Drag the labels to the correct category to demonstrate your understan.pdf

•

0 likes•2 views

Drag the labels to the correct category to demonstrate your understanding of cell walls in different types of microbes. Protozoans Helminths Bacteria Fungi Solution Protozoans- These are classified under kingdom Protist. Helminths-These are classified under kingdom animalia. Fungi-These are classified under kingdom fungi. Bacteria- Prokaryotes..

Education

More from mckenziecast21211

A population has two alleles for a particular gene, A and a, and is in Hardy-Weinberg equilibrium. The frequency of allele a is 0.2. What is the frequency of individuals with AA genotype? 0.2 0.4 0.64 0.04 0.8 Solution C). 0.64 Hardy and Weinberg mathematically proved that in a population, all dominant and recessive alleles comprise all alleles for that gene. This was mathematically represented as p+ q = 1.0 Where, p = frequency of dominant alleles q = frequency of recessive alleles. Given that, the frequency of a = 0.2 As the population is in H-W equilibrium, the frequency of A = 1-0.2 = 0.8 The frequency of AA genotype = 0.8*0.8 = 0.64.

A population has two alleles for a particular gene, A and a, and is .pdf

mckenziecast21211

A 12-year-old male complained of strange odors before loss of consciousness and a major tonic- clonic seizure. During the seizure, his parents rushed him to the emergency room of a local hospital. On arrival at the hospital, he appeared to be asleep. Studies at the hospital showed routine laboratory work within normal limits (WNL), lumbar puncture (CSF) was WNL, no evidence of skull fracture on x-ray study was revealed, and an electroencephalograph (EEG) showed no abnor malities. How would you interpret the episode and findings? Solution Charecterized by sudden loss of consciousness ,chaotic muscle movement and tone, and apnea Tonic phase:Bilateral muscle rigidity Clonic phase: muslce contraction and relaxation lasting 1 to 3 minutes Signs: Tachycardia, hyerpventilation,sweating, and intense salivation Last 3-5 minutes postictal state(5 to 20 mintues)follows -gradual return to consciousness.

A 12-year-old male complained of strange odors before loss of consci.pdf

mckenziecast21211

2.Which of the following statements about evolution is false?Nonrandom mating can change the genetic makeup of populations over time.Genetic drift can change the genetic makeup of populations over time.Natural selection is one of several mechanisms of evolution.Populations, not individuals, evolve.Evolution is goal-directed.2.Which of the following statements about evolution is false?Nonrandom mating can change the genetic makeup of populations over time.Genetic drift can change the genetic makeup of populations over time.Natural selection is one of several mechanisms of evolution.Populations, not individuals, evolve.Evolution is goal- directed. Solution Note:.

2.Which of the following statements about evolution is falseNonrand.pdf

mckenziecast21211

can someone explain in a easy way chromosome walking? I know it\'s with overlapping fragments and a gen nearby the gen you want to find, but I don\'t clearly understand it, I have images in my book, but an image with steps and explanation would be nice, Solution Chromosome Walking: Chromosome walking is positional cloning of gene sequences or upstream promoter sequences. Eukaryotic DNA contains a lot of junk DNA between the genes. The technique relies upon screening of gDNA library for overlapping fragments in a sequential manner to tap the upstream or downstream region. Procedure: 1. Isolation of Genomic DNA: First of all isolate genomic DNA (gDNA) of the test organism and then partially digest it with some restriction enzyme, say Hind III that would yield unequal random fragments. 2. Cloning of the Digested into E.coli: Clone the digested gDNA into a cloning vector (between the Hind III sites in this case) to prepare a gDNA library of the organism. Each colony of the library would have only one clone. 3. Preparation of marker probe: Prepare a radioactively labelled probe from the neighboring gene (say A), from where you want to start walking. 4. Colony Hybridization: Hybridize the probe with your gDNA library. The probe would show the signal in the colonies carrying DNA in and around your gene. 5. Sequencing: Pick the colonies showing the signal and isolate the plasmid DNA and sequence each using the plasmid-specific primers. You would get only one sequence per bacterial colony of your library. The sequence, thus obtained must be analyzed. Select longer sequences towards the direction of your walk. 6. Preparation of the probe: Prepare new probes from the region towards your target gene. 7. Repeat the steps 4-6 till you get the clone and sequence of your target gene..

can someone explain in a easy way chromosome walking I know its w.pdf

mckenziecast21211

9. When a bacteriophage inserts its DNA into a bacterial chromosome,.pdf

mckenziecast21211

Write an informal negation for each of the following statements. Be careful to avoid negations that are ambiguous. a. All dogs are friendly. b. All people are happy. c. Some suspicions were substantiated. d. Some estimates are accurate. Solution (a) these is a dog which is not friendly (b) Some people are not happy (c) these was a ssuspicions which was not substantiated (d) these is some estimates which are wrong.

