Explain exploratory factor analysis and give real life examplesS.pdf

•

0 likes•2 views

Explain exploratory factor analysis and give real life examples Solution In multivariate statistics, exploratory factor analysis (EFA) is a statistical method used to uncover the underlying structure of a relatively large set of variables. EFA is a technique within factor analysis whose overarching goal is to identify the underlying relationships between measured variables.[1] It is commonly used by researchers when developing a scale (a scale is a collection of questions used to measure a particular research topic) and serves to identify a set of latent constructs underlying a battery of measured variables.[2] It should be used when the researcher has no a priori hypothesis about factors or patterns of measured variables.[3]Measured variables are any one of several attributes of people that may be observed and measured. An example of a measured variable would be the physical height of a human being. Researchers must carefully consider the number of measured variables to include in the analysis.[2] EFA procedures are more accurate when each factor is represented by multiple measured variables in the analysis. Following is the set of EFA examples, . • 4.1: Exploratory factor analysis with continuous factor indicators • 4.2: Exploratory factor analysis with categorical factor indicators • 4.3: Exploratory factor analysis with continuous, censored, categorical, and count factor indicators* • 4.4: Exploratory factor mixture analysis with continuous latent class indicators • 4.5: Two-level exploratory factor analysis with continuous factor indicators • 4.6: Two-level exploratory factor analysis with both individual- and cluster-level factor indicators • 4.7: Bi-factor exploratory factor analysis with continuous factor indicators * Example uses numerical integration in the estimation of the model. This can be computationally demanding depending on the size of the problem..

Education

Similar to Explain exploratory factor analysis and give real life examplesS.pdf

Quantitative Research

Christian Ronel Austria

Seminario

Diana Ashandy Pool Antonio

Solving research problem_3539ce35db1215c11a780b1712d47e46

Kæsy Chaudhari

Topic 1 introduction to quantitative research

Audrey Antee

Analysis of data (pratik)

Patel Parth

Aishwarya.ppt

Aishwariya32

ANALYZING DATA BY BY SELLIGER AND SHAOAMY (1989)

Lenis Beatriz Marquez Vidal

Research is a systematic and scientific method of finding solutions by obtaining various types of data and systematic analysis of the multiple aspects of the issues related. The techniques or the specific procedure which helps to identify, choose, process, and analyze information about a subject is called Research Methodology Experimental design is a statistical tool for improving product design and solving production problems.

Biostatistics and Research Methodology Semester 8

ParulSharma130721

business-research.ppt

KaneezElahi

Thirupathi.ppt

preethi483339

Chapter 10-DATA ANALYSIS & PRESENTATION

Ludy Mae Nalzaro,BSM,BSN,MN

Factor analysis (1)

CVA170032STUDENT

4793325

Amit Pandey

factor analysis (basics) for research .ppt

MsHumaJaved

business-research

Mbabba2

Introduction to Statistics

jasondroesch

Quantitative Research

syerencs

Factor analysis

Vinaykar Thakur

Quantitative research design

Islamic Azad University (IAU)- دانشگاه آزاد اسلامی

Kinds of Quantitative Research.pptx

DanCyrelSumampong2

Similar to Explain exploratory factor analysis and give real life examplesS.pdf (20)

Quantitative Research

Seminario

Solving research problem_3539ce35db1215c11a780b1712d47e46

Topic 1 introduction to quantitative research

Analysis of data (pratik)

Aishwarya.ppt

ANALYZING DATA BY BY SELLIGER AND SHAOAMY (1989)

Biostatistics and Research Methodology Semester 8

business-research.ppt

Thirupathi.ppt

Chapter 10-DATA ANALYSIS & PRESENTATION

Factor analysis (1)

