Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016

1. Crop losses due to fungi and oomycetes (filamentous plant pathogens) Fisher et al. 2012

2. Crop losses due to fungi and oomycetes (filamentous plant pathogens) Fisher et al. 2012

3. Veredeling voor resistentie niet geluktThe Irish potato famine pathogen Phytophthora infestans causes potato blight

4. Phytophthora Irish potato famine pathogen Greek for plant destroyer fungus-like oomycete

5. Ü Infection cycle and diversity Ü Evolutionary history Ü Genome architecture and evolution Ü Virulence mechanisms: effector biology Ü Host resistance and evasion of resistance Ü Breeding host resistance: prospects and challenges What you will learn – Phytophthora and the oomycetes

6. Fifi the oomycete is a scary parasite, With flagellated spores and hyphal threads She kills crops and triggers blight. Infection cycle and diversity

7. Infection cycle of Phytophthora infestans

8. Infection cycle of Phytophthora infestans Zoospore cyst appressorium Infection vesicle haustorium sporangium

9. Phytophthora infestans necrotrophy biotrophy Phytophthora infestans is a hemibiotroph – undergoes a biotrophic phase and then becomes necrotrophic

10. Filamentous growth of Phytophthora

11. Appressoria – Infection structures that enable penetration of plant tissue appressorium

12. Haustoria – Infection structures that enable nutrient uptake and secretion of effector proteins Coffey and Wilson, 1983 Tolga Bozkurt, Imperial College Extrahaustorial membrane (EHM) haustorium

13. Haustoria – pathogen infection structures that are surrounded by a host-derived membrane Bozkurt et al. Curr Opin Plant Biol 2012

14. Haustoria enable secretion of effector proteins and nutrient uptake suppress immunity, alter host physiology nutrients?

15. Asexual spores – finding the host and dispersal Sporangia and zoospores

16. a d c f g h ↓↓ ↓ ↓ ↓ ↓↓ ↓ ↓ ↓ b ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓↓ ↓ ↓ ↓ ↓↓ ↓ ↓ ↓ ↓↓ e ↓↓ ↓ ↓↓ ↓↓ ↓ ↓ ↓ ↓ * Phytophthora palmivora: Root tip (electrotaxis) Pythium aphanidermatum: Wound exudates (chemotaxis) Zoospore-root interactions

17. Fifi the oomycete is a scary parasite, With flagellated spores and hyphal threads She kills crops and triggers blight. Infection cycle and diversity

18. Oomycete phylogeny and diversity Colonized many ecological niches yet more than 60% of species are parasitic on plants

19. ■  Obligate biotrophic parasites: require living plants to grow, usually do not kill host plants ■  Largest number of species ■  Typically host specific/specialized parasites: one species infects one plant species ■  Best studied is Hyaloperonospora arabidopsidis (Hpa); infects host plant Arabidopsis thaliana Downy mildews

20. Variety of symptoms caused by downy mildews on plants

21. ■  Phytophthora are the most important pathogens of dicot plants, causing tens of billions of dollars of losses annually ■  Phytophthora infestans, the agent of late blight of potato and tomato, causes more crop losses than any other member of the genus ■  But there are many other species that are damaging to natural and agricultural ecosystems Phytophthora: “plant killers”

22. Phytophthora capsici causes blight on several vegetables

23. Phytophthora capsici causes blight on several vegetables

24. Phytophthora ramorum and Phytophthora kernoviae infect many native British woodland species and are a threat to the environment

25. Fifi the oomycete is a heterokont, they say, She’s fungus-like but the scientists Know how she had plastids one day. Evolutionary history

26. Phytophthora is an oomycete not a fungus

27. Oomycetes are fungus-like filamentous microbes: a unique group of eukaryotic plant pathogens Plant pathogens in greenAnimal parasites in redTree adapted from Embley and Martin (2006) Nature 440:623 (Heterokonts)