Write an informal negation for each of the following statements. Be .pdf

mckenziecast21211

Write a C++ program which generates and displays a random walk across a grid. A 2- dimensional array of characters will be used for this grid. The cells visited by the walk will be labeled by capital letters with A being the first cell, B the cell moved to from A, and so on, ending either when Z is reached or when it is not possible to move to another cell. The following libraries, constant definition, and type definition are needed in the program: #include #include // for srand and rand #include // for time using namespace std; const int SIZE = 10; typedef char Grid[SIZE][SIZE] The grid must be set to have all its elements be the character ’.’ before the walk is begun. The program must contain the following function prototypes, the main function, and the function definitions for all the other functions: // Function prototypes bool can_move_up(int i, int j, Grid walk); bool can_move_down(int i, int j, Grid walk); bool can_move_left(int i, int j, Grid walk); bool can_move_right(int i, int j, Grid walk); void init_array(Grid walk); void generate_random_walk(Grid walk); void print_array(Grid walk); int main(void) { Grid walk; // the grid in which the random walk occurs srand((unsigned) time(NULL)); init_array(walk); generate_random_walk(walk); print_array(walk); return 0; } The four functions can_move _* must return whether or not it is possible to move in the particular direction in the grid. For example, a function call like if (can_move_up(i, j, walk)) could be used to determine whether or not it is possible to move up. The rule for a move being possible is that if it doesn’t go outside of the grid and isn’t already part of the walk, then that move is possible. The function init_array must set all characters in the grid to ’.’ The function generate_random_walk must modify the cells of grid by changing ones that are part of the walk to letters. The function print_array must print the resulting grid in the form shown in the sample run below. In the function generate_random_walk, at each step of the walk, randomly select one of the 4 directions and try to move in that direction. If that move isn’t available, try the other moves in turn until one is possible. If all 4 directions are blocked, the walk must terminate, and the program must continue and print out the walk. To select one of the 4 directions randomly, use the expression: rand() % 4 The function rand returns an integer, and finding the remainder of this integer divided by 4 results in getting one of the numbers 0, 1, 2, or 3. Use these 4 numbers to represent the 4 directions up, down, left and right. The call to the function srand from the main function seeds the pseudo-random number generator used by rand so that different sequences of numbers will be generated by calls to rand each time the program is run. Solution #include //input output functions in C++ #include //rand() and srand() functions #include //time() function for creating seed #include #include // for srand and rand #inclu.

Write a C++ program which generates and displays a random walk acros.pdf

mckenziecast21211

true or false1- The grouped frequency table should ideally have.pdf

mckenziecast21211

Answer the questions that follow the VHDL code given below. LIBRARY ieee; USE ieee.std_logic_1164.ALL; ENTITY ex1_IS PORT (n, cp, n rd: IN st_logic; q: BUFFER integer RANGE 0 TO 15); END ex1; ARCHITECTURE are OF ex1 IS BEGIN PROCESS (n_cp, n_rd) BEGIN IF (n_rd = \'0\') THEN q Solution a)n_rd- used to reset the counter n_cp-used as clock to the counter b)4 binary bits are there in q; Q stores 0 t0 15 number so log2(16)=4.

