Huntingtons Disease, Mechanisms of Neuro degenration, Clinical Features, Natural History

1. Molecular Genetics Lab to the Neurology Clinic

2. Goals
• Increase understanding of the neuropathology and clinical
presentation of HD
• Review basic genetics
• Understand principles of management of HD patients
• Discuss HD research endeavors

3. Historical Aspects
1872 George Huntington, MD, described a
neurological disorder that later came to
bear his name
“….The hereditary chorea, as I shall call it, is
confined to certain and fortunately few
families and has been transmitted to them,
an heirloom from generations away back in
the dim past….”
“….There are three marked peculiarities of
this disease: 1 hereditary nature; 2.
tendency to insanity and suicide; 3.
manifesting itself as a grave disease in
adult life.”

4. Historical Aspects of HD
• 1955 Amerigo Negrette arrived as local physician in fishing
village outside of Maracaibo, Venezuela shocked to see many
of the villagers staggering around as if drunk with an illness
known locally as El Mal de San Vito, or St. Vito’s Dance. Dr.
Negrette realized that this was the same disease described by
Huntington (Huntington’s Chorea).
• 1972 Physicians and scientists from around the world
assembled in Ohio to discuss the rare disorder on the 100 th
anniversary of Dr. Huntington’s original paper. A movie of the
Venezuelan village filled with HD patients was shown, the
largest known population.

5. Nancy Wexler, PhD
• Hereditary Disease Foundation
• Led scientists and physicians to
Maracaibo, Venezuela since 1981 to
study families with HD; collected
blood/DNA samples from 4,000
individuals across 8 generations
• USA-Venezuela Collaborative
Huntington’s Project developed

6. • HD gene marker was discovered in 1983 at MGH (Gusella et al.)
and ultimately the gene itself discovered 1993 by the
Huntington’s Disease Collaborative Research Group.

7. Gross anatomy and pathology

8. Neuropathology of HD
•
HD involves atrophy and cell death of the basal ganglia, the complex
subcortical structures involved in control of motor movement, cognition
and sensory pathways.
•
Specifically, progressive and marked degeneration of caudate and
putamen (striatum).
•

9. Neuropathology
•
•
•
There are different types of
neurons and neurotransmitters
in striatum, and balanced
interaction between dopamine,
acetylcholine, and GABA play
vital role in regulating motor
movements.
.
Striatal gamma aminobutyric
acid (GABA-ergic) medium
spiny neurons are most
vulnerable to cell death in HD.
.
GABA normally has inhibitory
effect on thalamus and tells
cortex to ‘brake’ movement.

10. Neuropathology
•
Selective loss of these
specialized cells results in
decreased inhibition (i.e.,
increased activity) of the
thalamus.
•
Thalamus increases output to
certain regions of the cerebral
cortex. This may lead to the
disorganized, excessive
(hyperkinetic) movement
patterns of chorea.
•
As disease progresses,
damage to other pathways and
dopamine receptors cause
decreased stimulation to
cortex and thus rigid
bradykinetic features.

11. Degeneration of Basal Ganglia

12. MOLECULAR BIOLOGY

13. Genetics Review
•
Instructions providing all
information necessary for living
organism to grow and function
reside in the nucleus of cells.
•
These instructions come in form
of a complex molecule called
DNA (Deoxyribonucleic Acid).

15. Examples of Triplet (or Trinucleotide)
Repeat Diseases

16. Central dogma of biology
transcription
DNA
translation
RNA
PROTEIN
cellular
proteins
replication
amino acids,
peptides
degradation
(turnover)
cellular
proteins
folding,
assembly,
targeting
FUNCTIONAL
(NATIVE)
PROTEIN cellular
proteins
regulation of
conformation/
function

17. Cellular processes involving
non-native proteins: folding and assembly
• proteins are synthesized on the
ribosome and must fold/assemble
to become native
folding
assembly
- proteins are synthesized as
unfolded polypeptide chains
- folding occurs co-translationally
- folding (and assembly) to the
native state requires the complete
polypeptide chain

18. Cellular processes involving
non-native proteins: refolding
cellular stress
Native
protein
heat/cold
proteotoxic
chemicals
intracellular
changes
non-native
(unfolded)
protein
aggregated
protein
various cellular
proteins

