SlideShare a Scribd company logo
1 of 80
Download to read offline
Crop losses due to
fungi and oomycetes
(filamentous plant
pathogens)
Fisher et al. 2012
Crop losses due to
fungi and oomycetes
(filamentous plant
pathogens)
Fisher et al. 2012
Veredeling voor resistentie niet geluktThe Irish potato famine pathogen Phytophthora infestans
causes potato blight
Phytophthora
Irish potato famine pathogen
Greek for plant destroyer
fungus-like oomycete
Ü Infection cycle and diversity
Ü Evolutionary history
Ü Genome architecture and evolution
Ü Virulence mechanisms: effector biology
Ü Host resistance and evasion of resistance
Ü Breeding host resistance: prospects and challenges
What you will learn – Phytophthora and the oomycetes
Fifi the oomycete is a scary parasite,
With flagellated spores and hyphal threads
She kills crops and triggers blight.
Infection cycle and diversity
Infection cycle of Phytophthora infestans
Infection cycle of Phytophthora infestans
Zoospore
cyst
appressorium
Infection
vesicle
haustorium
sporangium
Phytophthora infestans
necrotrophy
biotrophy
Phytophthora infestans is a hemibiotroph –
undergoes a biotrophic phase and then becomes necrotrophic
Filamentous growth of Phytophthora
Appressoria – Infection structures that enable
penetration of plant tissue
appressorium
Haustoria – Infection structures that enable
nutrient uptake and secretion of effector proteins
Coffey and Wilson, 1983
Tolga Bozkurt, Imperial College
Extrahaustorial
membrane (EHM)
haustorium
Haustoria – pathogen infection structures that are
surrounded by a host-derived membrane
Bozkurt et al. Curr Opin Plant Biol 2012
Haustoria enable secretion of effector proteins
and nutrient uptake
suppress immunity,
alter host physiology
nutrients?
Asexual spores – finding the host and dispersal
Sporangia and zoospores
a d
c f
g h
↓↓
↓
↓
↓
↓↓
↓
↓
↓
b
↓ ↓ ↓ ↓
↓ ↓ ↓ ↓
↓ ↓
↓ ↓
↓↓
↓
↓
↓ ↓↓
↓
↓
↓
↓↓
e
↓↓
↓ ↓↓
↓↓
↓
↓
↓ ↓
*
Phytophthora palmivora:
Root tip (electrotaxis)
Pythium aphanidermatum:
Wound exudates (chemotaxis)
Zoospore-root
interactions
Fifi the oomycete is a scary parasite,
With flagellated spores and hyphal threads
She kills crops and triggers blight.
Infection cycle and diversity
Oomycete phylogeny and diversity
Colonized many ecological niches
yet more than 60% of species are
parasitic on plants
■  Obligate biotrophic parasites: require living plants
to grow, usually do not kill host plants
■  Largest number of species
■  Typically host specific/specialized parasites: one
species infects one plant species
■  Best studied is Hyaloperonospora arabidopsidis
(Hpa); infects host plant Arabidopsis thaliana
Downy mildews
Variety of symptoms caused by downy mildews on plants
■  Phytophthora are the most important pathogens of
dicot plants, causing tens of billions of dollars of
losses annually
■  Phytophthora infestans, the agent of late blight of
potato and tomato, causes more crop losses than
any other member of the genus
■  But there are many other species that are
damaging to natural and agricultural ecosystems
Phytophthora: “plant killers”
Phytophthora capsici causes blight on several vegetables
Phytophthora capsici causes blight on several vegetables
Phytophthora ramorum and Phytophthora kernoviae infect many native
British woodland species and are a threat to the environment
Fifi the oomycete is a heterokont, they say,
She’s fungus-like but the scientists
Know how she had plastids one day.
Evolutionary history
Phytophthora is an oomycete not a fungus
Oomycetes are fungus-like filamentous microbes:
a unique group of eukaryotic plant pathogens
Plant pathogens in greenAnimal parasites in redTree adapted from Embley and Martin (2006) Nature 440:623
(Heterokonts)
Christine Strullu-Derrien and Paul Kenrick
@ Natural History Museum
Oomycetes form an ancient
eukaryotic lineage
§  may have been parasitic ~300
million year ago
§  present in the 407 million year-old
Rhynie Chert, an ecosystem of
plants, fungi and oomycetes
■  Unrelated to fungi, more closely related to brown
algae and diatoms in the Stramenopiles
(Heterokonts)
■  Supported by molecular phylogenies based on
ribosomal RNA sequences, compiled amino acid data
for mitochondrial proteins, and protein encoding
chromosomal genes
■  Exhibit fungal-like filamentous (hyphal) growth and
several fungal-like morphological structures
Oomycetes - Phylogeny
Fifi the oomycete has a big genome, they say,
Full of repeats but don’t call it junk
‘cause can be handy one day.
Genome architecture and evolution
Veredeling voor resistentie niet geluktWhy the misery? Why are oomycetes the scourge of
farmers worldwide?
§  Phytophthora are astonishing plant destroyers that can
wipe out crops in days but the secret of their success is
their ability to rapidly adapt to resistant plant varieties
§  How did Phytophthora and other oomycetes manage to
keep on changing and adapting to ensure their
uninterrupted survival over evolutionary time?
2006
maland
e of the
with the
10, 38).
to ap-
ntrol. In
e vibra-
dth are
ence in
owever,
dths in
to ma-
ch long-
ization.
nterfer-
splaced
bility of
obser-
proper-
ocesses,
ted.
9 (2003).
990).
Phys. 92,
Mathies,
Acad. Sci.
.
U.S.A. 97,
1 (2001).
(2002).
7 (2002).
J. 85,
5 (2004).
ujimura,
r,
(2005).
ler,
90).
01, 6629
New York, 1981).
33. D. Gelman, R. Kosloff, J. Chem. Phys. 123, 234506 (2005).
34. J. Hauer, H. Skenderovic, K.-L. Kompa, M. Motzkus, Chem.
Phys. Lett. 421, 523 (2006).
35. D. Oesterhelt, W. Stoeckenius, in Methods in Enzymology,
vol. 31 of Biomembranes (Academic Press, New York,
1974), pp. 667–678.
36. The saturation energy is related to the absorption cross
section s as Es 0 1/strans (for a negligibly small
contribution of the excited-state emission), and s is
thank J.T.M. Kennis, Vrije Universiteit Amsterdam, for
helpful discussions of preliminary results.
Supporting Online Material
www.sciencemag.org/cgi/content/full/313/5791/1257/DC1
Materials and Methods
Figs. S1 to S5
References
1 June 2006; accepted 10 August 2006
10.1126/science.1130747
Phytophthora Genome Sequences
Uncover Evolutionary Origins and
Mechanisms of Pathogenesis
Brett M. Tyler,1
* Sucheta Tripathy,1
Xuemin Zhang,1
Paramvir Dehal,2,3
Rays H. Y. Jiang,1,4
Andrea Aerts,2,3
Felipe D. Arredondo,1
Laura Baxter,5
Douda Bensasson,2,3,6
Jim L. Beynon,5
Jarrod Chapman,2,3,7
Cynthia M. B. Damasceno,8
Anne E. Dorrance,9
Daolong Dou,1
Allan W. Dickerman,1
Inna L. Dubchak,2,3
Matteo Garbelotto,10
Mark Gijzen,11
Stuart G. Gordon,9
Francine Govers,4
Niklaus J. Grunwald,12
Wayne Huang,2,14
Kelly L. Ivors,10,15
Richard W. Jones,16
Sophien Kamoun,9