28. Christine Strullu-Derrien and Paul Kenrick @ Natural History Museum Oomycetes form an ancient eukaryotic lineage §  may have been parasitic ~300 million year ago §  present in the 407 million year-old Rhynie Chert, an ecosystem of plants, fungi and oomycetes

29. ■  Unrelated to fungi, more closely related to brown algae and diatoms in the Stramenopiles (Heterokonts) ■  Supported by molecular phylogenies based on ribosomal RNA sequences, compiled amino acid data for mitochondrial proteins, and protein encoding chromosomal genes ■  Exhibit fungal-like filamentous (hyphal) growth and several fungal-like morphological structures Oomycetes - Phylogeny

30. Fifi the oomycete has a big genome, they say, Full of repeats but don’t call it junk ‘cause can be handy one day. Genome architecture and evolution

31. Veredeling voor resistentie niet geluktWhy the misery? Why are oomycetes the scourge of farmers worldwide? §  Phytophthora are astonishing plant destroyers that can wipe out crops in days but the secret of their success is their ability to rapidly adapt to resistant plant varieties §  How did Phytophthora and other oomycetes manage to keep on changing and adapting to ensure their uninterrupted survival over evolutionary time?

32. 2006 maland e of the with the 10, 38). to ap- ntrol. In e vibra- dth are ence in owever, dths in to ma- ch long- ization. nterfer- splaced bility of obser- proper- ocesses, ted. 9 (2003). 990). Phys. 92, Mathies, Acad. Sci. . U.S.A. 97, 1 (2001). (2002). 7 (2002). J. 85, 5 (2004). ujimura, r, (2005). ler, 90). 01, 6629 New York, 1981). 33. D. Gelman, R. Kosloff, J. Chem. Phys. 123, 234506 (2005). 34. J. Hauer, H. Skenderovic, K.-L. Kompa, M. Motzkus, Chem. Phys. Lett. 421, 523 (2006). 35. D. Oesterhelt, W. Stoeckenius, in Methods in Enzymology, vol. 31 of Biomembranes (Academic Press, New York, 1974), pp. 667–678. 36. The saturation energy is related to the absorption cross section s as Es 0 1/strans (for a negligibly small contribution of the excited-state emission), and s is thank J.T.M. Kennis, Vrije Universiteit Amsterdam, for helpful discussions of preliminary results. Supporting Online Material www.sciencemag.org/cgi/content/full/313/5791/1257/DC1 Materials and Methods Figs. S1 to S5 References 1 June 2006; accepted 10 August 2006 10.1126/science.1130747 Phytophthora Genome Sequences Uncover Evolutionary Origins and Mechanisms of Pathogenesis Brett M. Tyler,1 * Sucheta Tripathy,1 Xuemin Zhang,1 Paramvir Dehal,2,3 Rays H. Y. Jiang,1,4 Andrea Aerts,2,3 Felipe D. Arredondo,1 Laura Baxter,5 Douda Bensasson,2,3,6 Jim L. Beynon,5 Jarrod Chapman,2,3,7 Cynthia M. B. Damasceno,8 Anne E. Dorrance,9 Daolong Dou,1 Allan W. Dickerman,1 Inna L. Dubchak,2,3 Matteo Garbelotto,10 Mark Gijzen,11 Stuart G. Gordon,9 