19. Cellular processes involving
non-native proteins: degradation
unfolding proteolysis
Protein destined
for degradation
*
*
proteolysis
peptides
antigen
presentation
*steps involve various
cellular machineries
*
amino
acids

20. Cellular processes involving
non-native proteins: quality control
refolding
non-native
protein
refolding
Native
protein
Native
protein
unfolding
degradation
peptides,
amino
acids

21. Huntingtin Protein
• Cytoplasmic protein found in almost all tissues of the body and
brain
• Normal function is not well understood, yet implicated in cell
membrane recycling and neuroprotection.
• Huntingtin protein thought to play important role in early
development in mice models (where knockout of huntingtin gene
are embryonic lethal).
• Effects of HD suggest that huntingtin protein regularly interacts
with other proteins found only in brain, and that altered form of
huntingtin protein leads to nerve cell death in brain.

22. How much CAG expansion is too much?
•
People with 6 to about 35
copies of CAG have a normally
functioning form of the
huntingtin protein.
•
Expansion of 40 or more CAG
repeats is often full penetrance
and the person will develop HD.
•
For people who have 36 to 39
copies of CAG, the outcome is
less clear. Some will develop
the symptoms of Huntington's
disease and some will not.

23. Categories of CAG Repeat Sizes
26
27
35
36
39 40
…CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG…
Unaffected
“Mutable” Unaffected
“Reduced
Penetrance”
Affected
Repeat may be unstable when larger than 26 repeats

30. Genotype-Phenotype Correlations
•
There is a negative correlation between number of CAG repeats and
age of onset.
•
Individuals with adult onset HD usually have 35-55 CAG repeats.
•
Patients with very late onset tend to have repeats in 36-38 low
abnormal range.
•
Anticipation, a phenomenon in which increasing disease severity and
earlier onset is observed in successive generations, can occur in HD
and most often through paternal transmission (instability of CAG repeat
during spermatogenesis).
•
Individuals with CAG repeats 60+ often present with Juvenile HD.

31. Alleles
H = Huntington
h = Normal
Genotypes-Phenotypes
HH - Huntington
Hh - Huntington
hh - normal
Female
hh
eggs
h
h
Male
Hh
H
Hh
Hh
h
hh
hh
Offspring
sperm
Each child would
have a 50%
chance of having
Huntington
Disease

32. Imaging

33. Brain Imaging studies in HD:
Striatal degeneration and atrophy
• Caudate and putamen hypometabolism and volume loss begins
before symptom onset.
• Some evidence of patchy cortical thinning more prominent over
posterior cortical regions and proceeded to anterior cortical
regions with disease progression, and more prominent in left
striatum.
• Atrophy to thalamic subnuclei projecting to prefrontal areas,
substantia nigra, nuclei of hypothalamus, small regions of
hippocampus, Purkinje cells of cerebellum.

34. Clinical Features

35. Clinical Features of Huntington’s Disease
• Progressive neurodegenerative disorder characterized by
atrophy of basal ganglia causing triad of cognitive, motor and
psychiatric impairments. There is no cure for HD.
• Inherited autosomal dominant disorder with 50% chance of
inheriting mutant gene from affected parent.
• In western European and USA prevalence higher at about 7-10
per 100, 000) affected with >150,000 at risk. Lower in Asian and
African populations.

36. Clinical Features
• Typically adult onset disorder with mean age onset 35-44 years
(range 2 to 80 years).
• <20% first display symptoms of the disease after age 50 and
have a slower progression.
• <10% cases are juvenile HD with onset before age 20 years.
• Median survival after onset is 15-18 years (range 5-25 years)
with average age at death 54 years.

37. Motor Abnormalities: Early/Mid HD
•
Chorea = Abnormal, often rapid, involuntary, unpredictable movements
hallmark of the disease onset present in most adult cases.
•
Chorea appears as subtle to prominent uncontrolled jerking movements
of the limbs, trunk, face and oral motor structures.
•
Motor impersistence, the inability to maintain voluntary muscle
contraction at constant level.
•
Motor speed and coordination, fine motor control, postural
stability/balance and gait progressively worsen.
•
Abnormal oculomotor function including initiating ocular saccades, slow
scanning, and problems in gaze fixation.

