SlideShare a Scribd company logo
1 of 42
Maximum Likelihood
Likelihood
The likelihood is the probability of the data given the
model.
If we flip a coin and get a head and we think the coin is
unbiased, then the probability of observing this head is 0.5.
If we think the coin is biased so that we expect to get a head
80% of the time, then the likelihood of observing this datum (a
head) is 0.8.
The likelihood of making some observation is entirely
dependent on the model that underlies our assumption.
The datum has not changed, our model has. Therefore under
the new model the likelihood of observing the datum has
changed.
Likelihood
Maximum Likelihood (ML)
ML assumes a explicit model of sequence evolution. This is
justifiable, since molecular sequence data can be shown to
have arisen according to a stochastic process.
ML attempts to answer the question:
What is the probability that I would observe these data (a
multiple sequence alignment) given a particular model of
evolution (a tree and a process)?
Likelihood calculations
In molecular phylogenetics, the data are an alignment of sequences
We optimize parameters and branch lengths to get the maximum likelihood
Each site has a likelihood
The total likelihood is the product of the site likelihoods
The maximum likelihood tree is the tree topology that gives the highest
(optimized) likelihood under the given model.
We use reversible models, so the position of the root does not matter.
What is the probability of observing a G nucleotide?
If we have a DNA sequence of 1 nucleotide in length and the identity of this
nucleotide is G, what is the likelihood that we would observe this G?
In the same way as the coin-flipping observation, the likelihood of observing
this G is dependent on the model of sequence evolution that is thought to
underlie the data.
Model 1: frequency of G = 0.4 => likelihood(G) = 0.4
Model 2: frequency of G = 0.1 => likelihood(G) = 0.1
Model 3: frequency of G = 0.25 => likelihood(G) = 0.25
What about longer sequences?
If we consider a gene of length 2
gene 1 GA
The the probability of observing this gene is the product of the
probabilities of observing each character
Model frequency of G = 0.4 frequencyof A= 0.15
p(G) = 0.4 p(A) =0.15
Likelihood (GA) = 0.4 x 0.15 = 0.06
…or even longer sequences?
gene 1 GACTAGCTAGACAGATACGAATTAC
Model simple base frequency model
p(A)=0.15; p(C)=0.2; p(G)=0.4; p(T)=0.25;
(the sum of all probabilities must equal 1)
Likelihood (gene 1) = 0.000000000000000018452813
Note about models
You might notice that our model of base frequency is not the
optimal model for our observed data.
If we had used the following model
p(A)=0.4; p(C) =0.2; p(G)= 0.2; p(T) = 0.2;
The likelihood of observing the gene is
L (gene 1) = 0.000000000000335544320000
L (gene 1) = 0.000000000000000018452813
The datum has not changed, our model has. Therefore under
the new model the likelihood of observing the datum has
changed.
Increase in model sophistication
It is no longer possible to simply invoke a model that
encompasses base composition, we must also include the
mechanism of sequence change and stasis.
There are two parts to this model - the tree and the process
(the latter is confusingly referred to as the model, although
both parts really compose the model).
Different Branch Lengths
For very short branch lengths, the probability of a character staying the
same is high and the probability of it changing is low.
For longer branch lengths, the probability of character change becomes
higher and the probability of staying the same is lower.
The previous calculations are based on the assumption that the branch
length describes one Certain Evolutionary Distance or CED.
If we want to consider a branch length that is twice as long (2 CED), then
we can multiply the substitution matrix by itself (matrix2
).
I (A) II (C)
I (A) II (C)
v = 0.1
v = 1.0
v = µt
µ = mutation rate
t = time
ximum Likelihood
Two trees each consisting of single branch
Jukes-Cantor model
I (A) II (C)
I (A) II (C)
v = 0.1
v = 1.0
Ι AACC
ΙΙ CACT
1 j
N
1 C G G A C A C G T T T A C
2 C A G A C A C C T C T A C
3 C G G A T A A G T T A A C
4 C G G A T A G C C T A G C
1
42
3
1
C
2
C
4
G
3
A
5
6
L(j) = p
C C A G
A
A
C C A G
C
A
C C A G
T
T
+ p + … + p
L(j) = p
C C A G
A
A
C C A G
C
A
C C A G
T
T
+ p + … + p
N
L = L(1) • L(2) • … L(N) = ΠL(j)j = 1
N
lnL = lnL(1) + lnL(2) + … L(N) = Σ lnL(j)j = 1
Likelihood of the alignment at various branch lengths
0
0,00002
0,00004
0,00006
