Please explain Suppose that I roll a fair die (meaning that each num.pdf

•

0 likes•2 views

Please explain Suppose that I roll a fair die (meaning that each number from 1 to 6 is equally likely) until I get a 6. What is the probability (in terms of k) that the first 6 appears the k^th time I roll the die? Suppose Alice and Bob play a game where the alternate rolling the die: First Alice rolls, then Bob, then Alice again, and so on. The first person to roll a 6 wins. What is the probability that Alice wins this game? Solution.

Education

More from arihanthtextiles

Daunte is frustrated about management\'s recent decision to merge his two teams into one. He discusses this issue with Claire, a so-worker. Claire responds by saying, \"Its sounds like management\'s decision really bothers you.\" In the context of listening skills, Clarire\'s statement best exemplifies a (n) sarcastic tone that blocks responses. (b) active response that mirrors feelings (c) active response that advises the speaker. (d) blocking response that criticies the speaker (e) negative response that magnifies the problem. Solution (b) active response that mirrors feelings.

Daunte is frustrated about managements recent decision to merge hi.pdf

arihanthtextiles

Concern over the weather associated with El Nino has increased interest in the possibility that the climate on earth is getting warmer. The most common theory relates an increase in atmospheric levels of carbon dioxide (CO_2), a greenhouse gas, to increases in temperature. A regression analysis of the mean annual CO_2 concentration (in parts per million) in the atmosphere at the top of Mauna Loa in Hawaii and the mean annual air temperature (in degrees Celsius) over both land and sea across the globe for 37 years was performed. Assume all conditions are met for simple linear regression inference. A hypothesis test is to be performed to determine if CO_2 levels is a significant predictor of air temperature. What is the correct conclusion based on the results of the hypothesis test? Choose the correct answer below. Solution Here, the t statistic is t = B1 / sB1 here, B1 = 0.004, sB1 = 0.009. Thus, t = 4.444444444 For a 0.001 level, the critical t value is, as df = n - 1 = 36, tcrit= 3.582149701 Thus, as t > 3.5821, then it is OPTION D. [ANSWER].

Concern over the weather associated with El Nino has increased intere.pdf

arihanthtextiles

Clostridium difficile is a bacteria currently making headlines. It has long been the considered the most common health-care associated infection, causing death to a large number of patients when they contract it during hospital stays. The CDC is now reporting an increase in C. difficile cases even outside of hospitals, which is raising concern. Below is an electron micrograph of C. difficile. If you were able to do a Gram stain on a sample of the bacteria, you would find that the cells stain a dark purple. Given this information, how would you classify C. difficile? A. Gram negative, rod shaped B. Gram positive, coccus shaped C. Gram negative, coccus shaped D. Gram positive, rod shaped Many protists have evolved complex life cycles that include sexual reproduction. This means that: A. haploid cells must undergo meiotic divisions to form gametes. B. complex mating behavior likely evolved at the same time as sexual reproduction. C. genetic material from two haploid cells is combined at some point in the life cycle. D. diploid cells must undergo mitotic cell division in order to reproduce. Protists: A. are all eukaryotes. B. are all heterotrophs. C. are all photosynthetic. D. are all single-celled. E. All of the above are correct. All of the following are examples of the evidence that supports the endosymbiotic theory EXCEPT: A. Mitochondria and chloroplasts have their own genomes. B. Mitochondria and chloroplasts divide in a process resembling binary fission. C. Mitochondria and chloroplasts are similar in size to bacteria. D. Mitochondria and chloroplasts have linear chromosomes. Solution Clostridium difficle is a Gram positive, rod shaped bacteria.(option-D) Many protists have evolved complex sexual reproductive life cycles which includes haploid cells undergo meiotic division to form gametes. Protists are all eukaryotes, not an animal, plant or fungus. The point \"mitochondria and chloroplaats have linear chromosomes\" is not an evidence that supports for endosymbiotic theory..