38. Motor Abnormalities: Later Disease
•
Dystonia = Prolonged co-contractions of antagonistic muscle groups
causing slow, sustained movements and abnormal postures
•
Bradykinesia and rigidity often increases causing inability to move or
care for oneself.
•
Ocular motor disturbances may be seen in as much as 75% of
individuals.
•
Subgroup of adult-onset HD patients with more predominant dystonia
and rigidity, and paucity of chorea throughout course of disease
sometimes referred to ‘rigid-akinetic’ subtype.

39. Motor Speech Impairments:
Hyperkinetic Dysarthria of Speech
(Darley, Aronson, Brown 1969; Duffy 1995)
•
Oral mechanism exam often reveals normal structure, symmetry
of face, lips, tongue, jaw, palate.
•
Speech tasks such as conversation, oral reading, vowel
prolongation, are very useful to detect articulatory breakdown,
rate and prosody changes, phonatory-respiratory discoordination
•
Choreiform movements characterized by quick, unpatterned
involuntary head/neck, jaw, face, tongue, palate, pharyngeal,
laryngeal, and/or thoracic and abdominal movements at rest and
during movement
•
Dystonia or slower waxing/waning movements or postures of of
above speech mechanism substrates

40. Primary Hyperkinetic Dysarthria in HD
•
Articulation: Imprecise consonants, distortions and irregular
breakdowns
•
Phonation-Respiration: Sudden forced inhalation/exhalation, voice
stoppages, transient breathiness or strained-harsh (especially if
dystonia presentation) voice quality, excess pitch or loudness variation
•
Resonance: Intermittent hypernasality
•
Prosody: Prolonged phonemes, variable rate and stress patterns,
inappropriate silences, short phrases

41. Dysphagia: Common and Progressive
(Kagel and Leopold 1992)
• Hyperextension of head and trunk
• Lingual chorea and decreased ability to orally control bolus
• Rigidity of neck and/or mandible in bradykinetic subgroup
• Absent or inefficient chewing
• Intraoral retention and segmented bolus transfer
• Premature loss of control and bolus spillage into pharynx
• Swallow timing and coordination deficits

42. Swallowing impairments
•
Delayed swallow onset with advanced disease
•
Decreased pharyngeal contraction and clearance
•
Laryngeal penetration and aspiration
•
Unpredictable inhalation/ respiratory-swallow discoordination
•
Frequent belching (especially those with chorea)
•
Impaired cognition strongly impacts, ? Intra-oral sensory deficits
•
‘Tachyphagia’ or behavioral impulsivity very common increasing risks
for choking and airway obstruction

43. Nutrition:
•
Weight loss common in HD patients with chorea and this often in
context of increased appetite and eating (and increasing swallowing
problems).
•
Studies formally evaluating metabolism and energy expenditure reveal
that 24-hour resting energy expenditure up to 14% higher in HD
patients with chorea than in controls matched for age, sex and body
mass.
•
Loose correlation higher body weight with slower progression of adult
disease.
•
Our Neurologists recommend that HD patients be 10% above ideal
body weight.

44. Cognitive Impairments
•
Visuospatial (scanning and perceptual skills)
•
Executive Function: cognitive planning and sequencing, spatial
working memory, cognitive flexibility and shifting set
•
Memory: slowed learning rates, impaired delayed free recall which
improves significantly with cued recall/recognition, preserved retention
rates
•
Language: Word finding deficits, decreased phrase length and
syntactic complexity, decreased comprehension of complex information
•
Cognitive-communication impairments vary in onset and severity in
early-mid disease and progresses to dementia in advanced HD

45. Psychiatric Symptoms
• Can occur in any stage of disease and do not follow clear
progression (or relation to CAG repeat)
• May be present before motor symptoms and mistaken for other
primary psychiatric illnesses (such as schizophrenia, bipolar)
• Dysfunction of frontostriatal pathways implicated in psychiatric
symptoms

46. Psychiatric Manifestations
•
Depression
•
Aggressive Behavior
•
Apathy
•
Disinhibition
•
Irritability/Outbursts
•
Psychosis (3-12%)
•
Anxiety
•
Suicide (5.7 to 13% higher than
general population)
•
Impulsivity
•
Obsessive-compulsive disorder
(26-52%)

47. Juvenile HD (Westphal variant)
• Defined as onset of symptoms before age 20, accounts for
<10% cases.
• Prominent features are marked bradykinesia, rigidity, ocular
motor disturbances tremor and cerebellar symptoms (Purkinje
cells death) present. Chorea less dominant.
• Behavioral & psychiatric disturbances, impaired global cognitive
function, oral motor dysfunction, language delay and seizures.