Francine Govers,4 Niklaus J. Grunwald,12 Wayne Huang,2,14 Kelly L. Ivors,10,15 Richard W. Jones,16 Sophien Kamoun,9 Konstantinos Krampis,1 Kurt H. Lamour,17 Mi-Kyung Lee,18 W. Hayes McDonald,19 Mo´nica Medina,20 Harold J. G. Meijer,4 Eric K. Nordberg,1 Donald J. Maclean,21 Manuel D. Ospina-Giraldo,22 Paul F. Morris,23 Vipaporn Phuntumart,23 Nicholas H. Putnam,2,3 Sam Rash,2,13 Jocelyn K. C. Rose,24 Yasuko Sakihama,25 Asaf A. Salamov,2,3 Alon Savidor,17 Chantel F. Scheuring,18 Brian M. Smith,1 Bruno W. S. Sobral,1 Astrid Terry,2,13 Trudy A. Torto-Alalibo,1 Joe Win,9 Zhanyou Xu,18 Hongbin Zhang,18 Igor V. Grigoriev,2,3 Daniel S. Rokhsar,2,7 Jeffrey L. Boore2,3,26,27 Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae and the sudden oak death pathogen Phytophthora ramorum. Oo¨mycetes such as these Phytophthora species share the kingdom Stramenopila with photosynthetic algae such as diatoms, and the presence of many Phytophthora genes of probable phototroph origin supports a photosynthetic ancestry for the stramenopiles. Comparison of the two species’ genomes reveals a rapid expansion and diversification of many protein families associated with plant infection such as hydrolases, ABC transporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteins with similarity to known oo¨mycete avirulence genes. P hytophthora plant pathogens attack a wide range of agriculturally and orna- mentally important plants (1). Late blight of potato caused by Phytophthora infestans resulted in the Irish potato famine in the 19th cen- tury, and P. sojae costs the soybean industry millions of dollars each year. In California and Oregon, a newly emerged Phytophthora species, P. ramorum, is responsible for a disease called sudden oak death (2) that affects not only the live w.sciencemag.org SCIENCE VOL 313 1 SEPTEMBER 2006 1261 LETTERS Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans Brian J. Haas1 *, Sophien Kamoun2,3 *, Michael C. Zody1,4 , Rays H. Y. Jiang1,5 , Robert E. Handsaker1 , Liliana M. Cano2 , Manfred Grabherr1 , Chinnappa D. Kodira1 {, Sylvain Raffaele2 , Trudy Torto-Alalibo3 {, Tolga O. Bozkurt2 , Audrey M. V. Ah-Fong6 , Lucia Alvarado1 , Vicky L. Anderson7 , Miles R. Armstrong8 , Anna Avrova8 , Laura Baxter9 , JimBeynon9 ,PetraC.Boevink8 ,StephanieR.Bollmann10 ,JorunnI.B.Bos3 ,VincentBulone11 ,GuohongCai12 ,CahidCakir3 , James C. Carrington13 , Megan Chawner14 , Lucio Conti15 , Stefano Costanzo16 , Richard Ewan15 , Noah Fahlgren13 , Michael A. Fischbach17 , Johanna Fugelstad11 , Eleanor M. Gilroy8 , Sante Gnerre1 , Pamela J. Green18 , Laura J. Grenville-Briggs7 , John Griffith14 , Niklaus J. Gru¨nwald10 , Karolyn Horn14 , Neil R. Horner7 , Chia-Hui Hu19 , 3 18 2 2 20 Vol 461|17 September 2009|doi:10.1038/nature08358 2009