4793325

factor analysis (basics) for research .ppt

business-research

Introduction to Statistics

Quantitative Research

Factor analysis

Quantitative research design

Kinds of Quantitative Research.pptx

More from mckenziecast21211

In a comparison of ectotherms and endotherms, which of the following are correct? 1. Endotherms are regulators while ectotherms are conformers 2. Endotherms have higher energetic demands compared to ectotherms. 3. Endotherms spend more energy on internal temperature regulation compared to ectotherms. 4. Endothermy is more common among animal phyla than ectothermy. 5. At the cellular level, endotherms cells always produce more ATP and more heat. Solution 1.correct Regulator A regulator is also known as an endotherm. A regulator uses internal control mechanisms to maintain the optimum temperature needed for its body to function. Mammals and birds are examples of regulators. They are often described as warm blooded because they maintain a constant body temperature. For example, if the climate around a regulator gets hotter, the animal can adjust its metabolism to lessen the need for heat production. Conformer (or ectotherm) A conformer is also called an ectotherm. A conformer cannot regulate its own internal temperature so it must adapt its behavior, physically moving itself to environments with optimum temperatures. Reptiles, amphibians and insects are all conformers and are often referred to as cold blooded. For example, a lizard may lie on a rock in the sun to raise its body temperature, as it cannot regulate it internally. 2.not correct Endotherms also called warm blooded animals have the ability to regulate their body temperature by themselves. If the endotherms are in a cold place their body increases the metabolism and generates more heat. This will compensate for the cold outside. In a hot region the body metabolism is tuned down (this is not as efficient as the adaptation to cold region - as the metabolism can\'t be turned down below a certain limit - this will result in death) a little and heat generation is somewhat reduced. The second and more efficient mechanism is the heat dissipation by sweating and through skin (directly). Ectotherms on the other hand, do not have efficient temperature regulation systems. In warm regions when the temperature is high, the ectotherms seek shade and low-temperature areas to prevent over-heating In cool regions they seek sunlight and expose themselves to the sunlight for warmth. For the same reason, they can also search out and stay near fire pits, campfires etc... So when we calculate the energy demands, the ectotherms need more energy as they regulate their own metabolisms to match the need. 3.correct previously explaine 4.not correct,ectother ectothermy is more common then endothermy 5.correct.

In a comparison of ectotherms and endotherms, which of the following.pdf

mckenziecast21211

Implement Breadth-First Search with a Queue Solution // Program to print BFS traversal from a given source vertex. BFS(int s) // traverses vertices reachable from s. #include #include using namespace std; // This class represents a directed graph using adjacency list representation class Graph { int V; // No. of vertices list *adj; // Pointer to an array containing adjacency lists public: Graph(int V); // Constructor void addEdge(int v, int w); // function to add an edge to graph void BFS(int s); // prints BFS traversal from a given source s }; Graph::Graph(int V) { this->V = V; adj = new list[V]; } void Graph::addEdge(int v, int w) { adj[v].push_back(w); // Add w to v’s list. } void Graph::BFS(int s) { // Mark all the vertices as not visited bool *visited = new bool[V]; for(int i = 0; i < V; i++) visited[i] = false; // Create a queue for BFS list queue; // Mark the current node as visited and enqueue it visited[s] = true; queue.push_back(s); // \'i\' will be used to get all adjacent vertices of a vertex list::iterator i; while(!queue.empty()) { // Dequeue a vertex from queue and print it s = queue.front(); cout << s << \" \"; queue.pop_front(); // Get all adjacent vertices of the dequeued vertex s // If a adjacent has not been visited, then mark it visited // and enqueue it for(i = adj[s].begin(); i != adj[s].end(); ++i) { if(!visited[*i]) { visited[*i] = true; queue.push_back(*i); } } } } // Driver program to test methods of graph class int main() { // Create a graph given in the above diagram Graph g(4); g.addEdge(0, 1); g.addEdge(0, 2); g.addEdge(1, 2); g.addEdge(2, 0); g.addEdge(2, 3); g.addEdge(3, 3); cout << \"Following is Breadth First Traversal \" << \"(starting from vertex 2) \ \"; g.BFS(2); return 0; } Output: // Program to print BFS traversal from a given source vertex. BFS(int s) // traverses vertices reachable from s. #include #include using namespace std; // This class represents a directed graph using adjacency list representation class Graph { int V; // No. of vertices list *adj; // Pointer to an array containing adjacency lists public: Graph(int V); // Constructor void addEdge(int v, int w); // function to add an edge to graph void BFS(int s); // prints BFS traversal from a given source s }; Graph::Graph(int V) { this->V = V; adj = new list[V]; } void Graph::addEdge(int v, int w) { adj[v].push_back(w); // Add w to v’s list. } void Graph::BFS(int s) { // Mark all the vertices as not visited bool *visited = new bool[V]; for(int i = 0; i < V; i++) visited[i] = false; // Create a queue for BFS list queue; // Mark the current node as visited and enqueue it visited[s] = true; queue.push_back(s); // \'i\' will be used to get all adjacent vertices of a vertex list::iterator i; while(!queue.empty()) { // Dequeue a vertex from queue and print it s = queue.front(); cout << s << \" \"; queue.pop_front(); // Get all adjacent vertices of the dequeued vertex s // If a adjacent has not been visited, then mark it visited // and enqueue it fo.