Konstantinos Krampis,1
Kurt H. Lamour,17
Mi-Kyung Lee,18
W. Hayes McDonald,19
Mo´nica Medina,20
Harold J. G. Meijer,4
Eric K. Nordberg,1
Donald J. Maclean,21
Manuel D. Ospina-Giraldo,22
Paul F. Morris,23
Vipaporn Phuntumart,23
Nicholas H. Putnam,2,3
Sam Rash,2,13
Jocelyn K. C. Rose,24
Yasuko Sakihama,25
Asaf A. Salamov,2,3
Alon Savidor,17
Chantel F. Scheuring,18
Brian M. Smith,1
Bruno W. S. Sobral,1
Astrid Terry,2,13
Trudy A. Torto-Alalibo,1
Joe Win,9
Zhanyou Xu,18
Hongbin Zhang,18
Igor V. Grigoriev,2,3
Daniel S. Rokhsar,2,7
Jeffrey L. Boore2,3,26,27
Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae and
the sudden oak death pathogen Phytophthora ramorum. Oo¨mycetes such as these Phytophthora
species share the kingdom Stramenopila with photosynthetic algae such as diatoms, and the
presence of many Phytophthora genes of probable phototroph origin supports a photosynthetic
ancestry for the stramenopiles. Comparison of the two species’ genomes reveals a rapid expansion
and diversification of many protein families associated with plant infection such as hydrolases, ABC
transporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteins
with similarity to known oo¨mycete avirulence genes.
P
hytophthora plant pathogens attack a
wide range of agriculturally and orna-
mentally important plants (1). Late blight
of potato caused by Phytophthora infestans re-
sulted in the Irish potato famine in the 19th cen-
tury, and P. sojae costs the soybean industry
millions of dollars each year. In California and
Oregon, a newly emerged Phytophthora species,
P. ramorum, is responsible for a disease called
sudden oak death (2) that affects not only the live
w.sciencemag.org SCIENCE VOL 313 1 SEPTEMBER 2006 1261
LETTERS
Genome sequence and analysis of the Irish potato
famine pathogen Phytophthora infestans
Brian J. Haas1
*, Sophien Kamoun2,3
*, Michael C. Zody1,4
, Rays H. Y. Jiang1,5
, Robert E. Handsaker1
, Liliana M. Cano2
,
Manfred Grabherr1
, Chinnappa D. Kodira1
{, Sylvain Raffaele2
, Trudy Torto-Alalibo3
{, Tolga O. Bozkurt2
,
Audrey M. V. Ah-Fong6
, Lucia Alvarado1
, Vicky L. Anderson7
, Miles R. Armstrong8
, Anna Avrova8
, Laura Baxter9
,
JimBeynon9
,PetraC.Boevink8
,StephanieR.Bollmann10
,JorunnI.B.Bos3
,VincentBulone11
,GuohongCai12
,CahidCakir3
,
James C. Carrington13
, Megan Chawner14
, Lucio Conti15
, Stefano Costanzo16
, Richard Ewan15
, Noah Fahlgren13
,
Michael A. Fischbach17
, Johanna Fugelstad11
, Eleanor M. Gilroy8
, Sante Gnerre1
, Pamela J. Green18
,
Laura J. Grenville-Briggs7
, John Griffith14
, Niklaus J. Gru¨nwald10
, Karolyn Horn14
, Neil R. Horner7
, Chia-Hui Hu19
,
3 18 2 2 20
Vol 461|17 September 2009|doi:10.1038/nature08358
2009
Features of sequenced oomycete genomes
Figure 2. Features of sequenced oomycete pathogen genomes. The representative phylogeny depicts oomycete pathogens with sequenced
genomes and was generated using Interactive Tree Of Life (iTOL) with National Center for Biotechnology Information (NCBI) taxonomy identifiers
(branch lengths are arbitrary). Pathogen lifestyles and major variations in effector gene families are indicated along the tree branches. Potential
loss of particular effector classes in a lineage is indicated by a red cross. The principal host, genome size, repetitive DNA content (as a percentage
of genome size), gene space (the percentage of the genome encoding genes), number of protein-coding genes and number and percentage of
proteins encoding predicted secreted proteins (secretome) are indicated from left to right for each pathogen. CRN, Crinkler; ND, not determined.
Pythium ultimum
Phytophthora ramorum
Phytophthora infestans
Phytophthora sojae
Phytophthora parasitica
Hyaloperonospora arabidopsidis
Saprolegnia parasitica
Albugo candida
Albugo laibachii
CRN
effectors
CHXC effectors
Host
Varied
Arabidopsis
Arabidopsis
Vegetables
Potato,tomato
Varied
Soybean
Varied
Fish
Woody plants
53
80
65
100
45
53
Genome
size (Mb)
% Repetitive
DNA content
ND
39
17
ND
43
22
Protein
coding genes
20,822
16,988
14,451
14,543
15,824
20,088
Secretome (%)
1,561
1,867
1,523
727
1,255
RefsOomycetes
% gene
space
32
28
31
17
43
49
(7.5)
(11.0)
(10.5)
(5.0)
(3.3)515
(6.2)
NPP1
-like
NPP1-like
64 19 1,17619,80529 (5.9)
240 74 18,155 1,588 (8.7)10
43 7 15,291 843 (5.5)44
37 28 13,032 413 (3.2)48
Plant Biotroph
Plant Necrotroph Fish Saprotroph/Necrotroph
Non-repetitive Repetitive Non-coding Coding
Phytophthora capsici
RXLR effectors
YxSL[RK]
& RXLR
effectors
YxSL[RK] effectors
[6]
[11]
[12]
[13]
[13]
[14]
[15]
[16]
[17]
[18]
Apoplastic effectors Cytoplasmic effecttors
Plant Hemibiotroph
Key (i): Key (ii):
Pais et al. Genome Biology 2013, 14:211
http://genomebiology.com/2013/14/6/211
Page 3 of 10
Pais et al. Genome Biology, 2013
The 240 Mbp genome of Phytophthora infestans
– a repeat and transposon driven expansion
P. infestans
P. sojae
P. ramorum
P. sojae
P. infestans
P. ramorum
B. Haas, S. Kamoun et al. Nature, 2009
Phytophthora infestans genome architecture - repeat-
rich and gene-poor loci interrupt colinear regions
RXLR
Crinklers
Protease inhibitors
Phytophthora infestans genome: so many effectors!
Apoplastic
Host-translocated
~38
~550
~200
~250ψ
P. infestans
P. sojae
P. ramorum
P. sojae RXLR effector gene
P. infestans
P. ramorum
B. Haas, S. Kamoun et al. Nature, 2009
RSLR
43 47 100221
AVRblb2
Host translocation Effector activity
Signal Peptide
Phytophthora infestans effectors typically occur
in the expanded, repeat-rich and gene-poor loci
Length of intergenic regions (kb)
Nb of genes :
80-85
75-80
70-75
65-70
60-65
55-60
50-55
45-50
40-45
35-40
30-35
25-30
20-25
15-20
10-15
5-10
0-5
16
15
14
13
12
11
10
9
8
7
6
5
4
3
2
1
00-5
11-15
16-20
6-10
21-25
31-35
36-40
26-30
41-45
51-55
56-60
46-50
61-65
71-75
76-80
66-70
81-85
P. infestans (16442 genes)
Core orthologs (7580) RXLR effectors (520)
Phytophthora infestans effectors typically occur
in the expanded, repeat-rich and gene-poor loci
B. Haas, S. Kamoun et al. Nature, 2009
The “two-speed genome” of P. infestans
underpins high evolutionary potential
P. sojae
P. infestans
P. ramorum
§  Gene-sparse regions of genome show highest rates of structural
and sequence variation, signatures of adaptive selection
§  Gene-sparse regions underpin rapid evolution of virulence (effector)
genes and host adaptation; cradle for adaptive evolution
Several filamentous plant pathogens (fungi and
oomycetes) have a “two-speed” genome architecture
A C
D
B
O, Fifi the oomycete
Was as virulent as she’s been;
and scientists say she secretes her way
Inside potatoes and bean.
Virulence mechanisms: effector biology
bacterium	
  