33. Features of sequenced oomycete genomes Figure 2. Features of sequenced oomycete pathogen genomes. The representative phylogeny depicts oomycete pathogens with sequenced genomes and was generated using Interactive Tree Of Life (iTOL) with National Center for Biotechnology Information (NCBI) taxonomy identifiers (branch lengths are arbitrary). Pathogen lifestyles and major variations in effector gene families are indicated along the tree branches. Potential loss of particular effector classes in a lineage is indicated by a red cross. The principal host, genome size, repetitive DNA content (as a percentage of genome size), gene space (the percentage of the genome encoding genes), number of protein-coding genes and number and percentage of proteins encoding predicted secreted proteins (secretome) are indicated from left to right for each pathogen. CRN, Crinkler; ND, not determined. Pythium ultimum Phytophthora ramorum Phytophthora infestans Phytophthora sojae Phytophthora parasitica Hyaloperonospora arabidopsidis Saprolegnia parasitica Albugo candida Albugo laibachii CRN effectors CHXC effectors Host Varied Arabidopsis Arabidopsis Vegetables Potato,tomato Varied Soybean Varied Fish Woody plants 53 80 65 100 45 53 Genome size (Mb) % Repetitive DNA content ND 39 17 ND 43 22 Protein coding genes 20,822 16,988 14,451 14,543 15,824 20,088 Secretome (%) 1,561 1,867 1,523 727 1,255 RefsOomycetes % gene space 32 28 31 17 43 49 (7.5) (11.0) (10.5) (5.0) (3.3)515 (6.2) NPP1 -like NPP1-like 64 19 1,17619,80529 (5.9) 240 74 18,155 1,588 (8.7)10 43 7 15,291 843 (5.5)44 37 28 13,032 413 (3.2)48 Plant Biotroph Plant Necrotroph Fish Saprotroph/Necrotroph Non-repetitive Repetitive Non-coding Coding Phytophthora capsici RXLR effectors YxSL[RK] & RXLR effectors YxSL[RK] effectors [6] [11] [12] [13] [13] [14] [15] [16] [17] [18] Apoplastic effectors Cytoplasmic effecttors Plant Hemibiotroph Key (i): Key (ii): Pais et al. Genome Biology 2013, 14:211 http://genomebiology.com/2013/14/6/211 Page 3 of 10 Pais et al. Genome Biology, 2013

34. The 240 Mbp genome of Phytophthora infestans – a repeat and transposon driven expansion

35. P. infestans P. sojae P. ramorum P. sojae P. infestans P. ramorum B. Haas, S. Kamoun et al. Nature, 2009 Phytophthora infestans genome architecture - repeat- rich and gene-poor loci interrupt colinear regions

36. RXLR Crinklers Protease inhibitors Phytophthora infestans genome: so many effectors! Apoplastic Host-translocated ~38 ~550 ~200 ~250ψ

37. P. infestans P. sojae P. ramorum P. sojae RXLR effector gene P. infestans P. ramorum B. Haas, S. Kamoun et al. Nature, 2009 RSLR 43 47 100221 AVRblb2 Host translocation Effector activity Signal Peptide Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci

38. Length of intergenic regions (kb) Nb of genes : 80-85 75-80 70-75 65-70 60-65 55-60 50-55 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 00-5 11-15 16-20 6-10 21-25 31-35 36-40 26-30 41-45 51-55 56-60 46-50 61-65 71-75 76-80 66-70 81-85 P. infestans (16442 genes) Core orthologs (7580) RXLR effectors (520) Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci B. Haas, S. Kamoun et al. Nature, 2009

39. The “two-speed genome” of P. infestans underpins high evolutionary potential P. sojae P. infestans P. ramorum §  Gene-sparse regions of genome show highest rates of structural and sequence variation, signatures of adaptive selection §  Gene-sparse regions underpin rapid evolution of virulence (effector) genes and host adaptation; cradle for adaptive evolution

40. Several filamentous plant pathogens (fungi and oomycetes) have a “two-speed” genome architecture A C D B

41. O, Fifi the oomycete Was as virulent as she’s been; and scientists say she secretes her way Inside potatoes and bean. Virulence mechanisms: effector biology

42. bacterium fungus oomycete haustorium apoplas4c eﬀectors plant cell Microbes alter plant cell processes using secreted “effector” molecules Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010 Cytoplasmic eﬀectors targets targets Alter plant cell processes Help microbe colonize plant

43. Ü Effectors have been described in bacteria, oomycetes, fungi, nematodes, insects etc. Ü Current paradigm - effector activities are key to understanding parasitism (and symbiosis) Ü Operationally effectors are plant proteins - Encoded by genes in pathogen genomes but function in (inside) plant cells Key concepts about plant pathogen effectors