Implement Breadth-First Search with a QueueSolution Program .pdf

mckenziecast21211

Immunology: what are TdT and AID, and what are their roles in B cells? How does this relate to CDRs? Immunology: what are TdT and AID, and what are their roles in B cells? How does this relate to CDRs? Solution Answer-TdT stands for terminal deoxynucleotidel transferase.i t is a special kind of DNA polymerase expressed immature pre B and pre T lymphocytes.Unlike other DNA polymerase TdT has a unusual function to synthesize DNA without using template DNA. AID-AID stands for activation induced cytidine deaminase.i T is a 24kDa enzyme in human which is responsible for antibody diversity.d ye to its deamination activity it deaminase it causes mutation in DNA by deamination of cytosine to uracil and thus change base pairs G-C to U-Aor T-A due to these mutation in germinal center of B lymphocytes antibody diversity produces. Role of TdT and AID in B cells-Bcells are immune cell that produces antibody with the binding sites for antigen. Different types of antibodies produced by B cell which give immunity to different type of antigens.These antibody diversity occure due to VDJ recombination .In antibody producing pre B cells rearrangement of these variable(v), diversity (D), joining (J)gene segments allow B cells to generate antibody with different antigen binding sites with antibody specificity.For breaking,arranging and rejoining these gene segments district classes of enzymes like nuclease ,ligase and polymerase work.S specific kind of polymerase used for these gene recombination known as TdT. RAG enzyme cut- the double standard DNA which contains genes .and the hairpin structure left is open by Artemis complex which has endonuclease activity.once Artemis complex open hairpin and add palindromic sequence in DNA cut end TdT start working on 3\'OH end of DNA and add nucleotide to single stranded DNA in 5\'to3\' direction without using template.single stranded DNA formed at both the ends of non homologous segment joining done by Watson and Crick base pairing and unpaired bases are removed by exonuclease ,gap is filled by template dependent polymerase and Nick is sealed by ligase.in this way due to the recombination of antibody diversity producing gene pre B cells produces diffrent type of antibody specific to different type of antigen. AID produces mutation in B cells during germinal center development by deamination of cytosine that produces antibody diversity. CD-R are the part of variable chain in immunoglobulin generated by B cells and T cell receptor.tdt and AID helps to crate these sites on antibody and create antibody diversity..