fungus	
  
oomycete	
  
haustorium	
  
apoplas4c	
  effectors	
  
plant	
  cell	
  
Microbes alter plant cell processes
using secreted “effector” molecules
Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and
Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
Cytoplasmic	
  
effectors	
  
targets	
  
targets	
  
Alter	
  plant	
  cell	
  
processes	
  
Help	
  microbe	
  
colonize	
  plant	
  
Ü Effectors have been described in bacteria, oomycetes,
fungi, nematodes, insects etc.
Ü Current paradigm - effector activities are key to
understanding parasitism (and symbiosis)
Ü Operationally effectors are plant proteins - Encoded by
genes in pathogen genomes but function in (inside)
plant cells
Key concepts about plant pathogen effectors
Effectors - sensus Dawkins in “The extended
phenotype: the long reach of the gene” p. 210, 1981
“...parasite genes
having phenotypic
expression in host
bodies and behavior”
Phytoplasmas
see Saskia Hogenhout’s lectures
RXLR
Crinklers
Protease inhibitors
The diverse effectors of Phytophthora infestans
Apoplastic
Host-translocated
~38
~550
~200
~250ψ
Apoplastic effectors are typically
small cysteine-rich secreted proteins
- often get processed upon secretion
- disulfide bridges provide stability in apoplast
Targeting Function
(tomato cell)
(apoplast)
RCR3 PIP1 C14 CYP3 CatB1ALP CatB2
Immune response
EPIC1
EPIC2B
Phytophthora infestans
Oomycete
Phytophthora and fungal effectors inhibit the same
plant immune proteases
with Renier van der Hoorn
Cladosporium fulvum
Fungus
AVR2
RLLR SEER
21 44 59 147
Signal Peptide
1
RSLR DEER
21 51 72 1521
Signal Peptide
RFLR EER
23 54 69 1681
Signal Peptide
PEX-RD3
IPIO1
NUK10
AVR3a
RQLR GEERSignal Peptide
19 50 77 2131
Cytoplasmic effectors of oomycetes have
a conserved domain defined by the RXLR motif
Targeting Function
P. infestans RXLR effectors target a variety host
proteins and processes
Ü  AVR3a targets an E3 Ubiquitin Ligase CMPG1 to suppress
immunity (Bos et al. PNAS, 2010)
Ü  AVR2 targets a Kelch repeat phosphatase BSL1 to suppress
immunity (Saunders et al. Plant Cell, 2012)
Ü  PexRD54 binds ATG8 and antagonizes selective autophagy to
counteract plant defense (Dagdas, Belhaj et al. eLife 2016)
Ü  AVRblb2 interferes with secretion of cysteine protease C14 to
counteract plant defense (Bozkurt et al. PNAS, 2011)
Kamoun & van der Hoorn Labs
EPIC
C14
P. infestans evolved distinct effectors and
mechanisms to interfere with apoplastic proteases
Kamoun & van der Hoorn Labs
EPIC
C14
C14
P. infestans evolved distinct effectors and
mechanisms to interfere with apoplastic proteases
Kamoun & van der Hoorn Labs
EPIC
C14
C14
P. infestans evolved distinct effectors and
mechanisms to interfere with apoplastic proteases
Kamoun & van der Hoorn Labs
EPIC
C14
AVRblb2
P. infestans evolved distinct effectors and
mechanisms to interfere with apoplastic proteases
Fifi the oomycete found
A resistant plant that day,
So she said, "Let's run and
There’ll be no fun
Until I mutate away."
Host resistance and evasion of resistance
Resistance to Phytophthora infestans
§  The Hypersensitive Response
(HR): a programmed cell
death response
§  Activation of a plant immune
receptor (R) by an effector
effectors	
  
bacterium	
  
fungus	
  
oomycete	
  
haustorium	
  
plant	
  cell	
  
Some effectors “trip the wire” and activate
immunity in particular plant genotypes
Alter	
  plant	
  cell	
  
processes	
  
targets	
  
NB-­‐LRR/NLR	
  
immune	
  receptors	
  
NLR-­‐	
  
triggered	
  
immunity	
  
Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and
Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
effectors	
  
bacterium	
  
fungus	
  
oomycete	
  
haustorium	
  
plant	
  cell	
  
Concept: Host Resistance and Susceptibility genes
Alter	
  plant	
  cell	
  
processes	
  
targets	
  
NB-­‐LRR/NLR	
  
immune	
  receptors	
  
NLR-­‐	
  
triggered	
  
immunity	
  
Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and
Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
R
S
Wheat
Potato
Tomato
Corn
Rice
Barley
Bacteria
Nematodes
Oomycetes
Insects
Fungi
Viruses
CCNB-ARCLRR(xxLxLxx)
Plants utilize a ubiquitous disease resistance toolkit
to defend against unrelated pathogens
NLR	
  /	
  NB-­‐LRR	
  
immune	
  receptors	
  
How do pathogen effectors evade immunity?
AVR	
  effector	
  
§  Effectors evade activating
immune receptors by
acquiring stealthy mutations
target	
  