Clostridium difficile is a bacteria currently making headlines. It h.pdf

arihanthtextiles

You cloned an EcoRI digested DNA fragment into a unique EcoRI site of a vector. You identify a recombinant vector that you believe has the DNA of interest. To generate a restriction map of the recombinant plasmid, you take three individual samples of the plasmid and digest them with EcoRI, HindIII, and with both EcoRI and HindIII. You then run the digested DNA on an agarose gel to see the fragments. The gel is then subjected to a Southern hybridization using the EcoRI insert as a probe. Assume that the insert fragment is smaller than the vector. 15. Which fragment (s) on the gel would hybridize to the probe which represents the inert? 16. Which fragment (s) on the gel would hybridize to a probe representing the 5.3 kb band observed in the EcoRI lane? 17. Which fragment (s) in the EcoRI lane would hybridize to a probe representing the 4.1 kb band observed in the HindIII lane? 18. The cloning strategy used being non-directional, the recombinant plasmid may represent one of two possible orientations of the insert. You perform a hybridization with the 1.5 kb band observed in the EcoRI lane. Which fragment (s) would not be observed in the opposite orientation of that represented on the gel? PLEASE EXPLAIN THOUGHT PROCESS 5.3 4.1 2.7 1.5 EcoRI HindIII EcoRI Hind 3.0 2.3 1.1 0.4 Solution The band of HINDIII (2.7) and the band of EcoRI+HINDIII (2.3) represent the fragments that will hybridize to 5.3kb band probe. The band of EcoRI+HINDIII (3.0) and the band of EcoRI (1.5) represent the fragments that will hybridize to 4.1kb band probe. The fragments which will mot be observed in opposite direction are the ones which are dual enzyme digested. The reason behind this is that when dual enzyme digestion occurs it causes an incompatible recognition sequence in the opposite direction. Therefore such fragments are found in the middle of two individual enzyme digestions..

You cloned an EcoRI digested DNA fragment into a unique EcoRI site o.pdf

arihanthtextiles

You have constructed a new reporter gene to help you find novel zebrafish mutations. The reporter gene consists of several LEG/TCF binding domains in the enhancer fused to the coding region for green fluorescent protein (GFP). Wild-type embryos that contain this transgene normally express it in the brain and eye primordia and have no developmental defects. You then mutagenize this reporter strain to look for new mutants that affect GFP expression. Which developmental pathway are these mutants likely to be in and why? You find a mutant (which you call GLO-1) that ubiquitously expresses your reporter gene throughout the entire embryo. Which molecule in the above pathway is most likely to be mutated and why? Solution Ans.) Nacre, a zebrafish homolog of MITF is required for pigment cell differentiation. We isolated a promoter region of shell that contains Tcf/Lef binding sites which will mediate Wnt responsiveness. This promoter binds to zebrafish Lef1 protein in vitro, and a nacre communicator construct is powerfully inhibited by dominant-negative Tcf in malignant melanoma cells. Mutation of Tcf/Lef sites abolishes Lef1 binding and reporter operates in vivo. Wnt signaling so directly activates shell, which in flip ends up in pigment cell differentiation. It was determined that the human melanocyte-specific MITF promoter contains many purported Tcf/Lef binding sites, hallmarks of Wnt/-catenin-mediated transcriptional control. To test the hypothesis that nacre could be a target of the Wnt/-catenin pathway in zebrafish, a promoter/enhancer region is isolated for this sequence from a genomic bacteriophage library. This genomic fragment contains the translation initiation site for nacre which is associated with a 836-bp upstream region with a possible transcription begin site, a cAMP response element (CRE) and several agreement Tcf/Lef binding sites. These CRE and Tcf/Lef locations are not fully preserved between the human and zebrafish promoters in either their sequences or their positions from the transcription begin site. To examine whether the purported putative nacre promoter/enhancer will direct correct abstraction management of organic phenomenon, injected one -cell zebrafish embryos with the 836-bp deoxyribonucleic acid fragment driving a green fluorescent macromolecule (GFP) communicator sequence. Mosaic gene expression is typical for transient transgenics in zebrafish and because the neural crest springs from only a few precursor cells, reporter potency is minimized. Despite these, it was ready to analyze the fate of the few reporter-expressing cells in injected animals..