Immunology what are TdT and AID, and what are their roles in B c.pdf

mckenziecast21211

\"IDS in the Cloud\" Please respond to the following: (a) Explain whether or not you believe technologies such as IDS are still relevant and useful as there is a push toward SaaS and cloud-based solutions. (b) Discuss from your perspective how cloud-based services change incident response, for better or worse, and determine what you believe to be the greatest preparedness concern with cloud- based services. PLEASE NO COPY AND PASTING Solution (a) IDS - Intrusion Detection systems To prevent threat over once computer security firewall and encryption techniques were invented. Although, the intruders could still hack one\'s system. To prevent this, Intrusion detection systems were introduced which provide the following advantages: 1.Continuously monitors and analyzes the activities of the user and system. 2.Uses pattern recognition for recognizing typical kinds of attacks. 3.Tracks user policy violations. 3. Recognizes abnormal activities through pattern recognition. SaaS: Software as a Service 1.SaaS is a model for Software licensing and delivery which is hosted on internet on subscription basis and made available for the internet users. 2. It is one of the categories of cloud computing, where in instead of simply installing and maintaining software you keep it over the internet which is easily maintainable from complex software management. Intrusion detection systems are still relevant to protect one\'s private data although Cloud computing exists. (b) Security and Incident response is a major subject which many vendors try to overcome. At high level, the process defines six stages of incident response : Preparation,identification,containment,eradication,recovery,lessons learned. Five challenges or risks or concerns faced with cloud computing: 1.Privacy and Security. 2.Cloud transition. 3.Data access 4.Service quality 5.Data accessibility..

IDS in the Cloud Please respond to the following(a) Explain w.pdf

mckenziecast21211

Gandalf the Grey started in the Forest of Mirkwood at a point with coordinates (-3, -1) and arrived in the Iron Hills at the point with coordinates (-1,3). If he began walking in the direction of the vector v = 5i + lj and changes direction only once, when he turns at a right angle, what are the coordinates of the point where he makes the turn. Solution Geometrically, the vector 5i + 1j corresponds to a slope of 1/5. So, at the right angle where Gandalf changes direction, the slope becomes -5. Let\'s write out the equations. Point (-3, -1), slope 1/5 => y + 1 = (1/5)(x + 3) or y = (1/5)(x + 3) - 1 or y = (1/5)(x - 2) Point (-1, 3), slope - 5 => y - 3 = (-5)(x + 1) or y = - 5x - 2. Now, we find the intersecting point of these two curves (1/5)(x - 2) = -5x - 2 ==> x = - 4/13 Substituting this into either equation yields y = - 6/13. So, the desired point is ( - 4/13, - 6/13)..

Gandalf the Grey started in the Forest of Mirkwood at a point with co.pdf

mckenziecast21211

Drag the labels to the correct category to demonstrate your understan.pdf

mckenziecast21211

Do you agree that the Berg Letter, research moratorium, and Asilomar Conference were necessary before further recombinant DNA research was conducted? Why or why not? Solution Paul Berg, an American biochemist and professor emeritus at Stanford University witnessed firsthand the history of recombinant DNA research and regulation, having been in the forefront of both movements since he was a young man. He gained early recognition and influence when he delineated the key steps in which DNA produces proteins. In the mid-1970s, the National Academy of Sciences asked Berg to explore the safety of recombinant DNA technology. He responded with the historic \"Berg letter,\" calling for a moratorium on recombinant DNA research until safety issues could be addressed. He was one of the key organizers of the international forum on recombinant DNA technology, the Asilomar Conference. The ensuing dialogue resulted in the National Institutes of Health guidelines published a year later, a milestone of responsible self-regulation in science. The Asilomar Conference on Recombinant DNA was an influential conference organized by Paul Berg to discuss the potential biohazards and regulation of biotechnology, held in February 1975 at a conference center at Asilomar State Beach.A group of about 140 professionals (primarily biologists, but also including lawyers and physicians) participated in the conference to draw up voluntary guidelines to ensure the safety of recombinant DNA technology. The conference also placed scientific research more into the public domain, and can be seen as applying a version of the precautionary principle. The effects of these guidelines are still being felt through the biotechnology industry and the participation of the general public in scientific discourse. Due to potential safety hazards, scientists worldwide had halted experiments using recombinant DNA technology, which entailed combining DNAs from different organisms. After the establishment of the guidelines during the conference, scientists continued with their research, which increased fundamental knowledge about biology and the public’s interest in biomedical research. During the conference, the principles guiding the recommendations for how to conduct experiments using this technology safely were established. The first principle for dealing with potential risks was that containment should be made an essential consideration in the experimental design. A second principle was that the effectiveness of the containment should match the estimated risk as closely as possible. The conference also suggested the use of biological barriers to limit the spread of recombinant DNA. Such biological barriers included fastidious bacterial hosts that were unable to survive in natural environments. Other barriers were nontransmissible and equally fastidious vectors (plasmids, bacteriophages, or other viruses) that were able to grow in only specified hosts. In addition to biological barriers, the co.