§  But, they have to maintain
their virulence activity!
§  Still many effectors become
nonfunctional (pseudogenes)
or get deleted in the pathogen
genome
Functional redundancy among pathogen
effectors enables “bet-hedging”
Ü Many effectors are functionally
redundant; affect different steps
or converge on same target
Ü Functional redundancy enables
robustness in the face of the
evolving plant immune system
Ü “Bet-hedging”
Win, J., et al. Cold Spring Harbor Symposium on Quantitative Biology, 2013
For Fifi the oomycete
Keeps evolving in her way,
But don’t wave her goodbye,
Don't you even try,
She’ll be back again some day.
Breeding host resistance: prospects and challenges
An arms race between the plant breeder/
biotechnologist and the pathogen?
•  Ability of the pathogen to adapt is astounding
•  “Don’t bet against the pathogen” – silver bullet
solutions unlikely to be durable
•  Framework to rapidly generate new resistance
specificities and introduce these traits into crop
genomes
•  Can we generate and deploy new resistance
traits faster than the pathogen can evolve?
HOME / SCIENCE : THE STATE OF THE UNIVERSE.
No, You Shouldn’t Fear GMO
Corn
How Elle botched a story about genetically modified food.
By Jon Entine Posted Wednesday, Aug. 7, 2013, at 2:45 PM
|
1.2k
1784
Like 5.1k TweetTweet 181
NEW
... for peace of mind
in potato cultivation
UNDER DEVELOPMENTFOR YOURCONVENIENCE
On top of that, you have to ensure that the
weather is favorable in terms of wind strength
and precipitation. If you want to put an end to
precisely that situation, Fortuna is the right
potato variety for you, as it provides lasting
protection against late blight. So there’s no
more need for you to regularly inspect your
fields and check for signs of this disease. With
Fortuna, you no longer have to worry about the
right time and the right weather. And best of all,
when you plant out your crops you can look for-
ward to an extremely high yield and outstanding
quality without any stress.
What is Fortuna?
Fortuna is a further development of the leading
European potato variety used for making fries.
Fortuna is identical to its parent variety, but has
one key additional benefit: It provides complete
protection against late blight. Fortuna therefore
offers impressively high tuber yield and thanks
to its tuber form, color and taste, it satisfies all
the requirements to be used in making fries or
as fresh produce.
How was Fortuna developed?
Dutch researchers have undertaken extensive
research into the special resistance of the wild
potato. They managed to identify the genes
which give the wild potato protection against
late blight. Agricultural and biotechnological
experts at BASF then transferred these genes
to the leading French fries potato variety using
the soil bacterium Agrobacterium. This resulted
in Fortuna which is equipped with the wild po-
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
Why is Fortuna so useful to you?
If you’re a potato farmer, you’re sure to be fami-
liar with the following situation. July and August
are mainly wet. Late blight attacks all of your
potato fields, which you cared for intensively
throughout the whole year. All you can do is
wait until the rain subsides and machinery can
move on the soil again. Now you have the prob-
lem of, on the one hand, choosing the right
time to use fungicides to protect against late
blight. On the other hand, you don‘t want to risk
driving on the land and causing soil compaction.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
20 30 40
A
50
Application against Alternaria (A) and Phytophthora (P)
60
A
70 80
Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)
Fortuna, the potato variety for your peace of mind.
With natural resistance to Phytophthora
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
... for peace of mind
in potato cultivation
UNDER DEVELOPMENTFOR YOURCONVENIENCE
On top of that, you have to ensure that the
weather is favorable in terms of wind strength
and precipitation. If you want to put an end to
precisely that situation, Fortuna is the right
potato variety for you, as it provides lasting
protection against late blight. So there’s no
more need for you to regularly inspect your
fields and check for signs of this disease. With
Fortuna, you no longer have to worry about the
right time and the right weather. And best of all,
when you plant out your crops you can look for-
ward to an extremely high yield and outstanding
quality without any stress.
What is Fortuna?
Fortuna is a further development of the leading
European potato variety used for making fries.
Fortuna is identical to its parent variety, but has
one key additional benefit: It provides complete
protection against late blight. Fortuna therefore
offers impressively high tuber yield and thanks
to its tuber form, color and taste, it satisfies all
the requirements to be used in making fries or
as fresh produce.
How was Fortuna developed?
Dutch researchers have undertaken extensive
research into the special resistance of the wild
potato. They managed to identify the genes
which give the wild potato protection against
late blight. Agricultural and biotechnological
experts at BASF then transferred these genes
to the leading French fries potato variety using
the soil bacterium Agrobacterium. This resulted
in Fortuna which is equipped with the wild po-
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
Why is Fortuna so useful to you?
If you’re a potato farmer, you’re sure to be fami-
liar with the following situation. July and August
are mainly wet. Late blight attacks all of your
potato fields, which you cared for intensively
throughout the whole year. All you can do is
wait until the rain subsides and machinery can
move on the soil again. Now you have the prob-
lem of, on the one hand, choosing the right
time to use fungicides to protect against late
blight. On the other hand, you don‘t want to risk
driving on the land and causing soil compaction.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
20 30 40
A
50
Application against Alternaria (A) and Phytophthora (P)
60
A
70 80
Fungicide treatments in Fortuna (due to lasting Phytophthora resistance)
Fortuna, the potato variety for your peace of mind.
With natural resistance to Phytophthora
tato‘s effective protection against late blight –
without modifying its outstanding agronomic
characteristics.
20 30
P
40
P+A
50
P P P
Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years)
60
P+A
70
P P PP P P
80
Fungicide treatments in conventionally improved potatoes
Ü Genomics-enabled gene mapping and cloning
Ü Impacting plant breeding: from Marker Assisted Selection
(MAS) to Genomic Selection (GS)
Ü Applicable to both Resistance and Susceptibility genes
Next-generation crop (disease resistance) breeding
A RT I C L E S
Genome sequencing reveals agronomically important
loci in rice using MutMap
Akira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3,
3,4 3 3 3 5 6
ved.
A RT I C L E S
Genome sequencing reveals agronomically important
loci in rice using MutMap
Akira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3,
Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6,
Sophien Kamoun6 & Ryohei Terauchi3
The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification
of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a