0,00008
0,0001
0,00012
0,00014
0,00016
0,00018
0,0002
0 0,1 0,2 0,3 0,4 0,5 0,6
Strengths of ML
• Does not try to make an observation of sequence change and then a
correction for superimposed substitutions. There is no need to
‘correct’ for anything, the models take care of superimposed
substitutions.
• Accurate branch lengths.
• Each site has a likelihood.
• If the model is correct, we should retrieve the correct tree (If we have
long-enough sequences and a sophisticated-enough model).
• You can use a model that fits the data.
• ML uses all the data (no selection of sites based on informativeness,
all sites are informative).
• ML can not only tell you about the phylogeny of the sequences, but
also the process of evolution that led to the observations of today’s
sequences.
Weaknesses of ML
• Can be inconsistent if we use models that are not accurate.
• Model might not be sophisticated enough
• Very computationally-intensive. Might not be possible to
examine all models (substitution matrices, tree topologies).
Models
• You can use models that:
Deal with different transition/transversion ratios.
Deal with unequal base composition.
Deal with heterogeneity of rates across sites.
Deal with heterogeneity of the substitution process (different rates
across lineages, different rates at different parts of the tree).
• The more free parameters, the better your model fits your data (good).
• The more free parameters, the higher the variance of the estimate (bad).
Choosing a Model
Don’t assume a model, rather find a model that fits your data.
Models often have “free” parameters. These can be fixed to a
reasonable value, or estimated by ML.
The more free parameters, the better the fit (higher the likelihood) of
the model to the data. (Good!)
The more free parameters, the higher the variance, and the less
power to discriminate among competing hypotheses. (Bad!)
We do not want to over-fit the model to the data
What is the best way to fit a line (a model) through these points?
How to tell if adding (or removing) a certain parameter is a good idea?
• Use statistics
• The null hypothesis is that the presence or absence of the parameter makes no difference
• In order to assess signifcance you need a null distribution
We have some DNA data, and a tree. Evaluate the data with 3 different
models.
model ln likelihood ∆
JC -2348.68
K2P -2256.73 91.95
GTR -2254.94 1.79
Evaluations with more complex models have higher likelihoods
The K2P model has 1 more parameter than the JC model
The GTR model has 4 more parameters than the K2P model
Are the extra parameters worth adding?
JC vs K2P K2P vs GTR
We have generated many true null hypothesis data sets and evaluated them under the JC
model and the K2P model. 95% of the differences are under 2.The statistic for our original
data set was 91.95, and so it is highly significant. In this case it is worthwhile to add the extra
parameter (tRatio).
We have generated many true null hypothesis data sets and evaluated them under the K2P
model and the GTR model. The statistic for our original data set was 1.79, and so it is not
signifcant. In this case it is not worthwhile to add the extra parameters.
You can use the χ2
approximation to assess
significance of adding parameters
Bayesian Inference
Maximum likelihood
Search for tree that maximizes the chance of
seeing the data (P (Data | Tree))
Bayesian Inference
Search for tree that maximizes the chance of
seeing the tree given the data (P (Tree | Data))
Bayesian Phylogenetics
Maximize the posterior probability of a tree given the aligned DNA
sequences
Two steps
- Definition of the posterior probabilities of trees (Bayes’ Rule)
- Approximation of the posterior probabilities of trees
Markov chain Monte Carlo (MCMC) methods
90 10
yesian Inference
yesian Inference
Markov Chain Monte Carlo Methods
Posterior probabilities of trees are complex joint probabilities
that cannot be calculated analytically.
Instead, the posterior probabilities of trees are approximated
with Markov Chain Monte Carlo (MCMC) methods that sample
trees from their posterior probability distribution.
MCMC
A way of sampling / touring a set of solutions,biased
by their likelihood
1 Make a random solution N1 the current solution
2 Pick another solution N2
3 If Likelihood (N1 < N2) then replace N1 with N2
4 Else if Random (Likelihood (N2) / Likelihood (N1)) then replace
N1 with N2
5 Sample (record) the current solution
6 Repeat from step 2
yesian Inference
yesian Inference