Do you agree that the Berg Letter, research moratorium, and Asilomar.pdf

mckenziecast21211

Brief Concepts and Questions EXAM 2 Chapter 8: DNA RNA Protein What is DNA? a phosphate Structure of DNA: Building blocks are called nucleotides Each nucleotide is composed of three br uithofenas bee. What makes DNA so special? Provide 4 reasons, below DNA DNA (Replication): Where does DNA replication take place? When does DNA replication take place? Explain steps involved in DNA replication: DNA RNA Protein (Gene Expression) Involves 2 processes: 1. Transcription 2. Translation Explain the Synthesis of Proteins (Gene Expression): o DNA RNA Protein What is RNA? What is \"codon What is \"anticodon\" What is a protein molecule? DNA mutation; Change in nucleotide bases of DNA Duplex Point mutation Frame shift mutation Solution Question Answer Where does DNA replication take place: It takes place in the nucleus in case of eukaryotic cells and in the cytoplasm in case of prokaryotic cells When does DNA replication take place: DNA replication occurs during the S-phase during cell cycle, so that cell can make an extra copy of genetic material. Explain steps involved in DNA replication: Initiation: During initiation, the proteins will bind to the origin of replication; helicase unwinds the DNA helix which results in the formation of two replication forks. Elongation: A RNA primer sequence will be added to this the DNA pol III will add the nucleotides in 5’ to 3’ direction and chain will elongate. Termination: In case of bacteria, termination of replication occurs whenever two replication forks meet each other from the opposite end of the parental chromosome. Transcription Gene expression first step is transcription, here a particular segment of DNA will be copied into RNA with the help of the enzyme RNA polymerase Translation Translation is the final step of the gene expression. Here mRNA will be used to synthesize the polypeptide chain. The information present in the mRNA in the form of codon will code for the amino acids needed for polypeptide chain synthesis. What is RNA? RNA is ribonucleic acid and is found in all living cells. It acts as the messenger carrying instructions from DNA for the synthesis of proteins. Few viruses will have RNA as their genetic material. What is codon? Codon is a sequence of three nucleotides and they together form a unit of genetic code in either DNA or RNA. What is anticodon? It is found on tRNA and it is a sequence of three nucleotides which forms a genetic code on tRNA, and these anticodon is complementary to the codons found on messenger RNA. What is a protein molecule? During translation, when amino acids are added in a sequential manner, the condensation of amino acids will form a peptide bond in between them and finally forms a polypeptide chain. It is the DNA through mRNA directs the protein synthesis. Point mutation In point mutation, only one or very few nucleotides will be affected or mutated in a gene sequence. Frame shift mutation Either insertions or deletion can result in frame shift mutation, due to th.

Brief Concepts and Questions EXAM 2 Chapter 8 DNA RNA Protein What i.pdf

mckenziecast21211

A population has two alleles for a particular gene, A and a, and is in Hardy-Weinberg equilibrium. The frequency of allele a is 0.2. What is the frequency of individuals with AA genotype? 0.2 0.4 0.64 0.04 0.8 Solution C). 0.64 Hardy and Weinberg mathematically proved that in a population, all dominant and recessive alleles comprise all alleles for that gene. This was mathematically represented as p+ q = 1.0 Where, p = frequency of dominant alleles q = frequency of recessive alleles. Given that, the frequency of a = 0.2 As the population is in H-W equilibrium, the frequency of A = 1-0.2 = 0.8 The frequency of AA genotype = 0.8*0.8 = 0.64.