Answer the questions that follow the VHDL code given below. LIBRARY .pdf

mckenziecast21211

The weak D phenotype is thought to arise from several mechanisms. Which one of the following statements is false? C gene is in trans position to D gene, this results in a weakening influence on the D gene, examples CDe/Cde and cDe/Cde. Weak D antigen is genetically transmitted. This can occur rarely in R1 and R2 genotypes in caucasians. Also occurs in the Ro genotype in certain racial groups more commonly. The D antigen consists of multiple pieces (is a mosaic). Occasionally one or more of these pieces is missing. The red cells are said to have a partial D. D deletion genes gives rise to weakened expression of D antigen. Rh null cells lack: MNSs antigens. Lewis antigens. Normal oxygen-carrying capacity. Rh antigens. There are two closely related and closely linked genes. Enzyme techniques, in conjunction with an IgM anti-D. Increasing the time for the incubation of the saline phase. Performance of an IAT using an IgG anti-D. Don\'t need to do it in a blood bank. C gene is in trans position to D gene, this results in a weakening influence on the D gene, examples CDe/Cde and cDe/Cde. Weak D antigen is genetically transmitted. This can occur rarely in R1 and R2 genotypes in caucasians. Also occurs in the Ro genotype in certain racial groups more commonly. The D antigen consists of multiple pieces (is a mosaic). Occasionally one or more of these pieces is missing. The red cells are said to have a partial D. D deletion genes gives rise to weakened expression of D antigen. Solution The weak D phenotype is thought to arise from several mechanisms. Which one of the following statements is false? D deletion genes gives rise to weakened expression of D antigen. Rh null cells lack: Rh antigens. There are two closely related and closely linked genes. Enzyme techniques, in conjunction with an IgM anti-D. Increasing the time for the incubation of the saline phase. Performance of an IAT using an IgG anti-D. Don\'t need to do it in a blood bank. Last one is an incomplete question D deletion genes gives rise to weakened expression of D antigen..

The weak D phenotype is thought to arise from several mechanisms. .pdf

mckenziecast21211

The coding region of a BACTERIAL gene has the following sequence: \"AGAGCCAACATGTCGAGCATATGCTGATATACG\' Draw and label the DNA (including ALLEABIS of the gene, sequence information) The info you need is in the sides. Label the template/coding strands Label 5\' and 3\' ends of each DNA strand Label where RNA polymerase binds \"Transcribe\" this gene into mRNA, as shown in Bb video. Write the mRNA nucleotide sequence, starting at the correct nucleotide, starting at the correct nucleotide Show the 5\' and 3\' ends of the RNA. Use the codon chart to \"translate\" the mRNA into a protein, and write the correct amino acid sequence of the protein. Only translate the part of the gene that a cell would translate. Label the N-terminus and C-terminus of the protein. If the sequence of the gene were changed to: AGACCCAACATGTCGGACATATGCTGATATACG what would happen to the properties of the protein? Explain why write out the entire process of bacterial transcription step by step in the correct order, in detail. Solution 4. Process of Bacterial Transcription: Bacterial transcription is the process in which mRNA transcripts of genetic material in bacteria are produced; it is further translated to produce proteins. Unlike in eukaryotes, bacterial transcription and translation can occur simultaneously in the cytoplasm. RNA polymerases are enzymes that transcribe DNA into RNA. Using a DNA template, RNA polymerase builds a new RNA molecule through base pairing. For instance, if there is a G in the DNA template, RNA polymerase will add a C to the new, growing RNA strand. Three steps are involved in bacterial transcription: Initiation: To begin transcribing a gene, RNA polymerase binds to the DNA of the gene at a region called the promoter. Basically, the promoter tells the polymerase where to locate on the DNA and begin transcribing. Elongation: Once RNA polymerase is in position at the promoter, the next step of transcription—elongation—can begin. Basically, elongation is the stage when the RNA strand gets longer, thanks to the addition of new nucleotides. During elongation, RNA polymerase \"walks\" along one strand of DNA, known as the template strand, in the 3\' to 5\' direction. For each nucleotide in the template, RNA polymerase adds a matching (complementary) RNA nucleotide to the 3\' end of the RNA strand. Termination: RNA polymerase will keep transcribing until it gets signals to stop. The process of ending transcription is called termination, and it happens once the polymerase transcribes a sequence of DNA known as a terminator. There are two major termination strategies found in bacteria: Rho-dependent and Rho- independent. In Rho-dependent termination, the RNA contains a binding site for a protein called Rho factor. Rho factor binds to this sequence and starts \"climbing\" up the transcript towards RNA polymerase. When it catches up with the polymerase at the transcription bubble, Rho pulls the RNA transcript and the template DNA strand apart, releasing .

The coding region of a BACTERIAL gene has the following sequence A.pdf

mckenziecast21211

Regarding the ABO blood group system in humans, if an individual is genetically I^B i and yet expresses the O blood type, which genotype is he or she likely to have? Hh HH hh i^A i i^B i none of the above are correct. Solution Option C is the correct answer. This hh is also known as Bombay blood group. These individuals do not express H antigen. Thus these individuals are unable to form either of A or B antigen on their RBCs. Usual test of these individuals for blood group shows them as having O blood group..