48. Treatment, Recent approaches
To Be Continued…..

52. Genetic Testing for HD Gene Mutation
•
Guidelines for genetic testing have been developed by the Huntington’s
Disease Society of America (HDSA), the Huntington’s Disease Society
of Canada, and the International Huntington Association, in conjunction
with the World Federation of Neurology Research Group on
Huntington’s Chorea.
•
HDSA Centers of Excellence: 21 specialty clinics at medical centers
throughout USA where medical care, counseling, genetic testing, and
clinical trials offered.
•
Test to determine gene status is done using a blood sample from
individual at risk and highly accurate.

53. HD Testing Guidelines:
Step 1: Pretest Genetic Counseling
Step 2: Neurological Examination
Step 3: Psychological Screening
Step 4: Post-Test Follow-up

54. Indications for Genetic Testing
•
Adult PresymptomaticTesting: An individual at 50% risk of HD from
affected parent and not showing signs of disease. Not currently
recommended on anyone <18 yrs of age.
•
Confirmation/Symptomatic Testing: For individuals exhibiting signs
of disease wanting to know their gene status, or MD confirmation of
disease process.
•
Prenatal Testing: Allows the prospective parent who has the HD allele
or is at risk to discover the genetic status of fetus. Prenatal procedures
currently available are amniocentesis and chorionic villus sampling
(CVS). Preimplantation Genetic Diagnosis: Allows parents at risk for
passing HD gene to determine prior to IVF/embryo implantation if
embryos possess HD allele.

55. Management
•
Evaluation at initial diagnosis to establish extent of disease including
thorough medical and neurological exam, collection of detailed family
and patient history.
•
Unified Huntington’s Disease Rating Scale (1996, Huntington’s Study
Group) used to provide reliable and consistent assessment of clinical
features and progression of HD.
-Motor section: oculomotor, dysarthria, chorea, dystonia, gait, postural stability
-Cognitive section: verbal fluency, symbol Digit, Stroop color, Stroop reading,
Stroop interference
- Functional Capacity Scale, Independence Scale
•
Long-term follow-up with multidisciplinary team including Neurologist,
Social Work, Geneticist , Psychiatrist, Speech Pathologist, Nutritionist,
PT, OT.

56. Treatment: Supportive
PHARMACOLOGIC
• Choreic movements may be partially suppressed by
neuroleptics (Tetrabenazine, Respirdal, Seroquel,
Zyprexa, Haldol) or benzodiapines (Valium, Ativan,
Klonopin).
•
Anti-parkinsonian agents may ameliorate rigidity, however,
L-dopa compounds (Sinemet) can increase chorea.
•
Psychiatric disturbances such as depression, aggression,
OCD, psychotic symptoms respond well to psychotropic
drugs (SSRIs Prozac, Paxil, Celexa) or anti-epileptic
medications (Valproic acid).

57. Therapy Services:
Degenerative Disease Model
•
Supportive treatment with attention to psychosocial issues and
community and home care services.
•
SLP: speech intelligibility and functional communication
strategies, cognitive-behavioral strategies, swallowing, caregiver
education and training
•
PT: balance/gait, joint range, muscle strength & aerobic
capacity, dystonia management, adaptive equipment for safety.
•
OT for to maximize functional independence with ADLs,
adaptive feeding equipment.