A population has two alleles for a particular gene, A and a, and is .pdf

mckenziecast21211

A 12-year-old male complained of strange odors before loss of consciousness and a major tonic- clonic seizure. During the seizure, his parents rushed him to the emergency room of a local hospital. On arrival at the hospital, he appeared to be asleep. Studies at the hospital showed routine laboratory work within normal limits (WNL), lumbar puncture (CSF) was WNL, no evidence of skull fracture on x-ray study was revealed, and an electroencephalograph (EEG) showed no abnor malities. How would you interpret the episode and findings? Solution Charecterized by sudden loss of consciousness ,chaotic muscle movement and tone, and apnea Tonic phase:Bilateral muscle rigidity Clonic phase: muslce contraction and relaxation lasting 1 to 3 minutes Signs: Tachycardia, hyerpventilation,sweating, and intense salivation Last 3-5 minutes postictal state(5 to 20 mintues)follows -gradual return to consciousness.

A 12-year-old male complained of strange odors before loss of consci.pdf

mckenziecast21211

2.Which of the following statements about evolution is false?Nonrandom mating can change the genetic makeup of populations over time.Genetic drift can change the genetic makeup of populations over time.Natural selection is one of several mechanisms of evolution.Populations, not individuals, evolve.Evolution is goal-directed.2.Which of the following statements about evolution is false?Nonrandom mating can change the genetic makeup of populations over time.Genetic drift can change the genetic makeup of populations over time.Natural selection is one of several mechanisms of evolution.Populations, not individuals, evolve.Evolution is goal- directed. Solution Note:.

2.Which of the following statements about evolution is falseNonrand.pdf

mckenziecast21211

can someone explain in a easy way chromosome walking? I know it\'s with overlapping fragments and a gen nearby the gen you want to find, but I don\'t clearly understand it, I have images in my book, but an image with steps and explanation would be nice, Solution Chromosome Walking: Chromosome walking is positional cloning of gene sequences or upstream promoter sequences. Eukaryotic DNA contains a lot of junk DNA between the genes. The technique relies upon screening of gDNA library for overlapping fragments in a sequential manner to tap the upstream or downstream region. Procedure: 1. Isolation of Genomic DNA: First of all isolate genomic DNA (gDNA) of the test organism and then partially digest it with some restriction enzyme, say Hind III that would yield unequal random fragments. 2. Cloning of the Digested into E.coli: Clone the digested gDNA into a cloning vector (between the Hind III sites in this case) to prepare a gDNA library of the organism. Each colony of the library would have only one clone. 3. Preparation of marker probe: Prepare a radioactively labelled probe from the neighboring gene (say A), from where you want to start walking. 4. Colony Hybridization: Hybridize the probe with your gDNA library. The probe would show the signal in the colonies carrying DNA in and around your gene. 5. Sequencing: Pick the colonies showing the signal and isolate the plasmid DNA and sequence each using the plasmid-specific primers. You would get only one sequence per bacterial colony of your library. The sequence, thus obtained must be analyzed. Select longer sequences towards the direction of your walk. 6. Preparation of the probe: Prepare new probes from the region towards your target gene. 7. Repeat the steps 4-6 till you get the clone and sequence of your target gene..

can someone explain in a easy way chromosome walking I know its w.pdf

mckenziecast21211

9. When a bacteriophage inserts its DNA into a bacterial chromosome,.pdf

mckenziecast21211

Write an informal negation for each of the following statements. Be careful to avoid negations that are ambiguous. a. All dogs are friendly. b. All people are happy. c. Some suspicions were substantiated. d. Some estimates are accurate. Solution (a) these is a dog which is not friendly (b) Some people are not happy (c) these was a ssuspicions which was not substantiated (d) these is some estimates which are wrong.