BACTERIA MAY NOT ELICIT MUCH SYMPA-
thy from us eukaryotes, but they, too, can get
sick. That’s potentially a big problem for the
dairy industry, which often depends on bac-
teria such as Streptococcus thermophilus to
make yogurts and cheeses. S. thermophilus
breaks down the milk sugar lactose into tangy
lactic acid. But certain viruses—bacterio-
phages, or simply phages—can debilitate the
pany now owned by DuPont, found a way to
boost the phage defenses of this workhouse
microbe. They exposed the bacterium to
a phage and showed that this essentially
vaccinated it against that virus (Science,
23 March 2007, p. 1650). The trick has
enabled DuPont to create heartier bacterial
strains for food production. It also revealed
something fundamental: Bacteria have a
become important for more than food scien-
tists and microbiologists, because of a valu-
able feature: It takes aim at specific DNA
sequences. In January, four research teams
reported harnessing the system, called
CRISPR for peculiar features in the DNA of
bacteria that deploy it, to target the destruc-
tion of specific genes in human cells. And in
the following 8 months, various groups have
The CRISPR CrazeA bacterial immune system yields a potentially
revolutionary genome-editing technique
IENCE/SCIENCESOURCE
Fighting invasion. When
viruses (green) attack
bacteria, the bacteria
respond with DNA-targeting
defenses that biologists
have learned to exploit
for genetic engineering.
onAugust23,2013www.sciencemag.orgDownloadedfrom
www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013
BACTERIA MAY NOT ELICIT MUCH SYMPA-
thy from us eukaryotes, but they, too, can get
sick. That’s potentially a big problem for the
dairy industry, which often depends on bac-
teria such as Streptococcus thermophilus to
make yogurts and cheeses. S. thermophilus
breaks down the milk sugar lactose into tangy
lactic acid. But certain viruses—bacterio-
phages, or simply phages—can debilitate the
bacterium, wreaking havoc on the quality or
quantity of the food it helps produce.
In 2007, scientists from Danisco, a
Copenhagen-based food ingredient com-
pany now owned by DuPont, found a way to
boost the phage defenses of this workhouse
microbe. They exposed the bacterium to
a phage and showed that this essentially
vaccinated it against that virus (Science,
23 March 2007, p. 1650). The trick has
enabled DuPont to create heartier bacterial
strains for food production. It also revealed
something fundamental: Bacteria have a
kind of adaptive immune system, which
enables them to fight off repeated attacks
by specific phages.
That immune system has suddenly
become important for more than food scien-
tists and microbiologists, because of a valu-
able feature: It takes aim at specific DNA
sequences. In January, four research teams
reported harnessing the system, called
CRISPR for peculiar features in the DNA of
bacteria that deploy it, to target the destruc-
tion of specific genes in human cells. And in
the following 8 months, various groups have
used it to delete, add, activate, or suppress tar-
geted genes in human cells, mice, rats, zebra-
fish, bacteria, fruit flies, yeast, nematodes,
and crops, demonstrating broad utility for the
The CRISPR CrazeA bacterial immune system yields a potentially
revolutionary genome-editing technique
CREDIT:EYEOFSCIENCE/SCIENCESOURCE
for genetic engineering.
Published by AAAS
infects plant scientists
REVIEW Open Access
Plant genome editing made easy: targeted
mutagenesis in model and crop plants using the
CRISPR/Cas system
Khaoula Belhaj†
, Angela Chaparro-Garcia†
, Sophien Kamoun*
and Vladimir Nekrasov*
Abstract
Targeted genome engineering (also known as genome editing) has emerged as an alternative to classical plant
breeding and transgenic (GMO) methods to improve crop plants. Until recently, available tools for introducing
site-specific double strand DNA breaks were restricted to zinc finger nucleases (ZFNs) and TAL effector nucleases
(TALENs). However, these technologies have not been widely adopted by the plant research community due to
complicated design and laborious assembly of specific DNA binding proteins for each target gene. Recently, an
easier method has emerged based on the bacterial type II CRISPR (clustered regularly interspaced short palindromic
repeats)/Cas (CRISPR-associated) immune system. The CRISPR/Cas system allows targeted cleavage of genomic DNA
guided by a customizable small noncoding RNA, resulting in gene modifications by both non-homologous end
joining (NHEJ) and homology-directed repair (HDR) mechanisms. In this review we summarize and discuss recent
applications of the CRISPR/Cas technology in plants.
Keywords: CRISPR, Cas9, Plant, Genome editing, Genome engineering, Targeted mutagenesis
Introduction
Targeted genome engineering has emerged as an alter-
native to classical plant breeding and transgenic (GMO)
methods to improve crop plants and ensure sustainable
food production. However, until recently the available
methods have proven cumbersome. Both zinc finger
nucleases (ZFNs) and TAL effector nucleases (TALENs)
based on the Cas9 nuclease and an engineered single
guide RNA (sgRNA) that specifies a targeted nucleic acid
sequence. Given that only a single RNA is required to gen-
erate target specificity, the CRISPR/Cas system promises
to be more easily applicable to genome engineering than
ZFNs and TALENs.
Recently, eight reports describing the first applications
PLANT METHODS
Belhaj et al. Plant Methods 2013, 9:39
http://www.plantmethods.com/content/9/1/39
Humans have been modifying the genomes
of animals and plants…
…using mutagens (chemicals, irradiation) and selective breeding
§  We are now moving into an era of precise genome editing
(synthetic biology, biohacking etc.); ultimate in editing
§  Accessing and generating genetic diversity will not be a
limiting factor anymore; key is to know which genes
influence agronomically important traits
500 -
400 -
300 -
bp
1 2 8 10WT
500 -
400 -
300 -
bp
200 -
1 2 83 4 5 6 7 9 10
ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG!
ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG!
ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!
ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!
ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48!
ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49!
WT
Plant 1
Plant 2
Plant 8
Plant 10
PAM PAMTarget 1 Target 2
500 -
400 -
300 -
8-1
500 -
400 -
300 -
bp 8-2 8-3 8-4 8-5 WT 8-6
SlMlo1
T-DNA
8-4
T-DNA: - - +-
WT slmlo1&
8-6
b c
d
e
f
Figure 1
Transform with
Cas9/sgRNAs
Callus
tissue
T0
plantlets
T1 seeds slmlo1
T-DNA
segregating
Regenerate T0
plants and screen
for slmlo1
homozygotes
Screen T1 generation
for T-DNA-free plants
3.5 months
T2 seeds
slmlo1
T-DNA-free
0 3 6 9.5
Time, months3 months 3 months 3.5 months
Tomelo – A DNA deletion results in fungus resistance
Tomelo – A DNA deletion in the S gene mlo
results in resistance to powdery mildew fungus
Vladimir Nekrasov
Deletion of CMPG1 in tomato reduces infection by P. infestans
Lesionsize(mm2)
Wild-Type
cmpg1 mutants
Mutant 1 Mutant 2 Mutant 3
P. infestans 88069 (5 dpi)
Wild-Type
cmpg1 mutant
Angela Chaparro-Garcia
Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016
Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016

