Recommended
More Related Content
Viewers also liked
Similar to GeneR Analysis of Rhodopsin Gene Sequence
Similar to GeneR Analysis of Rhodopsin Gene Sequence (17)
More from ocha_kaneko
Recently uploaded
Recently uploaded (20)
GeneR Analysis of Rhodopsin Gene Sequence
- 1. 2010/06/17 kaneko.satoko(at)ocha.ac.jp
- 2. R /R R Bioconductor(GeneR)
- 3. ( )
- 4. – ‐ ( ) ( ) ( )
- 5. – ‐ (A:61%, G:32%, C: 7%) 5 (A:80%, G:20%) 10 (A:60%, G:40%) 5 01 A 10 ( ) 02 A 03 A 01 A A G A G G 02 A G A A 04 G A A A G 05 A 03 A G A A C G 04 G C A A A: 80%, G: 20% A A A A 05 A A G A G 06 G 07 A 08 G 09 A 10 G A: 60%, G: 40%
- 6. – ‐ 1 n x = ∑ xi n i=1 ( ) € ( ‐1) ( )
- 7. – ‐ 5 5, 0.5 5, 1.0 5, 2.0
- 8. R R R ( ) Bioconductor(GeneR)
- 9. R R (2010 6 14 R 2 11.1) R‐2.11.1.dmg
- 10. R – ‐ R q() Save workspace image? [y/n/c]: y n
- 11. R –R ‐ R dock
- 12. R – ‐
- 13. R – ‐ > 1+2 # [1] 3 + >3‐1 # ‐ [1] 2 * >10*2 # / [1] 20 ^ >7/2 # sqrt() [1] 3.5 > 2^2 # [1] 4 > sqrt(4) # [1] 2
- 14. R – ‐ R c > x <‐ c(1,2,5,6) # c() () x > x [1] 1 2 5 6 > x + 10 #x (1,2,5,6) 10 [1] 11 12 15 16 > x * 10 #x 10 [1] 10 20 50 60 > x <‐ c(“France”, “123”, “abc”) # “” > x [1] "France" "123" "abc"
- 15. R – ‐ > number<‐ c(1,2,3,4,5,6,7,8,9,10) > number [1] 1 2 3 4 5 6 7 8 9 10 > length (number) #length [1] 10 > sum (number) # [1] 55 > max (number) # [1] 10 >min (number) # [1] 1 > mean(number) # [1] 5.5
- 16. R – 1‐ [41,55,51,61,45,38,60,48,43,46,63,51,55,55,53] > x<‐ c(41,55,51,61,45,38,60,48,43,46,63,51,55,55,53) > length(x) [1] 15 > sum(x) # [1] 765 # > 765/15 > mean(x) [1] 51
- 17. R – 2‐ [41,55,51,61,45,38,60,48,43,46,63,51,55,55,53] > sub <‐ x‐51 > sub [1] ‐10 4 0 10 ‐6 ‐13 9 ‐3 ‐8 ‐5 12 0 4 4 2 > sub^2 [1] 100 16 0 100 36 169 81 9 64 25 144 0 16 16 4 > sum(sub^2) [1] 780 > 780/15 [1] 52 >sqrt(52) # [1] 7.211103
- 18. Bioconductor h`p://www.bioconductor.org/packages/release/Soaware.html
- 19. Bioconductor/GeneR GeneR > source("h`p://www.bioconductor.org/biocLite.R") > biocLite("GeneR") > library(GeneR) > ls(“package:GeneR”) #GeneR
- 20. Bioconductor/GeneR 1 > s<‐"gtcatgcatgctaggtgacag`aaaatgcgtctaggtgacagtctaacaa" > placeString(s) #GeneR placeString() [1] 0 > translate() # 1 [1] "VMHAR*QLKCV*VTV*Q" > translate (from=c(1,2,3),to=c(0,0,0)) #3 [1] "VMHAR*QLKCV*VTV*Q" "SCMLGDS*NASR*QSN" "HAC*VTVKMRLGDSLT" > strCompoSeq(s, wsize=1) # (% ) T C A G X [1,] 0.2549020 0.1764706 0.3137255 0.2549020 0 > strCompoSeq(s, wsize=2) # 2 TT TC TA TG TX CT CC CA CG CX AT AC AA AG AX GT GC [1,] 0 0 0.04 0.08 0 0.12 0 0.2 0 0 0.04 0 0.08 0.08 0 0.24 0.04 GA GG GX XT XC XA XG XX [1,] 0.08 0 0 0 0 0 0 0
- 21. ‐Rhodopsin ‐ Rhodopsin (RHO) 5 exons, CDS 1047bp (348a.a.) human, chimpanzee, macaque Rhodopsin transioon, transversion 1) REST 2) CDS R CDS 3) ClustalW mulople alignment 4) transioon transversion
- 22. Clustalw Clustalw mulople alignment alignment output format Clustalw Clustalx GUI available for download here
- 23. Clustalw Clustalw‐2.0.12 (2010 6 ) ‐2.0.12‐ ‐2.0.12‐ Users/tg03/bin ap.ebi.ac.uk clustalw‐2.0.12macosx