Write an informal negation for each of the following statements. Be .pdf

mckenziecast21211

Write a C++ program which generates and displays a random walk across a grid. A 2- dimensional array of characters will be used for this grid. The cells visited by the walk will be labeled by capital letters with A being the first cell, B the cell moved to from A, and so on, ending either when Z is reached or when it is not possible to move to another cell. The following libraries, constant definition, and type definition are needed in the program: #include #include // for srand and rand #include // for time using namespace std; const int SIZE = 10; typedef char Grid[SIZE][SIZE] The grid must be set to have all its elements be the character ’.’ before the walk is begun. The program must contain the following function prototypes, the main function, and the function definitions for all the other functions: // Function prototypes bool can_move_up(int i, int j, Grid walk); bool can_move_down(int i, int j, Grid walk); bool can_move_left(int i, int j, Grid walk); bool can_move_right(int i, int j, Grid walk); void init_array(Grid walk); void generate_random_walk(Grid walk); void print_array(Grid walk); int main(void) { Grid walk; // the grid in which the random walk occurs srand((unsigned) time(NULL)); init_array(walk); generate_random_walk(walk); print_array(walk); return 0; } The four functions can_move _* must return whether or not it is possible to move in the particular direction in the grid. For example, a function call like if (can_move_up(i, j, walk)) could be used to determine whether or not it is possible to move up. The rule for a move being possible is that if it doesn’t go outside of the grid and isn’t already part of the walk, then that move is possible. The function init_array must set all characters in the grid to ’.’ The function generate_random_walk must modify the cells of grid by changing ones that are part of the walk to letters. The function print_array must print the resulting grid in the form shown in the sample run below. In the function generate_random_walk, at each step of the walk, randomly select one of the 4 directions and try to move in that direction. If that move isn’t available, try the other moves in turn until one is possible. If all 4 directions are blocked, the walk must terminate, and the program must continue and print out the walk. To select one of the 4 directions randomly, use the expression: rand() % 4 The function rand returns an integer, and finding the remainder of this integer divided by 4 results in getting one of the numbers 0, 1, 2, or 3. Use these 4 numbers to represent the 4 directions up, down, left and right. The call to the function srand from the main function seeds the pseudo-random number generator used by rand so that different sequences of numbers will be generated by calls to rand each time the program is run. Solution #include //input output functions in C++ #include //rand() and srand() functions #include //time() function for creating seed #include #include // for srand and rand #inclu.

Write a C++ program which generates and displays a random walk acros.pdf

mckenziecast21211

true or false1- The grouped frequency table should ideally have.pdf

mckenziecast21211

Answer the questions that follow the VHDL code given below. LIBRARY ieee; USE ieee.std_logic_1164.ALL; ENTITY ex1_IS PORT (n, cp, n rd: IN st_logic; q: BUFFER integer RANGE 0 TO 15); END ex1; ARCHITECTURE are OF ex1 IS BEGIN PROCESS (n_cp, n_rd) BEGIN IF (n_rd = \'0\') THEN q Solution a)n_rd- used to reset the counter n_cp-used as clock to the counter b)4 binary bits are there in q; Q stores 0 t0 15 number so log2(16)=4.

Answer the questions that follow the VHDL code given below. LIBRARY .pdf

mckenziecast21211

The weak D phenotype is thought to arise from several mechanisms. Which one of the following statements is false? C gene is in trans position to D gene, this results in a weakening influence on the D gene, examples CDe/Cde and cDe/Cde. Weak D antigen is genetically transmitted. This can occur rarely in R1 and R2 genotypes in caucasians. Also occurs in the Ro genotype in certain racial groups more commonly. The D antigen consists of multiple pieces (is a mosaic). Occasionally one or more of these pieces is missing. The red cells are said to have a partial D. D deletion genes gives rise to weakened expression of D antigen. Rh null cells lack: MNSs antigens. Lewis antigens. Normal oxygen-carrying capacity. Rh antigens. There are two closely related and closely linked genes. Enzyme techniques, in conjunction with an IgM anti-D. Increasing the time for the incubation of the saline phase. Performance of an IAT using an IgG anti-D. Don\'t need to do it in a blood bank. C gene is in trans position to D gene, this results in a weakening influence on the D gene, examples CDe/Cde and cDe/Cde. Weak D antigen is genetically transmitted. This can occur rarely in R1 and R2 genotypes in caucasians. Also occurs in the Ro genotype in certain racial groups more commonly. The D antigen consists of multiple pieces (is a mosaic). Occasionally one or more of these pieces is missing. The red cells are said to have a partial D. D deletion genes gives rise to weakened expression of D antigen. Solution The weak D phenotype is thought to arise from several mechanisms. Which one of the following statements is false? D deletion genes gives rise to weakened expression of D antigen. Rh null cells lack: Rh antigens. There are two closely related and closely linked genes. Enzyme techniques, in conjunction with an IgM anti-D. Increasing the time for the incubation of the saline phase. Performance of an IAT using an IgG anti-D. Don\'t need to do it in a blood bank. Last one is an incomplete question D deletion genes gives rise to weakened expression of D antigen..