More Related Content

What's hot

Transgenic plants for insect resistance (review)
Transgenic plants for insect resistance  (review)Transgenic plants for insect resistance  (review)
Transgenic plants for insect resistance (review)Jiya Ali
 
Pathogen variability,concept and mechanism
Pathogen variability,concept and mechanismPathogen variability,concept and mechanism
Pathogen variability,concept and mechanismShridhar Hiremath
 
genetic Resistance against gastrointestinal nematodes in sheep: Association w...
genetic Resistance against gastrointestinal nematodes in sheep: Association w...genetic Resistance against gastrointestinal nematodes in sheep: Association w...
genetic Resistance against gastrointestinal nematodes in sheep: Association w...Ishfaq Maqbool
 
Toby bruce applications of understanding insect chemical ecology -2017
Toby bruce   applications of understanding insect chemical ecology -2017Toby bruce   applications of understanding insect chemical ecology -2017
Toby bruce applications of understanding insect chemical ecology -2017Toby Bruce
 
host-pathogen interaction in paddy blast
host-pathogen interaction in paddy blasthost-pathogen interaction in paddy blast
host-pathogen interaction in paddy blasthema latha
 
Mycorrhizal induced resistance and plant innate immunity
Mycorrhizal induced resistance and plant innate immunityMycorrhizal induced resistance and plant innate immunity
Mycorrhizal induced resistance and plant innate immunityOlivia Nongthombam
 
Seb bruce insect-plant interactions
Seb bruce insect-plant interactionsSeb bruce insect-plant interactions
Seb bruce insect-plant interactionsToby Bruce
 
Bio project CLASS12 genetic engenering
Bio project CLASS12  genetic engeneringBio project CLASS12  genetic engenering
Bio project CLASS12 genetic engeneringRajveer Atal
 
Plant microbe interaction review ppt
Plant microbe interaction review pptPlant microbe interaction review ppt
Plant microbe interaction review pptMesele Tilahun
 
Role of biotechnology in the management of disease
Role of biotechnology in the management of diseaseRole of biotechnology in the management of disease
Role of biotechnology in the management of diseaseUka Tarsadia University
 
Genetic engineering & new technologies their progress in Integrated Pest Man...
Genetic engineering & new technologies  their progress in Integrated Pest Man...Genetic engineering & new technologies  their progress in Integrated Pest Man...
Genetic engineering & new technologies their progress in Integrated Pest Man...Thims957
 
Biocommunication in nematodes
Biocommunication in nematodesBiocommunication in nematodes
Biocommunication in nematodesMathi chandhran
 
2nd international sym. final abdelbagi
2nd international  sym. final abdelbagi2nd international  sym. final abdelbagi
2nd international sym. final abdelbagiICARDA
 
Aphidophaga13 bruce
Aphidophaga13 bruceAphidophaga13 bruce
Aphidophaga13 bruceToby Bruce
 
Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...
Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...
Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...Shweta Patel
 
Chapter 20 Molecular Genetics Lesson 3 - Genetic Engineering
Chapter 20 Molecular Genetics Lesson 3 - Genetic EngineeringChapter 20 Molecular Genetics Lesson 3 - Genetic Engineering
Chapter 20 Molecular Genetics Lesson 3 - Genetic Engineeringj3di79
 
Transgenic strategies for improving rice disease resistance
Transgenic strategies for improving rice disease resistanceTransgenic strategies for improving rice disease resistance
Transgenic strategies for improving rice disease resistanceKiranKumarN24
 
Transgenic plants ppt
Transgenic plants  pptTransgenic plants  ppt
Transgenic plants pptKajol Roy
 

What's hot (20)

Transgenic plants for insect resistance (review)
Transgenic plants for insect resistance  (review)Transgenic plants for insect resistance  (review)
Transgenic plants for insect resistance (review)
 
Master seminar
Master seminarMaster seminar
Master seminar
 
Pathogen variability,concept and mechanism
Pathogen variability,concept and mechanismPathogen variability,concept and mechanism
Pathogen variability,concept and mechanism
 
genetic Resistance against gastrointestinal nematodes in sheep: Association w...
genetic Resistance against gastrointestinal nematodes in sheep: Association w...genetic Resistance against gastrointestinal nematodes in sheep: Association w...
genetic Resistance against gastrointestinal nematodes in sheep: Association w...
 
Toby bruce applications of understanding insect chemical ecology -2017
Toby bruce   applications of understanding insect chemical ecology -2017Toby bruce   applications of understanding insect chemical ecology -2017
Toby bruce applications of understanding insect chemical ecology -2017
 
host-pathogen interaction in paddy blast
host-pathogen interaction in paddy blasthost-pathogen interaction in paddy blast
host-pathogen interaction in paddy blast
 
Mycorrhizal induced resistance and plant innate immunity
Mycorrhizal induced resistance and plant innate immunityMycorrhizal induced resistance and plant innate immunity
Mycorrhizal induced resistance and plant innate immunity
 
1 9
1 91 9
1 9
 
Seb bruce insect-plant interactions
Seb bruce insect-plant interactionsSeb bruce insect-plant interactions
Seb bruce insect-plant interactions
 
Bio project CLASS12 genetic engenering
Bio project CLASS12  genetic engeneringBio project CLASS12  genetic engenering
Bio project CLASS12 genetic engenering
 
Plant microbe interaction review ppt
Plant microbe interaction review pptPlant microbe interaction review ppt
Plant microbe interaction review ppt
 
Role of biotechnology in the management of disease
Role of biotechnology in the management of diseaseRole of biotechnology in the management of disease
Role of biotechnology in the management of disease
 
Genetic engineering & new technologies their progress in Integrated Pest Man...
Genetic engineering & new technologies  their progress in Integrated Pest Man...Genetic engineering & new technologies  their progress in Integrated Pest Man...
Genetic engineering & new technologies their progress in Integrated Pest Man...
 