More Related Content

What's hot

Random Forest / Bootstrap Aggregation
Random Forest / Bootstrap AggregationRandom Forest / Bootstrap Aggregation
Random Forest / Bootstrap AggregationRupak Roy
 
Summary statistics
Summary statisticsSummary statistics
Summary statisticsRupak Roy
 
Quicksort algorithm
Quicksort algorithmQuicksort algorithm
Quicksort algorithmBapan Maity
 
Simplicial closure and higher-order link prediction --- SIAMNS18
Simplicial closure and higher-order link prediction --- SIAMNS18Simplicial closure and higher-order link prediction --- SIAMNS18
Simplicial closure and higher-order link prediction --- SIAMNS18Austin Benson
 

What's hot (7)

NCM RB PAPER
NCM RB PAPERNCM RB PAPER
NCM RB PAPER
 
A Method for Constructing Non-Isosceles Triangular Fuzzy Numbers Using Freque...
A Method for Constructing Non-Isosceles Triangular Fuzzy Numbers Using Freque...A Method for Constructing Non-Isosceles Triangular Fuzzy Numbers Using Freque...
A Method for Constructing Non-Isosceles Triangular Fuzzy Numbers Using Freque...
 
Random Forest / Bootstrap Aggregation
Random Forest / Bootstrap AggregationRandom Forest / Bootstrap Aggregation
Random Forest / Bootstrap Aggregation
 
Quicksort
QuicksortQuicksort
Quicksort
 
Summary statistics
Summary statisticsSummary statistics
Summary statistics
 
Quicksort algorithm
Quicksort algorithmQuicksort algorithm
Quicksort algorithm
 
Simplicial closure and higher-order link prediction --- SIAMNS18
Simplicial closure and higher-order link prediction --- SIAMNS18Simplicial closure and higher-order link prediction --- SIAMNS18
Simplicial closure and higher-order link prediction --- SIAMNS18
 

Viewers also liked

Sr Presentation 2
Sr Presentation 2Sr Presentation 2
Sr Presentation 2guestd2364f
 
Strategie_workshop
Strategie_workshopStrategie_workshop
Strategie_workshopJan Bízik
 
Declaration local
Declaration local Declaration local
Declaration local Marine Bac
 
Personal narrative essay
Personal narrative essayPersonal narrative essay
Personal narrative essayDakota Heims
 
VishwasVats_MHRM_IITKGP
VishwasVats_MHRM_IITKGPVishwasVats_MHRM_IITKGP
VishwasVats_MHRM_IITKGPVishwas Vats
 
Behaviour driven development
Behaviour driven developmentBehaviour driven development
Behaviour driven developmentTony Nguyen
 
Permenkes No -2349-organisasi- BBTKL - PP
Permenkes No -2349-organisasi- BBTKL - PPPermenkes No -2349-organisasi- BBTKL - PP
Permenkes No -2349-organisasi- BBTKL - PPDitjen P2P
 
Writing an effective conclusion
Writing an effective conclusionWriting an effective conclusion
Writing an effective conclusionketurahhaferkamp
 
Lec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- Coherence
Lec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- CoherenceLec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- Coherence
Lec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- CoherenceHsien-Hsin Sean Lee, Ph.D.
 

