven to be associated with exacerbation
in RAAS activation (Velez Rueda et al., 2012) and is
confirmed by our results. Where, ISO treatment for 4 weeks
produced a significant increase in PRA. Treatment of
hypertrophied rats with ALS and/or CAV significantly
decreased PRA, indicating their suppressing effect on
RAAS activation. b-blockers inhibit renin release from the
kidney, which contributes to the benefits of b-adenoreceptor
blockade (Campbell et al., 2001). CAV was shown to
markedly reduce the increase in active renin level observed
in chronic HF patient and tended to decrease ACE activity as
well (Solal et al., 2004), a result that is keeping with the
inhibitory effect of CAV on PRA, that was reported in our
study. On the other hand, ALS treatment of hypertensive
patients reduced PRA by up to 65% from baseline (Villamil
et al., 2007). Furthermore, Velez Rueda et al. (2012) have
documented a significant reduction in plasma aldosterone
level, as an index for RAAS activity, after ALS treatment in
ISO model of cardiac hypertrophy in rats.
Increased cardiac CaMKIId expression and myocardial
apoptosis has been linked to different ISO-induced cardiac
hypertrophy and were associated with RAAS exacerbation
(Velez Rueda et al., 2012; Zhang et al., 2013). In harmony
with all of the previous studies, our result demonstrated that
ISO treatment significantly increased CaMKIId2 and
CaMKIId3 mRNA expression, total CaMKIId protein expres-
sion, and caspase 3 protein expression. One of the postulated
mechanism underlying this activation suggest that, stimula-
tion of b-ARs with ISO, activates PKA, which increases
intracellular Ca2+
, that finally might end with activation of
CaMKII and inducing apoptosis (Grimm Brown, 2010;
Zhang et al., 2013). b-ARs stimulation with ISO also result in
increase of renin release from the kidney, which contribute to
Figure 8. Light photomicrographs of sections
of rats left ventricles stained with Masson’s
trichrome stain (scale bar; 100 mm). (A) Left
ventricle of normal control rat showing
normal amount and distribution of collagen
fibers, which restricted to the wall of the
blood vessels (arrow). (B) Left ventricle of
rat exposed to ISO as cardiotoxic drug
showing large areas of fibrosis (arrow). (C)
Left ventricular muscle of rat received ISO
and ALS for protection showing marked
decrease of the fibrosis (arrow). (D) Left
ventricular muscle of rat received ISO and
CAV showing marked decrease of the myo-
cardial fibrosis (arrow). (E) Left ventricle of
rat received ISO and combination of ALS and
CAV showing very little collagen deposition
(arrow).
DOI: 10.3109/15376516.2015.1128035 Expression of Ca2+
/calmodulin-dependent protein kinase II 129
Downloadedby[KingSaudUniversity]at01:2018April2016

12. the increased activity of RAAS (Velez Rueda et al., 2012).
One of the most contributing mechanisms for RAAS effect on
the progression and maintenance of cardiac hypertrophy is
linked to CaMKII. This is might be related to the effect of
Ang II on increasing intracellular Ca2 +
through Gq pro-
tein mediated IP3 and DAG pathway (Wenzel et al., 2001).
Ang II also induces apoptotic pathway that involves increase
in ROS production and activation of CaMKII (Palomeque
et al., 2009). With respect to isoform-specific functions in
the heart, many studies over the past decade explored
the potential role of CaMKIId2 and CaMKIId3 in maladap-
tive cardiac remodeling (Zhang et al., 2002, 2003).
Additionally, CaMKIId2 has been shown to be a common
intermediate of cardiac cell apoptosis induced by diverse
death-inducing stimuli, including excessive b1-AR stimula-
tion, H2O2, intracellular high Ca2+
, and acidosis (Zhu et al.,
2003, 2007).