The weak D phenotype is thought to arise from several mechanisms. .pdf

mckenziecast21211

The coding region of a BACTERIAL gene has the following sequence: \"AGAGCCAACATGTCGAGCATATGCTGATATACG\' Draw and label the DNA (including ALLEABIS of the gene, sequence information) The info you need is in the sides. Label the template/coding strands Label 5\' and 3\' ends of each DNA strand Label where RNA polymerase binds \"Transcribe\" this gene into mRNA, as shown in Bb video. Write the mRNA nucleotide sequence, starting at the correct nucleotide, starting at the correct nucleotide Show the 5\' and 3\' ends of the RNA. Use the codon chart to \"translate\" the mRNA into a protein, and write the correct amino acid sequence of the protein. Only translate the part of the gene that a cell would translate. Label the N-terminus and C-terminus of the protein. If the sequence of the gene were changed to: AGACCCAACATGTCGGACATATGCTGATATACG what would happen to the properties of the protein? Explain why write out the entire process of bacterial transcription step by step in the correct order, in detail. Solution 4. Process of Bacterial Transcription: Bacterial transcription is the process in which mRNA transcripts of genetic material in bacteria are produced; it is further translated to produce proteins. Unlike in eukaryotes, bacterial transcription and translation can occur simultaneously in the cytoplasm. RNA polymerases are enzymes that transcribe DNA into RNA. Using a DNA template, RNA polymerase builds a new RNA molecule through base pairing. For instance, if there is a G in the DNA template, RNA polymerase will add a C to the new, growing RNA strand. Three steps are involved in bacterial transcription: Initiation: To begin transcribing a gene, RNA polymerase binds to the DNA of the gene at a region called the promoter. Basically, the promoter tells the polymerase where to locate on the DNA and begin transcribing. Elongation: Once RNA polymerase is in position at the promoter, the next step of transcription—elongation—can begin. Basically, elongation is the stage when the RNA strand gets longer, thanks to the addition of new nucleotides. During elongation, RNA polymerase \"walks\" along one strand of DNA, known as the template strand, in the 3\' to 5\' direction. For each nucleotide in the template, RNA polymerase adds a matching (complementary) RNA nucleotide to the 3\' end of the RNA strand. Termination: RNA polymerase will keep transcribing until it gets signals to stop. The process of ending transcription is called termination, and it happens once the polymerase transcribes a sequence of DNA known as a terminator. There are two major termination strategies found in bacteria: Rho-dependent and Rho- independent. In Rho-dependent termination, the RNA contains a binding site for a protein called Rho factor. Rho factor binds to this sequence and starts \"climbing\" up the transcript towards RNA polymerase. When it catches up with the polymerase at the transcription bubble, Rho pulls the RNA transcript and the template DNA strand apart, releasing .

The coding region of a BACTERIAL gene has the following sequence A.pdf

mckenziecast21211

Regarding the ABO blood group system in humans, if an individual is genetically I^B i and yet expresses the O blood type, which genotype is he or she likely to have? Hh HH hh i^A i i^B i none of the above are correct. Solution Option C is the correct answer. This hh is also known as Bombay blood group. These individuals do not express H antigen. Thus these individuals are unable to form either of A or B antigen on their RBCs. Usual test of these individuals for blood group shows them as having O blood group..

Regarding the ABO blood group system in humans, if an individual is g.pdf

mckenziecast21211

More from mckenziecast21211 (20)