Viewers also liked (16)

Sr Presentation 2
Sr Presentation 2Sr Presentation 2
Sr Presentation 2
 
161105+Amro+Letter
161105+Amro+Letter161105+Amro+Letter
161105+Amro+Letter
 
Strategie_workshop
Strategie_workshopStrategie_workshop
Strategie_workshop
 
Engrish
EngrishEngrish
Engrish
 
lkh iohoih
lkh iohoihlkh iohoih
lkh iohoih
 
Presentación
PresentaciónPresentación
Presentación
 
Declaration local
Declaration local Declaration local
Declaration local
 
Polymorphism
PolymorphismPolymorphism
Polymorphism
 
Personal narrative essay
Personal narrative essayPersonal narrative essay
Personal narrative essay
 
VishwasVats_MHRM_IITKGP
VishwasVats_MHRM_IITKGPVishwasVats_MHRM_IITKGP
VishwasVats_MHRM_IITKGP
 
Drive Your Career
Drive Your CareerDrive Your Career
Drive Your Career
 
Behaviour driven development
Behaviour driven developmentBehaviour driven development
Behaviour driven development
 
Permenkes No -2349-organisasi- BBTKL - PP
Permenkes No -2349-organisasi- BBTKL - PPPermenkes No -2349-organisasi- BBTKL - PP
Permenkes No -2349-organisasi- BBTKL - PP
 
Writing an effective conclusion
Writing an effective conclusionWriting an effective conclusion
Writing an effective conclusion
 
Abbott_Kinase
Abbott_KinaseAbbott_Kinase
Abbott_Kinase
 
Lec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- Coherence
Lec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- CoherenceLec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- Coherence
Lec14 Computer Architecture by Hsien-Hsin Sean Lee Georgia Tech --- Coherence
 

Similar to Data mining maximumlikelihood

Intro to Model Selection
Intro to Model SelectionIntro to Model Selection
Intro to Model Selectionchenhm
 
Ders 1 mean mod media st dev.pptx
Ders 1 mean mod media st dev.pptxDers 1 mean mod media st dev.pptx
Ders 1 mean mod media st dev.pptxErgin Akalpler
 
Probability distribution Function & Decision Trees in machine learning
Probability distribution Function  & Decision Trees in machine learningProbability distribution Function  & Decision Trees in machine learning
Probability distribution Function & Decision Trees in machine learningSadia Zafar
 
Maximum likelihood estimation from uncertain
Maximum likelihood estimation from uncertainMaximum likelihood estimation from uncertain
Maximum likelihood estimation from uncertainIEEEFINALYEARPROJECTS
 
Cost Optimized Design Technique for Pseudo-Random Numbers in Cellular Automata
Cost Optimized Design Technique for Pseudo-Random Numbers in Cellular AutomataCost Optimized Design Technique for Pseudo-Random Numbers in Cellular Automata
Cost Optimized Design Technique for Pseudo-Random Numbers in Cellular Automataijait
 
Data Science Interview Questions | Data Science Interview Questions And Answe...
Data Science Interview Questions | Data Science Interview Questions And Answe...Data Science Interview Questions | Data Science Interview Questions And Answe...
Data Science Interview Questions | Data Science Interview Questions And Answe...Simplilearn
 
Kaggle digits analysis_final_fc
Kaggle digits analysis_final_fcKaggle digits analysis_final_fc
Kaggle digits analysis_final_fcZachary Combs
 
CPSC 531: System Modeling and Simulation.pptx
CPSC 531:System Modeling and Simulation.pptxCPSC 531:System Modeling and Simulation.pptx
CPSC 531: System Modeling and Simulation.pptxFarhan27013
 
Data mining Part 1
Data mining Part 1Data mining Part 1
Data mining Part 1Gautam Kumar
 
Data Science - Part V - Decision Trees & Random Forests
Data Science - Part V - Decision Trees & Random Forests Data Science - Part V - Decision Trees & Random Forests
Data Science - Part V - Decision Trees & Random Forests Derek Kane
 
Other classification methods in data mining
Other classification methods in data miningOther classification methods in data mining
Other classification methods in data miningKumar Deepak
 
Bel ventutorial hetero
Bel ventutorial heteroBel ventutorial hetero
Bel ventutorial heteroEdda Kang
 