Inhibition of CaMKII activity and expression significantly
reduced myocardial hypertrophy and myocyte apoptosis
(Mangmool et al., 2010). ACEIs and ARBs have been
reported to attenuate experimental and clinical cardiac
hypertrophy, myocardial apoptosis, and normalize the
increases in CaMKII activity and expression (Al-Shabanah
et al., 1998; Hempel et al., 2002; Iqba et al., 2008; Qu et al.,
2009). However, no information was available on the effects
of DRI, ALS, nor the b-blocker, CAV, on CaMKIId activity
and expression in cardiac hypertrophy. Our results docu-
mented the ability of both ALS and CAV to inhibit ISO-
induced increase in CaMKIId2 and CaMKIId3 mRNA
expression that was associated with a significant decrease in
cardiac caspase 3 expression. Interestingly, the combination
treatment caused a complete reversal of caspase-3 protein
expression in ISO-hypertrophied hearts to a normal control
value. The mechanisms of ISO-induced cardiac cell death are
suggested to be mediated through CaMKII-dependent PKA
activation, and b1-antagonist, metaprolol abolished this
cardiotoxic features (Zhang et al., 2013). Numerous studies
have shown that CAV reduced myocardial cell apoptosis
(Romeo et al., 2000; Schwarz et al., 2003; Yue et al., 1998).
More recently, CAV was shown to protect cardiomyocytes
from H2O2-induced apoptosis by suppressing caspase-3 and
subsequent apoptotic pathways (Xu et al., 2014). On the other
hand, ALS treatment was documented to reduce caspase-3
activity in a murine model of cardiomyopathy (Rashikh et al.,
2012).
In conclusion, our study showed that chronic exposure to
b-adrenergic agonists, ISO, lead to enhancement of RAAS
with consequent progression of myocardial hypertrophy. The
mechanism of this hypertrophic effect involves CaMKIId-
dependent apoptosis, which has been prevented by b-AR
blockade and/or RAAS inhibition utilizing either CAV and/or
ALS. The combined use of both agents potentially amelio-
rated ISO-induced cardiac hypertrophy. The use of ALS
helped in suppression of the RAAS activity. Meanwhile, CAV
has additional beneficial anti-adrenergic effects that offer
another pathway to suppress RAAS. These results may
suggest that CaMKIId gene is a target for ALS and CAV
treatment in cardiac hypertrophy. Thus, CaMKIId may
constitute novel targets for therapies directed against hyper-
trophy and HF.
Declaration of interest
This research was supported by a grant from Research Center
of the Center Female Scientific and Medical Colleges in King
Saud University and King Abdul-Aziz City for Science and
Technology (KACST).
References
Ahmad KK, Rana AC, Dixit VK. (2004). Effect of Calotropis procera
latex on isoproterenol induced myocardial infarction in albino rats.
Phytomedicine 11:327–30.
Al-Shabanah O, Mansour M, Bekairi A. (1998). Captopril ameliorates
myocardial and hematological toxicities induced by adriamycin.
Biochem Mol Biol Int 45:419–27.
Azhar R, Shibli JA, Krishna KP, et al. (2012). Aliskiren attenuates
myocardial apoptosis and oxidative stress in chronic murine model of
cardiomyopathy. Biomed Pharmacother 66:138–43.
Balakumar P, Singh AP, Singh M. (2007). Rodent models of heart
failure. J Pharmacol Toxicol Methods 56:1–10.
Bristow MR, Gilbert EM, Abraham WT. (1995). Multicenter oral
cavedilol heart failure assessment (MOCHA): a six months dose-
response evaluation in class II-IV patients. Circulation 92:142.
Campbell DJ, Aggarwal A, Esler M, Kaye D. (2001). Beta-blockers,
angiotensin II, and ACE inhibitors in patients with heart failure.
Lancet 358:1609–10.
Carreno JE, Apablaza F, Ocaranza MP, Jalil JE. (2006). Cardiac
hypertrophy: molecular and cellular events. Rev Esp Cardiol 59:
473–86.
Colucci WS, Packer M, Bristow MR. (1996). Carvedilol inhibits clinical
progression in patients with mild symptoms of heart failure. US
carvedilol heart failure study group. Circulation 94:2800–6.