58. Research: Huntington Study Group (HSG)
At-Risk & Observational Research Studies-Repository of data including
blood/biological samples, genetic testing, UHDRS evaluations, family
information, and brain imaging on presymptomatic, symptomatic, and
some gene negative subjects
– PHAROS: Prospective Huntington at Risk
– PREDICT-HD: Neurobiological Predictors of HD
– COHORT: Cooperative Huntington’s Observational Research Trial
Experimental Clinical Compounds
Transgenic Mouse Models of HD allow scientists to study processes
that cause neurons to die in HD, and assess drug therapies that may
slow disease progression

59. Human Clinical Trials: Huntington Study Group
• Compounds must cross blood-brain barrier
• Research focus on finding potential blood or brain imaging
biomarkers of HD to measure effectiveness of treatments
• Drugs in human clinical trials include Creatine, Coenzyme Q-10,
omega-3 fatty acid Ethyl-EPA, Minocycline, Phenylbutyrate,
Riluzole which have shown potential neuroprotective benefits in
mouse models

60. Creatine and HD
•
Creatine is a critical element in cellular energy production and
modulation. It is the substrate of the creatine kinase system which
helps prolong cellular life and protect against cell injury and death.
•
Hersh et al. Neurology 2006, Randomized, double-blind, placebocontrolled study in 64 subjects with HD, 8 g/day of creatine
administered x 16 weeks was well tolerated and safe. Serum and
brain creatine concentrations increased in the creatine-treated group
and returned to baseline after washout.
•
BIOMARKER: Serum 8-hydroxy-2'-deoxyguanosine (8OH2'dG) levels,
an indicator of oxidative injury to DNA, were markedly elevated in HD
and reduced by creatine treatment.
•
Dose escalation study revealed 30g/day creatine as optimal dose for
sustained suppression of 80H2’dG to normal levels and sustained
reduction in brain atrophy on MRI morphometry.

61. Proposed Creatine Study:
Creatine Safety, Tolerability, & Efficacy In Huntington’s Disease
(CREST-E)
Randomized, double-blinded, placebo controlled trial of 30 grams
of creatine/day x 36 months in early symptomatic patients with HD
proposed to test hypothesis that creatine will slow progressive
functional decline in HD.

62. Research Team at MGH
•
Normal Huntingtin Function
•
Mitochondria and Energy
Metabolism (understand if
huntingtin interacts directly with
mitochondria and how does
expanded glutamine impact)
•
Folding, Aggregation and
Clearance of Mutant
Huntingtin (understand role of
huntingtin protein misfolding,
aggregation and how to stop or
reverse)

63. HD Research Teams
•
Huntingtin Proteolysis and
Posttranslational Modification
(preventing breakup/cleavage of
mutant huntingtin that may cause
neuronal dysfunction)
•
Transcription (understand how
mutant huntingtin disrupts normal
gene activation and disrupts normal
cell function)

64. An area in the brain cortex (yellow) of people
who are carrying a mutant Htt gene but have
not yet developed Huntington's symptoms
has lower activity during a cognitive task
than it does in noncarriers.
Protein Laboratory, University of Copenhagen
HD brain and age-matched
control brain
A neuron in yellow that contains
the disease-associated version
of the huntingtin protein, seen
as the orange-red structure in
the center of the cell. (Steven
Finkbeiner, Nature, October 13,
2004, Vol. 431, No. 7010, pp.
805-810. )

67. DNA- Blueprint of life
•
DNA comes in compact form of
a twisted ladder shape
molecule called a double helix.
•
Composed of a string of
nucleotides. The 4 units are
adenine (A), thymine (T),
cytosine (C), and guanine (G).
•
Sequence of these bases
provides the chemical
information or “instructions” for
inheritance.

68. HD = Huntingtin protein with expanded
CAG (glutamine) tract

69. Genes
•
“Functional” regions of DNA that
contain specific instructions are
called genes.
•
Example would be regions of DNA
that code for making proteins.
•
Our bodies contain thousands of
different proteins. Proteins have
many different jobs: they help the
cell maintain structure, produce
energy, and communicate with
other cells.
•
Huntingtin protein is found
throughout our body.

70. Protein must be folded normally to function.
Mutant expansion of CAG causes an unusual huntingtin
protein which clumps together in the cell and causes
neuronal cell death (in the brain only)

71. Genetic Mechanism of HD:
Unstable Trinucleotide repeat
•
The gene responsible for causing HD is located on
chromosome 4. The gene regulates the production of
huntingtin protein.
•
Huntingtin protein contains within it the amino acid
glutamine. DNA sequence C-A-G (cytosine-adenineguanine) codes for glutamine. In people with HD,
however, there is an excess number of glutamine.
•
People with HD have too many copies of C-A-G in the
DNA that codes for huntingtin protein. That is why HD is
often referred to as a trinucleotide repeat disorder