Regarding the ABO blood group system in humans, if an individual is g.pdf

mckenziecast21211

Peptidoglycan is a unique macromolecule found in cell walls of what k.pdf

mckenziecast21211

On this photo you see skull of Tasmanian Devil - now extinct only big.pdf

mckenziecast21211

Month Monthly Returns (%) Month Monthly Returns (%) Month Monthly Returns (%) Ended Yahoo Google S&P500 Ended Yahoo Google S&P500 Ended Yahoo Google S&P500 Dec-07 -13.241 -0.219 -0.692 Dec-06 -5.442 -5.018 1.403 Dec-05 -2.610 2.457 0.036 Nov-07 -13.794 -1.980 -4.182 Nov-06 2.544 1.767 1.899 Nov-05 8.818 8.806 3.778 Oct-07 15.861 24.632 1.590 Oct-06 4.193 18.534 3.257 Oct-05 9.249 17.595 -1.668 Sep-07 18.093 10.096 3.736 Sep-06 -12.314 6.174 2.575 Sep-05 1.561 10.650 0.810 Aug-07 -2.237 1.029 1.497 Aug-06 6.227 -2.087 2.376 Aug-05 -0.060 -0.612 -0.912 Jul-07 -14.302 -2.430 -3.097 Jul-06 -17.758 -7.805 0.616 Jul-05 -3.781 -2.172 3.717 Jun-07 -5.470 4.979 -1.660 Jun-06 4.463 12.778 0.133 Jun-05 -6.855 6.088 0.143 May-07 2.354 5.628 3.486 May-06 -3.630 -11.035 -2.875 May-05 7.826 26.032 3.179 Apr-07 -10.387 2.885 4.428 Apr-06 1.612 7.164 1.342 Apr-05 1.770 21.877 -1.896 Mar-07 1.393 1.938 1.116 Mar-06 0.624 7.551 1.244 Mar-05 5.051 -3.979 -1.769 Feb-07 9.007 -10.379 -1.950 Feb-06 -6.735 -16.188 0.271 Feb-05 -8.350 -3.900 2.103 Jan-07 10.846 8.908 1.511 Jan-06 -12.264 4.291 2.648 Jan-05 -6.555 1.468 -2.437 Question: (Use table above to solve) Segregate the return data in the above table into bull and bear markets, using the S&P 500 index as the proxy for the market. A.) What was the average return for the two companies during these two types of markets? What was the return for the S&P 500 index during those times? B.) Using the average return measures in a), compute the beta for Yahoo and Google. C.) According to these beta estimates, which company is riskier? Month Monthly Returns (%) Month Monthly Returns (%) Month Monthly Returns (%) Ended Yahoo Google S&P500 Ended Yahoo Google S&P500 Ended Yahoo Google S&P500 Dec-07 -13.241 -0.219 -0.692 Dec-06 -5.442 -5.018 1.403 Dec-05 -2.610 2.457 0.036 Nov-07 -13.794 -1.980 -4.182 Nov-06 2.544 1.767 1.899 Nov-05 8.818 8.806 3.778 Oct-07 15.861 24.632 1.590 Oct-06 4.193 18.534 3.257 Oct-05 9.249 17.595 -1.668 Sep-07 18.093 10.096 3.736 Sep-06 -12.314 6.174 2.575 Sep-05 1.561 10.650 0.810 Aug-07 -2.237 1.029 1.497 Aug-06 6.227 -2.087 2.376 Aug-05 -0.060 -0.612 -0.912 Jul-07 -14.302 -2.430 -3.097 Jul-06 -17.758 -7.805 0.616 Jul-05 -3.781 -2.172 3.717 Jun-07 -5.470 4.979 -1.660 Jun-06 4.463 12.778 0.133 Jun-05 -6.855 6.088 0.143 May-07 2.354 5.628 3.486 May-06 -3.630 -11.035 -2.875 May-05 7.826 26.032 3.179 Apr-07 -10.387 2.885 4.428 Apr-06 1.612 7.164 1.342 Apr-05 1.770 21.877 -1.896 Mar-07 1.393 1.938 1.116 Mar-06 0.624 7.551 1.244 Mar-05 5.051 -3.979 -1.769 Feb-07 9.007 -10.379 -1.950 Feb-06 -6.735 -16.188 0.271 Feb-05 -8.350 -3.900 2.103 Jan-07 10.846 8.908 1.511 Jan-06 -12.264 4.291 2.648 Jan-05 -6.555 1.468 -2.437 Solution According to Beta estimates Google is more risky than Yahoo because the beta is higher for google( 1.255) with Yahoo(0.987)ABCMonthMonthly Returns (%)Using excel Average return =AVERAGE(A1:A36)Using excel Average return =AVERAGE(B1:B36)Using excel Average return =AVERAGE(C1:C36)Beta of.