You have constructed a new reporter gene to help you find novel zebr.pdf

arihanthtextiles

Write a Java program that will incorporate either a sequential searc.pdf

arihanthtextiles

Answer only with excel instructions. Assume that 96% of ticket holders show up for an airline flight. If a plane seats 200 people, how many tickets should be sold to make the chance of an overbooked flight (more ticket holders show up for a flight than there are seats available) is at most 10%. Solution Say no. of tickets booked = x Now only 0.96x will turn up No. of seats = 200 Now these 0.96x people should get a seat with 90% probability 200 / (0.96x) >=0.9 200/0.864 >= x x <=231.48 x = 231 Airline will make 231 reservations.

Answer only with excel instructions.Assume that 96 of ticket hold.pdf

arihanthtextiles

A new species of sea horse has been discovered and is being sequenced The genome of the new species is being aligned using the reference sequence from a already-known species of sea horse Since the two species are evolutionary diverged, there may be some differences between their sequences Reference sequence: ACCTACATTCACAGAATGAT Fragments a) Align the set of mini-fragments above. b) How are the sequences of the two sea horse species different? c) Would this alignment have been easier or more difficult if you didn\'t have any reference sequence at all (alignment without a reference is called \"de novo\")? Explain d) If there had been sequencing errors, would this alignment have been easier or more difficult? Explain. Solution A) TAGATT TGAATG TCACTGA B) There is a form of polymorphism occurring in the new sequence of the genes for the new species of sea horses. There is single nucleotide polymorphism in the new species as C is replaced by T and A instead of G which may probably occurred due to some sort of mutation during genetic sequencing. C) The given alignment would be difficult without reference DNA sequence as reference sequence gives basic DNA information and a reference database techniques is much easier than performing a de novo technique though de novo methods are well established using mass spectra nowadays but still having a reference database helps and gives the better coding information of protein sequence. D) if there had been a sequence error there would be difficulty in alignment and in that case we have to perform de novo sequencing using mass spectra analysis. To know the sequence of the species and other information regarding the DNA characters..

A new species of sea horse has been discovered and is being sequenced.pdf

arihanthtextiles

Which of the following is the mechanism of action for Herceptin? Herceptin binds to the HER2 promoter to prevent transcription, thus lowering amounts of receptor. Herceptin binds to intracellular HER2 proteins to prevent cancer cells from dividing. Herceptin binds to HER3 and HER4 cell surface receptors to activate the immune system. Herceptin binds to extracellular domain of HER2 and prevents internalization and subsequent cancer cell division. Herceptin targets TNF alpha. Solution B) herceptin binds to intracellular ER2 proteins to prevent cancer cells from dividing Trastuzumab (herceptin) activates p27 factor by inhibiting PI3K/Akt, Mirk and hKIS pathways. HER2 protein can be expressed up to 100 times more in cancer cells. PI3K/Akt, Mirk and hKIS are intracellular proteins in HER2 pathways are activated which promote cell proliferation. Signals present in these pathways promote growth of blood vessels in order to supplement for tumour formation or angiogenesis and therefore resulting in cell proliferation. Thus, when herceptin inhibits PI3K/Akt, Mirk and hKIS pathways, the cell proliferation is inhibited..

Which of the following is the mechanism of action for Herceptin Her.pdf

arihanthtextiles

Which of these statements best describes an element? An element is composed of three subatomic particles. An element is formed when two atoms of the same kind are bonded together. An element is formed when two or more different atoms combine chemically. An element is composed of identical atoms. Solution An element is composed of identical atoms. Molecules can be made of elements, but elements arent made from molecules. 2 or more atoms of the same kind make up an element.For example H is hydrogen which is an element formed from H atoms only whereas H2O is a compount formed from 2 different atoms H and O..