Connelly KA, Advani A, Zhang Y, et al. (2013). Combination
angiotensin converting enzyme and direct renin inhibition in heart
failure following experimental infarction. Cardiovasc Ther 31:84–91.
El-Shitany NA, Tolba OA, El-Shanshory MR, El-Hawary EE. (2012).
Protective effect of carvedilol on adriamycin-induced left ventricular
dysfunction in children with acute lymphoblastic leukemia. J Card Fail
18:607–13.
Erickson JR, Joiner ML, Guan X, et al. (2008). A dynamic pathway for
calcium-independent activation of CaMKII by methionine oxidation.
Cell 133:462–74.
Fernandez BM, Heras ND, Miana M, et al. (2012). Spironolactone
prevents alterations associated with cardiac hypertrophy produced by
isoproterenol in rats: involvement of serum- and glucocorticoid-
regulated kinase type 1. Exp Physiol 97:710–18.
Ferrero P, Said M, Sanchez G, et al. (2007). Ca2+
/calmodulin kinase II
increases ryanodine binding and Ca2+
-induced sarcoplasmic reticulum
Ca2+
release kinetics during beta-adrenergic stimulation. J Mol Cell
Cardiol 43:281–91.
Grimm M, Brown JH. (2010). Beta-adrenergic receptor signaling in the
heart: role of CaMKII. J Mol Cell Cardiol 48:322–30.
Hagemann D, Bohlender J, Hoch B, et al. (2001). Expression of Ca2+
/
calmodulin-dependent protein kinase II delta-subunit isoforms in rats
with hypertensive cardiac hypertrophy. Mol Cell Biochem 220:69–76.
Hagemann D, Hoch B, Krause EG, Karczewski P. (1999).
Developmental changes in isoform expression of Ca2+
/calmodulin-
dependent protein kinase II delta-subunit in rat heart. J Cell Biochem
74:202–10.
Hanada K, Asari K, Saito M, et al. (2008). Comparison of pharmaco-
dynamics between carvedilol and metoprolol in rats with iso-
proterenol-induced cardiac hypertrophy: effects of carvedilol
enantiomers. Eur J Pharmacol 589:194–200.
Hempel P, Hoch B, Bartel S, Karczewski P. (2002). Hypertrophic
phenotype of cardiac calcium/calmodulin-dependent protein kinase II
is reversed by angiotensin converting enzyme inhibition. Basic Res
Cardiol 97:I96–101.
Iqba M, Dubey K, Anwer T. (2008). Protective effects of telmisartan
against acute doxorubicin-induced cardiotoxicity in rats. Pharmacol
Rep 60:382–90.
Kumar S, Seth S, Jaiswal A, et al. (2009). Chronic b adrenergic
activation induced left ventricular systolic dysfuction is associated
with systemic release of TNF-a and 1L-1-b in rats. Pharmacol Rep 61:
870–6.
130 A. F. Bin-Dayel et al. Toxicol Mech Methods, 2016; 26(2): 122–131
Downloadedby[KingSaudUniversity]at01:2018April2016

13. Leenen FH, Roselyn W, Baoxue Y. (2001). Isoproterenol-induced
cardiac hypertrophy: role of circulatory versus cardiac renin-angio-
tensin system. Am J Physiol Heart Circ Physiol 281:H2410–16.
Ma L, Hua J, He L, et al. (2012). Anti-fibrotic effect of aliskiren in rats
with deoxycorticosterone induced myocardial fibrosis and its potential
mechanism. Bosn J Basic Med Sci 12:69–73.
Maier L, Bers DM. (2002). Calcium, calmodulin and calcium-calmodu-
lin kinase II: heartbeat to heartbeat and beyond. J Mol Cell Cardiol 34:
919–39.
Mangmool S, Shukla AK, Rockman HA. (2010). b-Arrestin dependent
activation of CaMKII after b1-adrenergic receptor stimulation. J Cell
Biol 189:573–87.