- 24. (nucleoode) A,T,G,C 4 A,G purine T,C pyrimidine A T G C purine pyrimidine transioon purine pyrimidine transversion C α T β β β β A T α A G :transioon α :transversion β G C purine pyrimidine Figure 4‐4 Molecular Biology of the Cell (© Garland Science 2008)
- 25. transioon/transversion Rhodopsin CDS(coding sequence) 1047bp transioon: A G, C T transversion: A,G C,T NCBI ID human(NM_000539) chimpanzee(XM_516740) macaque(XM_001094250) human – chimpanzee, human – macaque transioon transversion p distace p distance = / transioon transversion p distance human‐ chimpanzee human‐ macaque
- 26. Bioconductor/GeneR 1 R Users/tg03/bin > library(GeneR) # GeneR R 1) REST NCBI Rhodopsin x R > x <‐ " " > s <‐placeString(x) 2) CDS R CDS # rhodopsin.txt fasta > writeFasta(file="rhodopsin.txt",from =96, to=1142, comment="human") [1] 1 # 1: , ‐1:
- 27. Bioconductor/GeneR 2 1’) REST NCBI chimpanzee Rhodopsin > x <‐ " " > s <‐placeString(x) 2’) CDS R CDS > writeFasta(file=“rhodopsin.txt”, from = , to= , comment= "chimpanzee", append=T) #append=T 1’’) REST NCBI macaque Rhodopsion > x <‐ " " > s <‐placeString(x) 2’’) CDS R CDS > writeFasta(file=“rhodopsin.txt”, from = , to= , comment= "macaque", append=T) Users/tg03/bin rhodopsin.txt Seq_R_96_1142
- 28. Clustalw 3) ClustalW mulople alignment $ export PATH=/Users/tg03/bin/clustalw‐2.0.12‐macosx $ cd /Users/tg03/bin/clustalw‐2.0.12‐macosx $mv ~/bin/rhodopsin.txt ~/bin/clustalw‐2.0.12‐macosx $ clustalw2 ‐INFILE=rhodopsin.txt ‐OUTFILE=rho.aln rho.aln CotEditor / Courier Courier New 4) transioon transversion
- 29. Rhodopsin CDS(coding sequence) 1047bp transioon: A G, C T transversion: A,G C,T human – chimpanzee, human – macaque (NM_000539)‐(XM_516740) (NM_000539)‐(XM_001094250) transioon transversion transioon transversion p distance human‐ 5 1 6/1047 = 0.006 chimpanzee human‐ 32 8 40/1047 = 0.038 macaque 600 3000
- 30. 2 2 1 2 TCTGAGACCT TCTGTGACCT 5th A T 6th G C 3th T A 6th G C 6th G C 3th T A 9th C G 9th C G 5th A T 6th C G TCAGTGACCT TCTGTCACGT TCAGTGACCT TCTGTCACGT
- 31. 1) p distance: : , : 2) Jukes and Cantor model (1969): A T C G A ‐ α α α ( ) [ ( )] d = − 3 4 ln 1− 4 3 p T α ‐ α α G α α ‐ α 3) Kimura’s two parameter model (1980): C α α α ‐ transioon € transvesion A T C G ( )( P = 1 4 1− 2e−4 (α + β ) t + e−8 βt ) A ‐ β β α T β ‐ α Q= 1( 2)(1− e )−8 βt G β α ‐ β d ≡ 2rt = 2αt + 4 βt € C α β β ‐ € ( ) ( ) = − 1 2 ln(1− 2P − Q) − 1 4 ln(1− 2Q)
- 32. 1 ( a) a’,a” t t+1 a’ t t+1 T a’ T a’ T a’ (1‐r) (1‐r)2 a A G C T a a’’ 1‐2r (1‐r) T a” T a” T a” r 10‐8,10‐9 A G C r =3α r2 ( t T a’ T a’ (1‐r) ) a” :r C a” T a” r/3 2r(1‐r)/3 1‐r t A a’ T a’ r/3 2r/3 a’ :1/3 T a” T a” (1‐r)
- 33. 2 Jukes and Cantor model (1969): t t+1 qt qt+1 qt t qt+1‐qt dq/dt (d) 2rt d qt ( ) [ ( )] d = − 3 4 ln 1− 4 3 p pt=(1‐qt): p: (p distance) €
- 34. human, chimanzee, macaque Rhodopsin Jukes and Cantor model transioon transversion p distance JC distance human‐ 5 1 6/1047 = 0.006 chimpanzee human‐ 32 8 40/1047 = 0.038 macaque ( ) [ ( )] d = − 3 4 ln 1− 4 3 p 4 € > ‐(3/4)*log(1‐(4/3)*0.006)
- 35. R (transioon/transversion )