Similar to Data mining maximumlikelihood (20)

Into to prob_prog_hari
Into to prob_prog_hariInto to prob_prog_hari
Into to prob_prog_hari
 
MyStataLab Assignment Help
MyStataLab Assignment HelpMyStataLab Assignment Help
MyStataLab Assignment Help
 
Intro to Model Selection
Intro to Model SelectionIntro to Model Selection
Intro to Model Selection
 
Ders 1 mean mod media st dev.pptx
Ders 1 mean mod media st dev.pptxDers 1 mean mod media st dev.pptx
Ders 1 mean mod media st dev.pptx
 
Statistics
StatisticsStatistics
Statistics
 
Probability distribution Function & Decision Trees in machine learning
Probability distribution Function  & Decision Trees in machine learningProbability distribution Function  & Decision Trees in machine learning
Probability distribution Function & Decision Trees in machine learning
 
Explore ml day 2
Explore ml day 2Explore ml day 2
Explore ml day 2
 
Maximum likelihood estimation from uncertain
Maximum likelihood estimation from uncertainMaximum likelihood estimation from uncertain
Maximum likelihood estimation from uncertain
 
Cost Optimized Design Technique for Pseudo-Random Numbers in Cellular Automata
Cost Optimized Design Technique for Pseudo-Random Numbers in Cellular AutomataCost Optimized Design Technique for Pseudo-Random Numbers in Cellular Automata
Cost Optimized Design Technique for Pseudo-Random Numbers in Cellular Automata
 
Data Science Interview Questions | Data Science Interview Questions And Answe...
Data Science Interview Questions | Data Science Interview Questions And Answe...Data Science Interview Questions | Data Science Interview Questions And Answe...
Data Science Interview Questions | Data Science Interview Questions And Answe...
 
03 Data Mining Techniques
03 Data Mining Techniques03 Data Mining Techniques
03 Data Mining Techniques
 
Kaggle digits analysis_final_fc
Kaggle digits analysis_final_fcKaggle digits analysis_final_fc
Kaggle digits analysis_final_fc
 
ML MODULE 2.pdf
ML MODULE 2.pdfML MODULE 2.pdf
ML MODULE 2.pdf
 
CPSC 531: System Modeling and Simulation.pptx
CPSC 531:System Modeling and Simulation.pptxCPSC 531:System Modeling and Simulation.pptx
CPSC 531: System Modeling and Simulation.pptx
 
Into to prob_prog_hari (2)
Into to prob_prog_hari (2)Into to prob_prog_hari (2)
Into to prob_prog_hari (2)
 
Data mining Part 1
Data mining Part 1Data mining Part 1
Data mining Part 1
 
report
reportreport
report
 
Data Science - Part V - Decision Trees & Random Forests
Data Science - Part V - Decision Trees & Random Forests Data Science - Part V - Decision Trees & Random Forests
Data Science - Part V - Decision Trees & Random Forests
 
Other classification methods in data mining
Other classification methods in data miningOther classification methods in data mining
Other classification methods in data mining
 
Bel ventutorial hetero
Bel ventutorial heteroBel ventutorial hetero
Bel ventutorial hetero
 

More from Tony Nguyen

Object oriented analysis
Object oriented analysisObject oriented analysis
Object oriented analysisTony Nguyen
 
Directory based cache coherence
Directory based cache coherenceDirectory based cache coherence
Directory based cache coherenceTony Nguyen
 
Business analytics and data mining
Business analytics and data miningBusiness analytics and data mining
Business analytics and data miningTony Nguyen
 
Big picture of data mining
Big picture of data miningBig picture of data mining
Big picture of data miningTony Nguyen
 
Data mining and knowledge discovery
Data mining and knowledge discoveryData mining and knowledge discovery
Data mining and knowledge discoveryTony Nguyen
 
How analysis services caching works
How analysis services caching worksHow analysis services caching works
How analysis services caching worksTony Nguyen
 