44. Effectors - sensus Dawkins in “The extended phenotype: the long reach of the gene” p. 210, 1981 “...parasite genes having phenotypic expression in host bodies and behavior” Phytoplasmas see Saskia Hogenhout’s lectures

45. RXLR Crinklers Protease inhibitors The diverse effectors of Phytophthora infestans Apoplastic Host-translocated ~38 ~550 ~200 ~250ψ

46. Apoplastic effectors are typically small cysteine-rich secreted proteins - often get processed upon secretion - disulfide bridges provide stability in apoplast Targeting Function

47. (tomato cell) (apoplast) RCR3 PIP1 C14 CYP3 CatB1ALP CatB2 Immune response EPIC1 EPIC2B Phytophthora infestans Oomycete Phytophthora and fungal effectors inhibit the same plant immune proteases with Renier van der Hoorn Cladosporium fulvum Fungus AVR2

48. RLLR SEER 21 44 59 147 Signal Peptide 1 RSLR DEER 21 51 72 1521 Signal Peptide RFLR EER 23 54 69 1681 Signal Peptide PEX-RD3 IPIO1 NUK10 AVR3a RQLR GEERSignal Peptide 19 50 77 2131 Cytoplasmic effectors of oomycetes have a conserved domain defined by the RXLR motif Targeting Function

49. P. infestans RXLR effectors target a variety host proteins and processes Ü  AVR3a targets an E3 Ubiquitin Ligase CMPG1 to suppress immunity (Bos et al. PNAS, 2010) Ü  AVR2 targets a Kelch repeat phosphatase BSL1 to suppress immunity (Saunders et al. Plant Cell, 2012) Ü  PexRD54 binds ATG8 and antagonizes selective autophagy to counteract plant defense (Dagdas, Belhaj et al. eLife 2016) Ü  AVRblb2 interferes with secretion of cysteine protease C14 to counteract plant defense (Bozkurt et al. PNAS, 2011)

50. Kamoun & van der Hoorn Labs EPIC C14 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases

51. Kamoun & van der Hoorn Labs EPIC C14 C14 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases

52. Kamoun & van der Hoorn Labs EPIC C14 C14 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases

53. Kamoun & van der Hoorn Labs EPIC C14 AVRblb2 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases

54. Fifi the oomycete found A resistant plant that day, So she said, "Let's run and There’ll be no fun Until I mutate away." Host resistance and evasion of resistance

55. Resistance to Phytophthora infestans §  The Hypersensitive Response (HR): a programmed cell death response §  Activation of a plant immune receptor (R) by an effector

56. eﬀectors bacterium fungus oomycete haustorium plant cell Some effectors “trip the wire” and activate immunity in particular plant genotypes Alter plant cell processes targets NB-‐LRR/NLR immune receptors NLR-‐ triggered immunity Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010

57. eﬀectors bacterium fungus oomycete haustorium plant cell Concept: Host Resistance and Susceptibility genes Alter plant cell processes targets NB-‐LRR/NLR immune receptors NLR-‐ triggered immunity Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010 R S

58. Wheat Potato Tomato Corn Rice Barley Bacteria Nematodes Oomycetes Insects Fungi Viruses CCNB-ARCLRR(xxLxLxx) Plants utilize a ubiquitous disease resistance toolkit to defend against unrelated pathogens

59. NLR / NB-‐LRR immune receptors How do pathogen effectors evade immunity? AVR eﬀector §  Effectors evade activating immune receptors by acquiring stealthy mutations target §  But, they have to maintain their virulence activity! §  Still many effectors become nonfunctional (pseudogenes) or get deleted in the pathogen genome

60. Functional redundancy among pathogen effectors enables “bet-hedging” Ü Many effectors are functionally redundant; affect different steps or converge on same target Ü Functional redundancy enables robustness in the face of the evolving plant immune system Ü “Bet-hedging” Win, J., et al. Cold Spring Harbor Symposium on Quantitative Biology, 2013

61. For Fifi the oomycete Keeps evolving in her way, But don’t wave her goodbye, Don't you even try, She’ll be back again some day. Breeding host resistance: prospects and challenges

62. An arms race between the plant breeder/ biotechnologist and the pathogen? •  Ability of the pathogen to adapt is astounding •  “Don’t bet against the pathogen” – silver bullet solutions unlikely to be durable •  Framework to rapidly generate new resistance specificities and introduce these traits into crop genomes •  Can we generate and deploy new resistance traits faster than the pathogen can evolve?