MonthMonthly Returns ()MonthMonthly Returns ()MonthMonth.pdf

mckenziecast21211

Many DOD components are accomplishing more training in the simulator instead of the aircraft due to limited financial resources and the benefit of reduced wear and tear on aging aircraft fleets. Commercial Airlines do much of their initial training and their recurring training in the simulator. Where do you stand on the premise of supplementing actual flight training with time in the simulator? Be sure to identify the positive and negative aspects of replacing actual flight time with simulator time. Please Cite Sources Solution Heads of the DoD Components shall establish procedures for transmission and transportation of classified information and information-bearing material that minimize risk of compromise while permitting use of the most cost-effective transmission or transportation means.COMSEC information shall be transmitted and transported in accordance with National Telecommunications and Information Systems Security Instruction 4001.NATO classified information shall be transmitted in compliance with USSAN Instruction 1-69. Except under rules established by the Secretary of Defense, or as provided by Section 102 of the National Security Act, classified information originating in a department or agency other than the Department of Defense shall not be disseminated outside the Department of Defense without the consent of the originating department or agency. When classified information is transmitted, it shall be enclosed in two opaque, sealed envelopes, wrappings, or containers, durable enough to properly protect the material from accidental exposure and facilitate detection of tampering. The following exceptions apply: (1) If the classified material is an internal component of a packageable item of equipment, the outside shell or body may be considered as the inner enclosure provided it does not reveal classified information. (2) If the classified material is an inaccessible internal component of a bulky item of equipment, the outside or body of the item may be considered to be a sufficient enclosure provided observation of it does not reveal classified information. (3). If the classified material is an item or equipment that is not reasonably packageable and the shell or body is classified, it shall be concealed with an opaque covering that will hide all classified features. (4) Specialized shipping containers, including closed cargo transporters, may be considered the outer wrapping or cover when used. (5) When classified material is hand-carried outside an activity, a locked briefcase may serve as the outer wrapper. In such cases, the addressing requirements of paragraph 7-201a., below, do not apply. (6) NATO Restricted material need not be double-wrapped when transmitted within the United States. The marking \"NATO Restricted\" shall not appear on the wrapper Classified material shall be prepared for shipment, packaged, and sealed in ways that minimize risk of accidental exposure or undetected deliberate compromise. Documents shoul.

Many DOD components are accomplishing more training in the simulator.pdf

mckenziecast21211

Match the numbered terms to the descriptions that follow. Choose all appropriate terms, but only appropriate terms. autotroph heterotroph phototroph chemotroph a prokaryote that obtains both energy and carbon as it decomposes dead organisms 1 only 4 only 1 and 3 2 and 4 1, 3, and 4 which of the following traits do archaea and bacteria share? composition of the cell wall presence of plasma membrane lack of a nuclear envelope identical rRNA sequences 1 only 3 only 1 and 3 2 and 3 2 and 4 Which prokaryotes should be expected to be most strongly resistant to plasmolysis in hypertonic environment? extreme halophiles extreme thermophiles methanogens cyanobacteria nitrogen-fixing bacteria that live in root nodules The group diplomonadida is characterized by a mouthlike gullet, and a hairlike surface: Paramecium is an example. flagella and a lack of mitochondria \"Gilardia is an example. nonmotility, parasitism and sporelike infective stages: Toxoplasma is an example. switching between autotrphic and heterotrphic lifestyles: Euglena is an example large protein deposites and movements by two falgella which a part of an undulating membrane: Trypanosoma is an example Plasmodium is transmitted to humans by the bite of mosquito (Anopheles) Its lifecycle is characterized by spores, gametes and cysts that can hide in human cells. This infective protist belongs to the group: Apicomplexa Oomycota Ciliophora Archaeplastida Dinoflagellata Solution Answer: 42). D). 2 and 4 Chemotrophs are organisms that obtain energy by the oxidation of electron donors in their environments. These molecules can be organic (chemoorganotrophs) or inorganic (chemolithotrophs). The chemotroph designation is in contrast to phototrophs, which utilize solar energy. 43). D). 2 and 3 Archaea and bacteria are both prokaryotes, meaning they do not have a nucleus and lack membrane-bound organelles. They are tiny, single-cell organisms called microbes, which cannot be seen by the naked human eye. 44). A) extreme halophiles 45). B). Flagella and a lack of mithochondria. Giardia is an example The diplomonads are a group of flagellates, most of which are parasitic. They include Giardia lamblia, which causes giardiasis in humans. They are placed among the metamonads, and appear to be particularly close relatives of the retortamonads. 46). A). Apicomplexa The Apicomplexa are a diverse group that includes organisms such as the coccidia, gregarines, piroplasms, haemogregarines, and plasmodia. Diseases caused by Apicomplexa include: Babesiosis (Babesia) Malaria (Plasmodium) Cryptosporidiosis (Cryptosporidium parvum).