Which of these statements best describes an element An element is c.pdf

arihanthtextiles

What is the general goal for descriptive statistics? How is the goal served by putting scores in a frequency distribution? How is the goal served by computing a measure of central tendency? How is the goal served by computing a measure of variability? Solution What is the general goal of descriptive statistics ? Answer : To simplify , organize, and summarize data so that it is easier for researchers to see patterns. How is the goal served by putting scores in a frequency distribution? A frequncy distribution provides an organized summary of the complete set of scores. How is the goal served by computing a measure of central tendency? Summarizes an entires set of scores with a single value that is representative of the whole set. How is the goal served by computing a measure of variability? Provides a single number that describes the differences that exist from complete score to another..

What is the general goal for descriptive statistics How is the goal.pdf

arihanthtextiles

What effects are shown on this graph? (assume that all effects where the marginal means differ are significant) Choose as many as applicable. A. Main effect of A where scores are higher at A1 than A2 B. Main effect of A where scores are higher at A2 than A1 C, Main effect of B where scores are higher at B1 than B2 D, Main effect of B where scores are higher at B2 than B1 E. Interaction where the effect of A is larger at B1 than B2 F. Interaction where the effect of A is larger at B2 than B1 Solution.

What effects are shown on this graph (assume that all effects where.pdf

arihanthtextiles

What are adaptive peaks? How do organisms move from one adaptive peak to another? 100 words or more please Solution An equilibrium state in a population when the gene pool has allele frequencies that maximize the average fitness of a population\'s members. In other words, A high point (perhaps one of several) on an adaptive landscape; selection tends to drive the genotype composition of the population toward a combination corresponding to an adaptive peak. Most extant organisms are thought to sit on the “peaks” of such adaptive landscapes. However, how does a phenotype shift from one peak to another is not clear. Common hypotheses include (1) There are “ridges” connecting the adaptive peaks, such that phenotypes along the ridge are more or less equally fit under a specific environment; (2) There are no ridges connecting the peaks but when effective population size is small enough, phenotypes may be able to traverse the less-adaptive region (i.e. adaptive valley) by genetic drift..

What are adaptive peaks How do organisms move from one adaptive pea.pdf

arihanthtextiles

We are dealing with Verilog language....... What is a major design advantage when using a ripple counter? Design simplicity. Glitch free. High speed. Outputs are all synchronized.a. Design simplicity.b. Glitch free.c. High speed.d. Outputs are all synchronized. Solution advantages of design of asynchronous(ripple) counter in verilog code are 1.Removes reset from the data path. 2.multi clock systems needs only one reset. 3.Faster in speed. So answer is (c).

We are dealing with Verilog language.......What is a major design .pdf

arihanthtextiles

The text defines three service layers when describing Cloud Computing. Identify and describe these three service layers. Which Service Layer is most likely to be consumed via Public Cloud service and why? You need to defend your answer. Solution First we’ll go high level. Cloud is made feasible through the deployment and interoperability of three platform types. These three layers are: IaaS - Infrastructure as a Service PaaS - Platform as a Service SaaS - Software as a Service Now this stack is easily broken down as follows: Think of the “Infrastructure-as-a-Service” as the road. It’s the basis for communication. It’s the bottom layer that you build your platform on. The platform are the cars traveling on the infrastructure. PaaS rides on IaaS. But on the top of that, the goods and passengers inside the cars are the SaaS. It’s the end user experience. It’s the end result. Let’s take that a step further. 1) Infrastructure-as-a-Service (IaaS) Cloud Providers offering Infrastructure as a Service tout data-center space, and servers; as well as network equipment such as routers/switches and software for businesses. These data-centers are fully outsourced, you need not lift a finger, upgrade an IOS or re-route data. Although this is the base layer, it allows for scalability and reliability; as well as better security than an organization may have in a local co-lo or local datacenter. In addition, these services are charged as utilities, so you pay for what you use, like your water, electric and gas. Depending on your capacity or usage, your payment is a variable. Because the IaaS vendors purchase equipment in such bulk, you, Mr. Customer, get the best gear for the lowest price. Hence, the financial benefits of IaaS are cheaper access to infrastructure. With the pay-as-you-go model, instead of investing in a fixed capacity infrastructure, which will either fall short or exceed the organizational need, customers are able to save quite a bit of coin. Buying hardware that’s barely used is a waste of hardware, air conditioning, space and power. Operational expenses versus Capital expenses: Cloud is better. Because these computing resources are basically used and paid for like a utility they can be paid via the operating expenditures budget versus being paid for via capital investments. In other words, instead of depreciating the gear over three years, you’re able to expense the monthly charge this year. And the next year. And the year after that. It’s an elastic service. 1.1) Application-level security This level is primarily about identity and access management. Your best investment here isn’t financial; it’s a policy that limits the ability of users to deploy cloud applications without IT’s knowledge. After ensuring policies are in place that offer IT visibility, the next step is to invest in multifactor authentication and identity management. The first approach uses two or more devices or applications to permit access. For example, a verification cod.