63. HOME / SCIENCE : THE STATE OF THE UNIVERSE. No, You Shouldn’t Fear GMO Corn How Elle botched a story about genetically modified food. By Jon Entine Posted Wednesday, Aug. 7, 2013, at 2:45 PM | 1.2k 1784 Like 5.1k TweetTweet 181 NEW

64. ... for peace of mind in potato cultivation UNDER DEVELOPMENTFOR YOURCONVENIENCE On top of that, you have to ensure that the weather is favorable in terms of wind strength and precipitation. If you want to put an end to precisely that situation, Fortuna is the right potato variety for you, as it provides lasting protection against late blight. So there’s no more need for you to regularly inspect your fields and check for signs of this disease. With Fortuna, you no longer have to worry about the right time and the right weather. And best of all, when you plant out your crops you can look for- ward to an extremely high yield and outstanding quality without any stress. What is Fortuna? Fortuna is a further development of the leading European potato variety used for making fries. Fortuna is identical to its parent variety, but has one key additional benefit: It provides complete protection against late blight. Fortuna therefore offers impressively high tuber yield and thanks to its tuber form, color and taste, it satisfies all the requirements to be used in making fries or as fresh produce. How was Fortuna developed? Dutch researchers have undertaken extensive research into the special resistance of the wild potato. They managed to identify the genes which give the wild potato protection against late blight. Agricultural and biotechnological experts at BASF then transferred these genes to the leading French fries potato variety using the soil bacterium Agrobacterium. This resulted in Fortuna which is equipped with the wild potato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. Why is Fortuna so useful to you? If you’re a potato farmer, you’re sure to be fami- liar with the following situation. July and August are mainly wet. Late blight attacks all of your potato fields, which you cared for intensively throughout the whole year. All you can do is wait until the rain subsides and machinery can move on the soil again. Now you have the problem of, on the one hand, choosing the right time to use fungicides to protect against late blight. On the other hand, you don‘t want to risk driving on the land and causing soil compaction. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes 20 30 40 A 50 Application against Alternaria (A) and Phytophthora (P) 60 A 70 80 Fungicide treatments in Fortuna (due to lasting Phytophthora resistance) Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora tato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes

65. ... for peace of mind in potato cultivation UNDER DEVELOPMENTFOR YOURCONVENIENCE On top of that, you have to ensure that the weather is favorable in terms of wind strength and precipitation. If you want to put an end to precisely that situation, Fortuna is the right potato variety for you, as it provides lasting protection against late blight. So there’s no more need for you to regularly inspect your fields and check for signs of this disease. With Fortuna, you no longer have to worry about the right time and the right weather. And best of all, when you plant out your crops you can look for- ward to an extremely high yield and outstanding quality without any stress. What is Fortuna? Fortuna is a further development of the leading European potato variety used for making fries. Fortuna is identical to its parent variety, but has one key additional benefit: It provides complete protection against late blight. Fortuna therefore offers impressively high tuber yield and thanks to its tuber form, color and taste, it satisfies all the requirements to be used in making fries or as fresh produce. How was Fortuna developed? Dutch researchers have undertaken extensive research into the special resistance of the wild potato. They managed to identify the genes which give the wild potato protection against late blight. Agricultural and biotechnological experts at BASF then transferred these genes to the leading French fries potato variety using the soil bacterium Agrobacterium. This resulted in Fortuna which is equipped with the wild potato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. Why is Fortuna so useful to you? If you’re a potato farmer, you’re sure to be fami- liar with the following situation. July and August are mainly wet. Late blight attacks all of your potato fields, which you cared for intensively throughout the whole year. All you can do is wait until the rain subsides and machinery can move on the soil again. Now you have the problem of, on the one hand, choosing the right time to use fungicides to protect against late blight. On the other hand, you don‘t want to risk driving on the land and causing soil compaction. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes 20 30 40 A 50 Application against Alternaria (A) and Phytophthora (P) 60 A 70 80 Fungicide treatments in Fortuna (due to lasting Phytophthora resistance) Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora tato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes

66. Ü Genomics-enabled gene mapping and cloning Ü Impacting plant breeding: from Marker Assisted Selection (MAS) to Genomic Selection (GS) Ü Applicable to both Resistance and Susceptibility genes Next-generation crop (disease resistance) breeding A RT I C L E S Genome sequencing reveals agronomically important loci in rice using MutMap Akira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, 3,4 3 3 3 5 6 ved. A RT I C L E S Genome sequencing reveals agronomically important loci in rice using MutMap Akira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6, Sophien Kamoun6 & Ryohei Terauchi3 The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a

67. BACTERIA MAY NOT ELICIT MUCH SYMPA- thy from us eukaryotes, but they, too, can get sick. That’s potentially a big problem for the dairy industry, which often depends on bacteria such as Streptococcus thermophilus to make yogurts and cheeses. S. thermophilus breaks down the milk sugar lactose into tangy lactic acid. But certain viruses—bacterio- phages, or simply phages—can debilitate the pany now owned by DuPont, found a way to boost the phage defenses of this workhouse microbe. They exposed the bacterium to a phage and showed that this essentially vaccinated it against that virus (Science, 23 March 2007, p. 1650). The trick has enabled DuPont to create heartier bacterial strains for food production. It also revealed something fundamental: Bacteria have a become important for more than food scientists and microbiologists, because of a valu- able feature: It takes aim at specific DNA sequences. In January, four research teams reported harnessing the system, called CRISPR for peculiar features in the DNA of bacteria that deploy it, to target the destruc- tion of specific genes in human cells. And in the following 8 months, various groups have The CRISPR CrazeA bacterial immune system yields a potentially revolutionary genome-editing technique IENCE/SCIENCESOURCE Fighting invasion. When viruses (green) attack bacteria, the bacteria respond with DNA-targeting defenses that biologists have learned to exploit for genetic engineering. onAugust23,2013www.sciencemag.orgDownloadedfrom www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013 BACTERIA MAY NOT ELICIT MUCH SYMPA- thy from us eukaryotes, but they, too, can get sick. That’s potentially a big problem for the dairy industry, which often depends on bacteria such as Streptococcus thermophilus to make yogurts and cheeses. S. thermophilus breaks down the milk sugar lactose into tangy lactic acid. But certain viruses—bacterio- phages, or simply phages—can debilitate the bacterium, wreaking havoc on the quality or quantity of the food it helps produce. In 2007, scientists from Danisco, a Copenhagen-based food ingredient com- pany now owned by DuPont, found a way to boost the phage defenses of this workhouse microbe. They exposed the bacterium to a phage and showed that this essentially vaccinated it against that virus (Science, 23 March 2007, p. 1650). The trick has enabled DuPont to create heartier bacterial strains for food production. It also revealed something fundamental: Bacteria have a kind of adaptive immune system, which enables them to fight off repeated attacks by specific phages. That immune system has suddenly become important for more than food scientists and microbiologists, because of a valu- able feature: It takes aim at specific DNA sequences. In January, four research teams reported harnessing the system, called CRISPR for peculiar features in the DNA of bacteria that deploy it, to target the destruc- tion of specific genes in human cells. And in the following 8 months, various groups have used it to delete, add, activate, or suppress targeted genes in human cells, mice, rats, zebra- fish, bacteria, fruit flies, yeast, nematodes, and crops, demonstrating broad utility for the The CRISPR CrazeA bacterial immune system yields a potentially revolutionary genome-editing technique CREDIT:EYEOFSCIENCE/SCIENCESOURCE for genetic engineering. Published by AAAS infects plant scientists