Hardware managed cache
Hardware managed cacheHardware managed cache
Hardware managed cacheTony Nguyen
 
Abstract data types
Abstract data typesAbstract data types
Abstract data typesTony Nguyen
 
Optimizing shared caches in chip multiprocessors
Optimizing shared caches in chip multiprocessorsOptimizing shared caches in chip multiprocessors
Optimizing shared caches in chip multiprocessorsTony Nguyen
 
Abstraction file
Abstraction fileAbstraction file
Abstraction fileTony Nguyen
 
Concurrency with java
Concurrency with javaConcurrency with java
Concurrency with javaTony Nguyen
 
Data structures and algorithms
Data structures and algorithmsData structures and algorithms
Data structures and algorithmsTony Nguyen
 
Object oriented programming-with_java
Object oriented programming-with_javaObject oriented programming-with_java
Object oriented programming-with_javaTony Nguyen
 
Cobol, lisp, and python
Cobol, lisp, and pythonCobol, lisp, and python
Cobol, lisp, and pythonTony Nguyen
 
Extending burp with python
Extending burp with pythonExtending burp with python
Extending burp with pythonTony Nguyen
 

More from Tony Nguyen (20)

Object oriented analysis
Object oriented analysisObject oriented analysis
Object oriented analysis
 
Directory based cache coherence
Directory based cache coherenceDirectory based cache coherence
Directory based cache coherence
 
Business analytics and data mining
Business analytics and data miningBusiness analytics and data mining
Business analytics and data mining
 
Big picture of data mining
Big picture of data miningBig picture of data mining
Big picture of data mining
 
Data mining and knowledge discovery
Data mining and knowledge discoveryData mining and knowledge discovery
Data mining and knowledge discovery
 
Cache recap
Cache recapCache recap
Cache recap
 
How analysis services caching works
How analysis services caching worksHow analysis services caching works
How analysis services caching works
 
Hardware managed cache
Hardware managed cacheHardware managed cache
Hardware managed cache
 
Abstract data types
Abstract data typesAbstract data types
Abstract data types
 
Optimizing shared caches in chip multiprocessors
Optimizing shared caches in chip multiprocessorsOptimizing shared caches in chip multiprocessors
Optimizing shared caches in chip multiprocessors
 
Abstract class
Abstract classAbstract class
Abstract class
 
Abstraction file
Abstraction fileAbstraction file
Abstraction file
 
Object model
Object modelObject model
Object model
 
Concurrency with java
Concurrency with javaConcurrency with java
Concurrency with java
 
Data structures and algorithms
Data structures and algorithmsData structures and algorithms
Data structures and algorithms
 
Inheritance
InheritanceInheritance
Inheritance
 
Object oriented programming-with_java
Object oriented programming-with_javaObject oriented programming-with_java
Object oriented programming-with_java
 
Cobol, lisp, and python
Cobol, lisp, and pythonCobol, lisp, and python
Cobol, lisp, and python
 
Extending burp with python
Extending burp with pythonExtending burp with python
Extending burp with python
 
Api crash
Api crashApi crash
Api crash
 

Recently uploaded

Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slidevu2urc
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProduct Anonymous
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking MenDelhi Call girls
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsJoaquim Jorge
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoffsammart93
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Igalia
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...Martijn de Jong
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Servicegiselly40
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherRemote DBA Services
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdflior mazor
 
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptxHampshireHUG
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfhans926745
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘RTylerCroy
 

Recently uploaded (20)

Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Service
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdf
 
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdf
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘
 