Nahar N, Akhter N, Rahman MS. (2004). Protective role of carvedilol in
expermental myocardial infarction. Bangladesh J Physiol Pharmacol
20:9–12.
Nussberger J, Wuerzner G, Jensen C, Brunner HR. (2002). Angiotensin
II suppression in humans by the orally active renin inhibitor aliskiren
(SPP100): comparison with enalapril. Hypertension 39:el–852.
Packer M, Bristow MR, Cohn JN. (1996). The effect of carvedilol on
morbidity and mortality in patients with chronic heart failure. N Engl J
Med 334:1349–55.
Palomeque J, Delbridge L, Petroff M. (2009). Angiotensin II: a regulator
of cardiomyocyte function and survival. Front Biosci 14:5118–33.
Qu F, Liu ZH, Jiang B, et al. (2009). Effects of valsartan on myocardial
CaMKII expression and activity in a rabbit model of heart failure.
Zhonghua Xin Xue Guan Bing Za Zhi 37:501–4.
Rashikh A, Ahmad SJ, Pillai KK, et al. (2012). Aliskiren attenuates
myocardial apoptosis and oxidative stress in chronic murine model of
cardiomyopathy. Biomed Pharmacother 66:138–43.
Romeo F, Li D, Shi M, Mehta JL, et al. (2000). Carvedilol prevents
epinephrine-induced apoptosis in human coronary artery endothelial
cells: modulation of Fas/Fas ligand and caspase-3 pathway.
Cardiovasc Res 45:788–94.
Said M, Mundina-Weilenmann C, Vittone L, Mattiazzi A. (2002). The
relative relevance of phosphorylation of the Thr(17) residue of
phospholamban is different at different levels of beta-adrenergic
stimulation. Pflugers Arch 444:801–9.
Schultz Jel J, Witt SA, Glascock B, et al. (2002). TGF-beta1 mediates the
hypertrophic cardiomyocyte growth induced by angiotensin II. J Clin
Invest 109:787–96.
Schwarz ER, Kersting PH, Reffelmann T, et al. (2003). Cardioprotection
by carvedilol: antiapoptosis is independent of beta-adrenoceptor
blockage in the rat heart. J Cardiovasc Pharmacol Ther 8:207–15.
Selvaraj P, Pugalendi KV. (2010). Hesperidin, a flavanone glycoside, on
lipid peroxidation and antioxidant status in experimental myocardial
ischemic rats. Redox Rep 15:217–23.
Smith A, Bruton J. (1978). A colour atlas of histological staining
techniques. J Clin Pathol 31:298.
Solal AC, Jondeau G, Beauvais F, Berdeaux A. (2004). Beneficial effects
of carvedilol on angiotensin-converting enzyme activity and renin
plasma levels in patients with chronic heart failure. Eur J Heart Fail 6:
463–6.
Stanton A, Jensen C, Nussberger J, O’Brien E. (2003). Blood pressure
lowering in essential hypertension with an oral renin inhibitor,
aliskiren. Hypertension 42:1137–43.
Sugden PH, Clerk A. (1998). Cellular mechanisms of cardiac hypertro-
phy. J Mol Med 76:725–46.
Towbin H, Staehelin T, Gordon J, et al. (1979). Electrophoretic transfer
of proteins from polyacrylamide gels to nitrocellulose sheets:
procedure and some applications. Proc Nat Acad Sci 76:4350–54.
Velez Rueda JO, Palomeque J, Mattiazzi A. (2012). Early apoptosis in
different models of cardiac hypertrophy induced by high renin-
angiotensin system activity involves CaMKII. J Appl Physiol 12:
2110–20.
Vergaro G, Fontana M, Poletti R. (2008). Plasma renin activity is
an independent prognostic factor in chronic heart failure. Eur Heart J
29:393.
Vila-Petroff M, Salas MA, Said M, et al. (2007). CaMKII inhibition
protects against necrosis and apoptosis in irreversible ischemia-
reperfusion injury. Cardiovasc Res 73:689–98.