Biocommunication in nematodes
Biocommunication in nematodesBiocommunication in nematodes
Biocommunication in nematodes
 
2nd international sym. final abdelbagi
2nd international  sym. final abdelbagi2nd international  sym. final abdelbagi
2nd international sym. final abdelbagi
 
Aphidophaga13 bruce
Aphidophaga13 bruceAphidophaga13 bruce
Aphidophaga13 bruce
 
Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...
Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...
Genetic Improvements to the Sterile Insect Technique for Agricultural & Publi...
 
Chapter 20 Molecular Genetics Lesson 3 - Genetic Engineering
Chapter 20 Molecular Genetics Lesson 3 - Genetic EngineeringChapter 20 Molecular Genetics Lesson 3 - Genetic Engineering
Chapter 20 Molecular Genetics Lesson 3 - Genetic Engineering
 
Transgenic strategies for improving rice disease resistance
Transgenic strategies for improving rice disease resistanceTransgenic strategies for improving rice disease resistance
Transgenic strategies for improving rice disease resistance
 
Transgenic plants ppt
Transgenic plants  pptTransgenic plants  ppt
Transgenic plants ppt
 

Viewers also liked

"Keeping up with the plant destroyers." My talk at The Royal Society, 7 March...
"Keeping up with the plant destroyers." My talk at The Royal Society, 7 March..."Keeping up with the plant destroyers." My talk at The Royal Society, 7 March...
"Keeping up with the plant destroyers." My talk at The Royal Society, 7 March...Sophien Kamoun
 
Everything you wanted to know about research integrity...
Everything you wanted to know about research integrity...Everything you wanted to know about research integrity...
Everything you wanted to know about research integrity...Sophien Kamoun
 
Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.
Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.
Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.Graham Etherington
 
Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...
Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...
Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...Jonathan Clarke
 
Plant-microbe interactions - exploring microbes to improve crop productivity
Plant-microbe interactions - exploring microbes to improve crop productivityPlant-microbe interactions - exploring microbes to improve crop productivity
Plant-microbe interactions - exploring microbes to improve crop productivityinformationretrieval
 
Plant Pathogen Interaction
Plant Pathogen InteractionPlant Pathogen Interaction
Plant Pathogen Interactionpoojamaggi
 
Limited WIP Meeting presentation - The Phoenix Project book review
Limited WIP Meeting presentation - The Phoenix Project book reviewLimited WIP Meeting presentation - The Phoenix Project book review
Limited WIP Meeting presentation - The Phoenix Project book reviewRudiger Wolf
 
Загальні теоритичні засади і принципи бухгалтерського обліку в банках
Загальні теоритичні засади і принципи бухгалтерського обліку в банкахЗагальні теоритичні засади і принципи бухгалтерського обліку в банках
Загальні теоритичні засади і принципи бухгалтерського обліку в банкахНастя Корабахина
 
ROTWILD GT S inspired by AMG
ROTWILD GT S inspired by AMGROTWILD GT S inspired by AMG
ROTWILD GT S inspired by AMGMaud von Hoff
 
RIHospitalVolumeTrends
RIHospitalVolumeTrendsRIHospitalVolumeTrends
RIHospitalVolumeTrendsKim Paull
 
Multimedia Teaching With Video Study
Multimedia Teaching With Video StudyMultimedia Teaching With Video Study
Multimedia Teaching With Video StudyGuinevere Shaw
 
"مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب
"مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب "مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب
"مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب WomenAntiCoup
 
The cognitive theory ppp
The cognitive theory   pppThe cognitive theory   ppp
The cognitive theory pppEmma Aguiluz
 
8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία
8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία
8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία8dimotikokilkis
 
Pisa2015 skl lokalt nvk 20 oktober
Pisa2015 skl lokalt nvk 20 oktoberPisa2015 skl lokalt nvk 20 oktober
Pisa2015 skl lokalt nvk 20 oktoberkvutis
 
ItAIS Special Interest Group on IS Education
ItAIS Special Interest Group on IS EducationItAIS Special Interest Group on IS Education
ItAIS Special Interest Group on IS EducationPaolo Spagnoletti
 
โครงงาน
โครงงาน โครงงาน
โครงงาน karakas14
 

Viewers also liked (20)

"Keeping up with the plant destroyers." My talk at The Royal Society, 7 March...
"Keeping up with the plant destroyers." My talk at The Royal Society, 7 March..."Keeping up with the plant destroyers." My talk at The Royal Society, 7 March...
"Keeping up with the plant destroyers." My talk at The Royal Society, 7 March...
 
Everything you wanted to know about research integrity...
Everything you wanted to know about research integrity...Everything you wanted to know about research integrity...
Everything you wanted to know about research integrity...
 
Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.
Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.
Diversity of Crinkler Effector Genes in Phytophthora infestans isolates.
 
Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...
Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...
Helping Farmers to Grow Healthier Crops: Use of qPCR to Monitor Plant Resista...
 
Plant-microbe interactions - exploring microbes to improve crop productivity
Plant-microbe interactions - exploring microbes to improve crop productivityPlant-microbe interactions - exploring microbes to improve crop productivity
Plant-microbe interactions - exploring microbes to improve crop productivity
 
Plant Pathogen Interaction
Plant Pathogen InteractionPlant Pathogen Interaction
Plant Pathogen Interaction
 
Limited WIP Meeting presentation - The Phoenix Project book review
Limited WIP Meeting presentation - The Phoenix Project book reviewLimited WIP Meeting presentation - The Phoenix Project book review
Limited WIP Meeting presentation - The Phoenix Project book review
 
Group Film Pitch
Group Film PitchGroup Film Pitch
Group Film Pitch
 
Загальні теоритичні засади і принципи бухгалтерського обліку в банках
Загальні теоритичні засади і принципи бухгалтерського обліку в банкахЗагальні теоритичні засади і принципи бухгалтерського обліку в банках
Загальні теоритичні засади і принципи бухгалтерського обліку в банках
 
ROTWILD GT S inspired by AMG
ROTWILD GT S inspired by AMGROTWILD GT S inspired by AMG
ROTWILD GT S inspired by AMG
 
RIHospitalVolumeTrends
RIHospitalVolumeTrendsRIHospitalVolumeTrends
RIHospitalVolumeTrends
 
артикль
артикльартикль
артикль
 
Multimedia Teaching With Video Study
Multimedia Teaching With Video StudyMultimedia Teaching With Video Study
Multimedia Teaching With Video Study
 
"مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب
"مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب "مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب
"مجزرة رمسيس" .. ذكرى تتجدد وجراح لم تندمل - نساء ضد الانقلاب
 