Match the numbered terms to the descriptions that follow. Choose all .pdf

mckenziecast21211

Khaleesi Corporation leases dragonelass weapons to customers. She gains a loyal following of customers because dragonglass is of limited supply but high demand due to its usefulness for the upcoming winter. Further, Khaleesi tends to offer more favorable financing terms than competitors offering substitutive products (e.g., Lannister, LLC) Khaleesi was recently approached by the Lords of the North, Inc. (the North\") which is interested in leasing a substantial stock of weapons over a potentially lengthy geriod.of time. The North has indicated a willingness to pay any rate that Khaleesi Corporation demands for its dragcaglass products, but generally receives an interest rate of 12% on all other borrowing transactions. The North\'s management are a very noble group, so payments are reasonably assured. Further, there are no material cost ncertainties. Khaleesi has gathered its council to discuss entering into such a contract with the North and has invited you to provide financial council. Khaleesi\'s board has proposed several alternative sets of lease terms (below) and would like you determine what the North\'s annual payments will be under each scenario, if payments are made at the beginning of the period $489,450 Fair value of weapons to be leased Lease Ternm Useful Life of leased assets Lessee/Lessor interest rate Residual Value (guaranteed) 1. On the first tab of your Excel workbook, prepare a schedule for Khaleesi which uses Excel to $489,450 11 years 13 years 696 So $489,450 11 years 13 years 6% $24,350 years 13 years 896 $24,350 compute the North\'s necessary annual payment under each of the scenarios listed in the chart above. The schedule should list for each scenario above the desired present value of lease payments, future value of the leased asset, the lease term, and the interest rate and utilize an Excel formola to compute a payment (Hint: -PMT). Khaleesi is a high paying client of your firm, so the schedule should be extremely organized and professional looking (s.e, include a title, date, description in the top left- hand corner and utilize borders, font effects, etc. in cells to make the worksheet look visually appealing). On the second tab of the Excel workbook, prepare a lease amortization schedule describing the pattern of payments and interest over the lease term for both Khaleesi and the North. On the third tab of the Excel workbook, prepare the appropriate entries for both Khaleesi and the North on 1/1/18. Numbers in journal entries should be linked to the table prepared in number 3 above or computed using Excel formulas. On the fourth tab of the Excel workbook, prepare the appropriate entries for both Khaleesi and the North through 1/1/21. Numbers in journal entries should be linked to the table prepared in number 3 above or computed using Excel formulas 2. 3. 4. 5. On the fifth tab, prepare the appropriate entries for both Khaleesi and the North on 12/31/2028. Assume the weapons returned to Khaleesi have an actual resi.

Khaleesi Corporation leases dragonelass weapons to customers. She gai.pdf

mckenziecast21211

IOError: [Errno 2] No such file or directory: \'states.xml\' Any suggestions on how I can fix this? By the way, it\'s in Python. Any help will be appreciated! Solution There can be several reasons for the given error. 1) states.xml is not present on yur system to be read by the python code 2) states.xml file is present in your system but cannot be accessed by the python code. make sure you have give the correct path of file in the python code or place the file in same destination as the python code i.e The file may be existing but may have a different path. Try writing the absolute path for the file. When the file is properly read, it will be parsed using the parse function and the contents will be stored in tree.

IOError [Errno 2] No such file or directory states.xmlAny su.pdf

mckenziecast21211

In the degradation of maltose to two glucose moleculesA. the enzy.pdf

mckenziecast21211

More from mckenziecast21211 (20)