Data mining maximumlikelihood

  • 2. Likelihood The likelihood is the probability of the data given the model.
  • 3. If we flip a coin and get a head and we think the coin is unbiased, then the probability of observing this head is 0.5. If we think the coin is biased so that we expect to get a head 80% of the time, then the likelihood of observing this datum (a head) is 0.8. The likelihood of making some observation is entirely dependent on the model that underlies our assumption. The datum has not changed, our model has. Therefore under the new model the likelihood of observing the datum has changed. Likelihood
  • 4. Maximum Likelihood (ML) ML assumes a explicit model of sequence evolution. This is justifiable, since molecular sequence data can be shown to have arisen according to a stochastic process. ML attempts to answer the question: What is the probability that I would observe these data (a multiple sequence alignment) given a particular model of evolution (a tree and a process)?
  • 5. Likelihood calculations In molecular phylogenetics, the data are an alignment of sequences We optimize parameters and branch lengths to get the maximum likelihood Each site has a likelihood The total likelihood is the product of the site likelihoods The maximum likelihood tree is the tree topology that gives the highest (optimized) likelihood under the given model. We use reversible models, so the position of the root does not matter.
  • 6. What is the probability of observing a G nucleotide? If we have a DNA sequence of 1 nucleotide in length and the identity of this nucleotide is G, what is the likelihood that we would observe this G? In the same way as the coin-flipping observation, the likelihood of observing this G is dependent on the model of sequence evolution that is thought to underlie the data. Model 1: frequency of G = 0.4 => likelihood(G) = 0.4 Model 2: frequency of G = 0.1 => likelihood(G) = 0.1 Model 3: frequency of G = 0.25 => likelihood(G) = 0.25
  • 7. What about longer sequences? If we consider a gene of length 2 gene 1 GA The the probability of observing this gene is the product of the probabilities of observing each character Model frequency of G = 0.4 frequencyof A= 0.15 p(G) = 0.4 p(A) =0.15 Likelihood (GA) = 0.4 x 0.15 = 0.06
  • 8. …or even longer sequences? gene 1 GACTAGCTAGACAGATACGAATTAC Model simple base frequency model p(A)=0.15; p(C)=0.2; p(G)=0.4; p(T)=0.25; (the sum of all probabilities must equal 1) Likelihood (gene 1) = 0.000000000000000018452813
  • 9. Note about models You might notice that our model of base frequency is not the optimal model for our observed data. If we had used the following model p(A)=0.4; p(C) =0.2; p(G)= 0.2; p(T) = 0.2; The likelihood of observing the gene is L (gene 1) = 0.000000000000335544320000 L (gene 1) = 0.000000000000000018452813 The datum has not changed, our model has. Therefore under the new model the likelihood of observing the datum has changed.
  • 10. Increase in model sophistication It is no longer possible to simply invoke a model that encompasses base composition, we must also include the mechanism of sequence change and stasis. There are two parts to this model - the tree and the process (the latter is confusingly referred to as the model, although both parts really compose the model).
  • 11. Different Branch Lengths For very short branch lengths, the probability of a character staying the same is high and the probability of it changing is low. For longer branch lengths, the probability of character change becomes higher and the probability of staying the same is lower. The previous calculations are based on the assumption that the branch length describes one Certain Evolutionary Distance or CED. If we want to consider a branch length that is twice as long (2 CED), then we can multiply the substitution matrix by itself (matrix2 ).
  • 12. I (A) II (C) I (A) II (C) v = 0.1 v = 1.0 v = µt µ = mutation rate t = time ximum Likelihood Two trees each consisting of single branch
  • 13. Jukes-Cantor model I (A) II (C) I (A) II (C) v = 0.1 v = 1.0
  • 15. 1 j N 1 C G G A C A C G T T T A C 2 C A G A C A C C T C T A C 3 C G G A T A A G T T A A C 4 C G G A T A G C C T A G C 1 42 3 1 C 2 C 4 G 3 A 5 6 L(j) = p C C A G A A C C A G C A C C A G T T + p + … + p
  • 16. L(j) = p C C A G A A C C A G C A C C A G T T + p + … + p N L = L(1) • L(2) • … L(N) = ΠL(j)j = 1 N lnL = lnL(1) + lnL(2) + … L(N) = Σ lnL(j)j = 1
  • 17. Likelihood of the alignment at various branch lengths 0 0,00002 0,00004 0,00006 0,00008 0,0001 0,00012 0,00014 0,00016 0,00018 0,0002 0 0,1 0,2 0,3 0,4 0,5 0,6