Villamil A, Chrysant SG, Calhoun D. (2007). Renin inhibition with
aliskiren provides additive antihypertensive efficacy when used in
combination with hydrochlorothiazide. J Hypertens 25:217–26.
Wei S, Chow LC, Sanderson JE. (2000). Effect of carvedilol in
comparison with metoprolol on myocardial collagen postinfarction. J
Am Coll Cardiol 36:276–81.
Wenzel S, Taimor G, Piper HM, Schlu¨ter KD. (2001). Redox-sensitive
intermediates mediate angiotensin II-induced p38 MAP kinase
activation, AP-1 binding activity, and TGF-beta expression in adult
ventricular cardiomyocytes. FASEB J 15:2291–3.
Xu C, Hu Y, Hou L, et al. (2014). b-Blocker carvedilol protects
cardiomyocytes against oxidative stress-induced apoptosis by up-
regulating miR-133 expression. J Mol Cell Cardiol 75:111–21.
Ye-Jing Z, Mei-Xiang X, Jiang S, et al. (2006). Effect of matrine and
carvedilol on collagen and MMPs activity of hypertrophy myocardium
induced by pressure overload. J Zheijang Univ 7:245–50.
Yeh JL, Hsu JH, Wu PJ, et al. (2010). KMUP-1 attenuates isoprenaline-
induced cardiac hypertrophy in rats through NO/cGMP/PKG and
ERK1/2/calcineurin A pathwaysbphy. Br J Pharmacol 159:1151–60.
Yoneda M, Sanada H, Yatabe J, et al. (2005). Differential effects of
angiotensin II type-1 receptor antisense oligonucleotides on renal
function in spontaneously hypertensive rats. Hypertension 46:58–65.
Young DS. (1990). Effects of drugs on clinical laboratory tests.
Washington (DC): AACC Press.
Yuan Z, Shioji K, Kihara Y, et al. (2004). Cardioprotective effects of
carvedilol on acute autoimmune myocarditis: anti-inflammatory
effects associated with antioxidant property. Am J Physiol Heart
Circ Physiol 286:H83–90.
Yue TL, Ma XL, Wang X, et al. (1998). Possible involvement of stress-
activated protein kinase signaling pathway and Fas receptor expres-
sion in prevention of ischemia/reperfusion-induced cardiomyocyte
apoptosis by carvedilol. Circ Res 82:166–74.
Zhang T, Johnson EN, Gu Y, et al. (2002). The cardiac specific nuclear
delta (B) isoform of CaMKII induces hypertrophy and dilated
cardiomyopathy associated with increased protein phosphatase 2A
activity. J Biol Chem 277:1261–7.
Zhang T, Maier LS, Dalton ND, et al. (2003). The dC isoform of
CaMKII Is activated in cardiac hypertrophy and induces dilated
cardiomyopathy and heart failure. Circ Res 92:912–19.
Zhang X, Szeto C, Gao E, et al. (2013). Cardiotoxic and cardioprotective
features of chronic b-adrenergic signaling. Circ Res 112:498–509.
Zhao Z, Fefelova N, Shanmugam M, et al. (2011). Angiotensin II induces
after depolarisations via reactive oxygen species and CaMKII
signalling. J Mol Cell Card 50:128–36.
Zhu W, Woo AY, Yang D, et al. (2007). Activation of CaMKII delta C is
a common intermediate of diverse death stimuli-induced heart muscle
cell apoptosis. J Biol Chem 282:10833–9.
Zhu WZ, Wang SQ, Chakir K, et al. (2003). Linkage of beta1-adrenergic
stimulation to apoptotic heart cell death through protein kinase A-
independent activation of Ca2+
/calmodulin kinase II. J Clin Invest
111:617–25.
DOI: 10.3109/15376516.2015.1128035 Expression of Ca2+
/calmodulin-dependent protein kinase II 131
Downloadedby[KingSaudUniversity]at01:2018April2016