68. REVIEW Open Access Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system Khaoula Belhaj† , Angela Chaparro-Garcia† , Sophien Kamoun* and Vladimir Nekrasov* Abstract Targeted genome engineering (also known as genome editing) has emerged as an alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants. Until recently, available tools for introducing site-specific double strand DNA breaks were restricted to zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs). However, these technologies have not been widely adopted by the plant research community due to complicated design and laborious assembly of specific DNA binding proteins for each target gene. Recently, an easier method has emerged based on the bacterial type II CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) immune system. The CRISPR/Cas system allows targeted cleavage of genomic DNA guided by a customizable small noncoding RNA, resulting in gene modifications by both non-homologous end joining (NHEJ) and homology-directed repair (HDR) mechanisms. In this review we summarize and discuss recent applications of the CRISPR/Cas technology in plants. Keywords: CRISPR, Cas9, Plant, Genome editing, Genome engineering, Targeted mutagenesis Introduction Targeted genome engineering has emerged as an alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants and ensure sustainable food production. However, until recently the available methods have proven cumbersome. Both zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs) based on the Cas9 nuclease and an engineered single guide RNA (sgRNA) that specifies a targeted nucleic acid sequence. Given that only a single RNA is required to generate target specificity, the CRISPR/Cas system promises to be more easily applicable to genome engineering than ZFNs and TALENs. Recently, eight reports describing the first applications PLANT METHODS Belhaj et al. Plant Methods 2013, 9:39 http://www.plantmethods.com/content/9/1/39

69. Humans have been modifying the genomes of animals and plants… …using mutagens (chemicals, irradiation) and selective breeding §  We are now moving into an era of precise genome editing (synthetic biology, biohacking etc.); ultimate in editing §  Accessing and generating genetic diversity will not be a limiting factor anymore; key is to know which genes influence agronomically important traits

70. 500 - 400 - 300 - bp 1 2 8 10WT 500 - 400 - 300 - bp 200 - 1 2 83 4 5 6 7 9 10 ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG! ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG! ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48! ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48! ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48! ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49! WT Plant 1 Plant 2 Plant 8 Plant 10 PAM PAMTarget 1 Target 2 500 - 400 - 300 - 8-1 500 - 400 - 300 - bp 8-2 8-3 8-4 8-5 WT 8-6 SlMlo1 T-DNA 8-4 T-DNA: - - +- WT slmlo1& 8-6 b c d e f Figure 1 Transform with Cas9/sgRNAs Callus tissue T0 plantlets T1 seeds slmlo1 T-DNA segregating Regenerate T0 plants and screen for slmlo1 homozygotes Screen T1 generation for T-DNA-free plants 3.5 months T2 seeds slmlo1 T-DNA-free 0 3 6 9.5 Time, months3 months 3 months 3.5 months Tomelo – A DNA deletion results in fungus resistance Tomelo – A DNA deletion in the S gene mlo results in resistance to powdery mildew fungus Vladimir Nekrasov

71. Deletion of CMPG1 in tomato reduces infection by P. infestans Lesionsize(mm2) Wild-Type cmpg1 mutants Mutant 1 Mutant 2 Mutant 3 P. infestans 88069 (5 dpi) Wild-Type cmpg1 mutant Angela Chaparro-Garcia

Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016

You are reading a preview.

Check these out next

Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016

More Related Content

Slideshows for you (20)

Viewers also liked (20)

Similar to Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016 (20)

More from Sophien Kamoun (9)

Recently uploaded (20)