  • 18. Strengths of ML • Does not try to make an observation of sequence change and then a correction for superimposed substitutions. There is no need to ‘correct’ for anything, the models take care of superimposed substitutions. • Accurate branch lengths. • Each site has a likelihood. • If the model is correct, we should retrieve the correct tree (If we have long-enough sequences and a sophisticated-enough model). • You can use a model that fits the data. • ML uses all the data (no selection of sites based on informativeness, all sites are informative). • ML can not only tell you about the phylogeny of the sequences, but also the process of evolution that led to the observations of today’s sequences.
  • 19. Weaknesses of ML • Can be inconsistent if we use models that are not accurate. • Model might not be sophisticated enough • Very computationally-intensive. Might not be possible to examine all models (substitution matrices, tree topologies).
  • 20. Models • You can use models that: Deal with different transition/transversion ratios. Deal with unequal base composition. Deal with heterogeneity of rates across sites. Deal with heterogeneity of the substitution process (different rates across lineages, different rates at different parts of the tree). • The more free parameters, the better your model fits your data (good). • The more free parameters, the higher the variance of the estimate (bad).
  • 21. Choosing a Model Don’t assume a model, rather find a model that fits your data. Models often have “free” parameters. These can be fixed to a reasonable value, or estimated by ML. The more free parameters, the better the fit (higher the likelihood) of the model to the data. (Good!) The more free parameters, the higher the variance, and the less power to discriminate among competing hypotheses. (Bad!) We do not want to over-fit the model to the data
  • 22. What is the best way to fit a line (a model) through these points? How to tell if adding (or removing) a certain parameter is a good idea? • Use statistics • The null hypothesis is that the presence or absence of the parameter makes no difference • In order to assess signifcance you need a null distribution
  • 23. We have some DNA data, and a tree. Evaluate the data with 3 different models. model ln likelihood ∆ JC -2348.68 K2P -2256.73 91.95 GTR -2254.94 1.79 Evaluations with more complex models have higher likelihoods The K2P model has 1 more parameter than the JC model The GTR model has 4 more parameters than the K2P model Are the extra parameters worth adding?
  • 24. JC vs K2P K2P vs GTR We have generated many true null hypothesis data sets and evaluated them under the JC model and the K2P model. 95% of the differences are under 2.The statistic for our original data set was 91.95, and so it is highly significant. In this case it is worthwhile to add the extra parameter (tRatio). We have generated many true null hypothesis data sets and evaluated them under the K2P model and the GTR model. The statistic for our original data set was 1.79, and so it is not signifcant. In this case it is not worthwhile to add the extra parameters. You can use the χ2 approximation to assess significance of adding parameters
  • 26. Maximum likelihood Search for tree that maximizes the chance of seeing the data (P (Data | Tree)) Bayesian Inference Search for tree that maximizes the chance of seeing the tree given the data (P (Tree | Data))
  • 27. Bayesian Phylogenetics Maximize the posterior probability of a tree given the aligned DNA sequences Two steps - Definition of the posterior probabilities of trees (Bayes’ Rule) - Approximation of the posterior probabilities of trees Markov chain Monte Carlo (MCMC) methods
  • 30.
  • 31. Markov Chain Monte Carlo Methods Posterior probabilities of trees are complex joint probabilities that cannot be calculated analytically. Instead, the posterior probabilities of trees are approximated with Markov Chain Monte Carlo (MCMC) methods that sample trees from their posterior probability distribution.
  • 32. MCMC A way of sampling / touring a set of solutions,biased by their likelihood 1 Make a random solution N1 the current solution 2 Pick another solution N2 3 If Likelihood (N1 < N2) then replace N1 with N2 4 Else if Random (Likelihood (N2) / Likelihood (N1)) then replace N1 with N2 5 Sample (record) the current solution 6 Repeat from step 2
  • 33.
  • 34.
  • 35.
  • 36.
  • 37.
  • 38.
  • 39.
  • 40.

Editor's Notes

  1. Even though we tend to refer to the tree and the model separately, they are in fact both parts of the model.