The text defines three service layers when describing Cloud Computin.pdf

arihanthtextiles

Social support plays a critical role in successful aging. Is this true or false? Why? Solution Social support plays a critical role in successful aging. The statement is true. Aging refers to the process of becoming older over a period of time.This includes the changes in physical , psychological and social changes.At any stage of life social support play a crucial role in the success of a person this is even more true in case of older adults.with the advancement of age there are several changes that occur in the life which include changes in the job status, a person may retire and yet may have family financial commitments to be fulfilled,the children would have grown up and for their future they might have left the parents for their life settlements , deterioration of physical health, financial status ,empty nest syndrome, felling isolated and left out all these may also lead to psychological depression. A positive approach to life is a very important factor in the process of aging. in older adults the body immune system becomes fragile , resources for support become depleted and such other causes will have an effect in the process of aging.Psychological well being is an indication of successful adaptation to old age . Acceptance to change as a part of life provides strength in overcoming several psychological problems and studies have indicated that adults who are active are more likely to be successful in their old age than those who expect a leisurely and lazy dependent life as this tend to negative interactions with the family mainly. As people age remaining socially active provides a positive health benefits to the aged people. Successful connectedness,isolation, mobility, spirituality all have a say in dealing with the geriatric problems.one can adapt themselves to the age by being socially active .Voulenteering is a notable factor in relation to social support for adults.It helps in building companionship and interact with more people of the community.They can engage themselves in spiritual activities , develop more realistic goals ,opportunities for self discovery. Physical health plays a very important role in successful aging,with the advancement of age .social support in terms of maintaining day to day affairs also plays a crucial role and studies have suggested that it also helps in enhanced well being , less depression and often provides a senses of meaning to life. To conclude aging is a general process and acceptance with grace provides the main solution for successful aging and the social support either monetary, physical or psychological all play a very important role in helping the elderly people in the late years of their life..

Social support plays a critical role in successful aging. Is this tr.pdf

arihanthtextiles

sch the Basic Principles of Science 1erms with their proper defrition. Testable undeseindiaadammtal processes natural lawaby questions suce, the wok taday are the iame ihaped the wodd the part, and they will continar Proof is elusive prefmible This nale ilse afire the English philosophe dange as new Parsimony Repeatability then the eedeseu cannot be Solution 1. Testable question - 7 Uncertainity - 4 Proof is elusive - 6 parsimony - 3 Repeatability - 5 Empiricism - 1 Uniformitarianism - 2 2. Emergent properties 3. Scientific theory.

sch the Basic Principles of Science 1erms with their prop.pdf

arihanthtextiles

A very thin slice is removed from a peanut and treated with Sudan III stain. Then a drop of Biuret reagent is added to the peanut slice. When you examine the peanut slice under a microscope, patches of red and blue-violet are visible. What conclusions can you draw from your examination? Solution Answer: When Biuret reagent is added to peanut slices, it turns into Blue-Violet colour indicating that presence of the proteins in peanut. When peanut is treated with Sudan III stain, slice turns into red colour indicating the presence of the Lipids..

A very thin slice is removed from a peanut and treated with Sudan II.pdf

arihanthtextiles

Question 1. CAM plants have adapted to very dry climates by opening their stomata only during the day. True False 2 points QUESTION 2 If the haploid number of chromosomes in an organism is 16, then the diploid number is 24 4 8 32 2 points QUESTION In human blood groups, the A, B, and O alleles are codominant. True False 2 points QUESTION If two plants that show incomplete dominance are crossed, one having red flowers and the other pink flowers, what will be the phenotypic ratio of their offspring? 1 pink:2 white:1 red 1 red:2 pink:1 white 1 white:2 red:1 pink 2 red:2 pink 2 points QUESTION DNA transcription takes place in the nucleus. True False 2 points QUESTION Which of the following is not haploid? sperm gamete zygote egg 24 4 8 32 Solution Ans. 1. False CAM plants are adapted to very dry climates by opening their stomata during the night. Night temperature is relatively much lower than that of the day time. So, opening stomata during night time cause less evaporation (low loss of water) loss of water during transpiration than day time. Ans. 2. True. Alleles are said to be co-dominant when both alleles are expressed simultaneously in heterozygous condition and both the traits retain their identity. For example, in AB blood group, both the antigens A (gene product of allele IA) and B (gene product of allele IB) are simultaneously expressed and independently present on RBC cell surface. In a complete dominance scenario, only the dominant allele is expressed while the recessive is NOT expressed in heterozygous condition. Ans. 3. Incomplete dominance shows simultaneously expression of two alleles in the heterozygous condition, but the two traits blend together to give a new phenotype. Consider the difference of crosses between homozygous red and homozygous white flower as RR x rr = RR, Rr, Rr, rr. - I. Complete dominance: Rr progeny = red flower as that of dominant allele. II. Incomplete dominance: Rr progeny = Pink flower as blending of red and white color because R and r are expressed simultaneously. III. Co-dominance: Rr progeny = A flower with white and red patches of color- both R and r are expressed simultaneously and both the phenotypes retain their identity. Now, coming to the question- Genotype of homozygous red flower: RR Genotype of homozygous red flower: Rr Now, RR x Rr = RR, Rr ; [RR = red ; Rr = pink] Phenotype ratio = 1: 1 or 2: 2 or 3:3 ; [Note: multiplying a ratio with any factor does not affect the ration. SO, 1:1 = 2: 2 = 3: 3, and so on]. Ans. 4. True DNA transcription i.e. formation of RMA from DNA is called transcription. Because DNA is present in nucleus and does not come out in cytoplasm at any point, the transcription must occur in nucleus. Ans. 5. Correct option C. zygote. Sperm (n) + egg (n) -------> Zygote (2n). Fusion of egg with sperm gives diploid zygote. Sperm and egg are gametes- all being haploid (n)..

Question 1. CAM plants have adapted to very dry climates by opening .pdf

arihanthtextiles

Programming in C. Create a program which turns your Arduino into a light based electronic instrument. The program should play music based on the amount of light hitting the optical sensor. There should be a way to capture particularly pleasing tones and play those tones back in the order they are captured. The program must utilize the following : • An array to hold the stored tones • A function : void read_buttons( int *sw1, int *sw2, int *sw3, int *sw4) to read and store the state of the four buttons on the board • A function playback( notes[] ) which plays back the notes stored • A function clear_playlist( *notes) which clears the stored tones • A function tone_value() which generates a tone based on the current state of the optical sensor • The possible tones should span the range of human hearing Solution #include #include using namespace std; // Class Declaration class prime { //Member Varibale Declaration int a,k,i; public: prime(int x) { a=x; } // Object Creation For Class void calculate() { k=1; { for(i=2;i<=a/2;i++) if(a%i==0) { k=0; break; } else { k=1; } } } void show() { if(k==1) cout<<\"\ \"<>a; // Object Creation For Class prime obj(a); // Call Member Functions obj.calculate(); obj.show(); getch(); return 0; }.

Programming in C.Create a program which turns your Arduino into a .pdf

arihanthtextiles

More from arihanthtextiles (20)