The cognitive theory ppp
The cognitive theory   pppThe cognitive theory   ppp
The cognitive theory ppp
 
Money market
Money marketMoney market
Money market
 
8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία
8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία
8ο δημοτικό σχολείο κιλκίς γερμανικά και διαδικτυακά εργαλεία
 
Pisa2015 skl lokalt nvk 20 oktober
Pisa2015 skl lokalt nvk 20 oktoberPisa2015 skl lokalt nvk 20 oktober
Pisa2015 skl lokalt nvk 20 oktober
 
ItAIS Special Interest Group on IS Education
ItAIS Special Interest Group on IS EducationItAIS Special Interest Group on IS Education
ItAIS Special Interest Group on IS Education
 
โครงงาน
โครงงาน โครงงาน
โครงงาน
 

Similar to Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016

L 1.Introduction to PDM kkungggfdrrfftghhh
L 1.Introduction to PDM kkungggfdrrfftghhhL 1.Introduction to PDM kkungggfdrrfftghhh
L 1.Introduction to PDM kkungggfdrrfftghhhAkash486765
 
NEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptx
NEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptxNEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptx
NEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptxnaseeruddinshah2
 
Fundamental of-plant-pathology
Fundamental of-plant-pathologyFundamental of-plant-pathology
Fundamental of-plant-pathologyRAHUKETUCREATIONS
 
MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...
MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...
MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...Mayur Thesiya
 
Problems facing mushroom availability and consumption in owerri municipal cou...
Problems facing mushroom availability and consumption in owerri municipal cou...Problems facing mushroom availability and consumption in owerri municipal cou...
Problems facing mushroom availability and consumption in owerri municipal cou...Alexander Decker
 
PATH-121-PRINTED-NOTE-DHULE.pdf
PATH-121-PRINTED-NOTE-DHULE.pdfPATH-121-PRINTED-NOTE-DHULE.pdf
PATH-121-PRINTED-NOTE-DHULE.pdfNikeshAmrute
 
Introduction to plant pathology
Introduction to plant pathologyIntroduction to plant pathology
Introduction to plant pathologyajuna1234
 
what is plant pathology and plant disease .ppt
what is plant pathology and plant disease .pptwhat is plant pathology and plant disease .ppt
what is plant pathology and plant disease .pptDawitGetahun6
 
1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdf1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdfJaimin Pandya
 
1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdf1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdfJaiminPandya19
 
Sarah 51 Root knot disease of vegetables.pptx
Sarah 51 Root knot disease of vegetables.pptxSarah 51 Root knot disease of vegetables.pptx
Sarah 51 Root knot disease of vegetables.pptxSarahAshfaq4
 
Trichoderma ppt
Trichoderma pptTrichoderma ppt
Trichoderma pptNagesh B
 
Role of endophytes in nematode menagement
Role of endophytes in nematode menagementRole of endophytes in nematode menagement
Role of endophytes in nematode menagementMathi chandhran
 
Pest Identification Course
Pest Identification CoursePest Identification Course
Pest Identification CourseCarlosItza2
 
Modul2 kb2, parasit patogen
Modul2 kb2, parasit patogenModul2 kb2, parasit patogen
Modul2 kb2, parasit patogenmuditateach
 

Similar to Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016 (20)

L 1.Introduction to PDM kkungggfdrrfftghhh
L 1.Introduction to PDM kkungggfdrrfftghhhL 1.Introduction to PDM kkungggfdrrfftghhh
L 1.Introduction to PDM kkungggfdrrfftghhh
 
NEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptx
NEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptxNEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptx
NEMATOLOGY-DEFINITION, HISTORY AND ECONOMIC IMPORTANCE.pptx
 
Introduction to plant_pathology
Introduction to plant_pathologyIntroduction to plant_pathology
Introduction to plant_pathology
 
Fundamental of-plant-pathology
Fundamental of-plant-pathologyFundamental of-plant-pathology
Fundamental of-plant-pathology
 
MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...
MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...
MANAGEMENT OF SOIL BORNE PATHOGENS OF VEGETABLE CROPS UNDER PROTECTED CULTIVA...
 
Problems facing mushroom availability and consumption in owerri municipal cou...
Problems facing mushroom availability and consumption in owerri municipal cou...Problems facing mushroom availability and consumption in owerri municipal cou...
Problems facing mushroom availability and consumption in owerri municipal cou...
 
PATH-121-PRINTED-NOTE-DHULE.pdf
PATH-121-PRINTED-NOTE-DHULE.pdfPATH-121-PRINTED-NOTE-DHULE.pdf
PATH-121-PRINTED-NOTE-DHULE.pdf
 
Introduction to plant pathology
Introduction to plant pathologyIntroduction to plant pathology
Introduction to plant pathology
 
what is plant pathology and plant disease .ppt
what is plant pathology and plant disease .pptwhat is plant pathology and plant disease .ppt
what is plant pathology and plant disease .ppt
 
1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdf1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdf
 
1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdf1_ IJAT2011_7_5_ Pandya JR_F.pdf
1_ IJAT2011_7_5_ Pandya JR_F.pdf
 
N bhart
N bhartN bhart
N bhart
 
Sarah 51 Root knot disease of vegetables.pptx
Sarah 51 Root knot disease of vegetables.pptxSarah 51 Root knot disease of vegetables.pptx
Sarah 51 Root knot disease of vegetables.pptx
 
Trichoderma ppt
Trichoderma pptTrichoderma ppt
Trichoderma ppt
 
Role of endophytes in nematode menagement
Role of endophytes in nematode menagementRole of endophytes in nematode menagement
Role of endophytes in nematode menagement
 
Lecture 1.ppt
Lecture 1.pptLecture 1.ppt
Lecture 1.ppt
 
Pp 401 Introduction to Plant Pathogens (1)
Pp 401 Introduction to Plant Pathogens (1) Pp 401 Introduction to Plant Pathogens (1)
Pp 401 Introduction to Plant Pathogens (1)
 
Pest Identification Course
Pest Identification CoursePest Identification Course
Pest Identification Course
 
jkjhk
jkjhkjkjhk
jkjhk
 
Modul2 kb2, parasit patogen
Modul2 kb2, parasit patogenModul2 kb2, parasit patogen
Modul2 kb2, parasit patogen
 

More from Sophien Kamoun

CRISPR Crops--a talk by Sophien Kamoun at Science Portal BD
CRISPR Crops--a talk by Sophien Kamoun at Science Portal BDCRISPR Crops--a talk by Sophien Kamoun at Science Portal BD
CRISPR Crops--a talk by Sophien Kamoun at Science Portal BDSophien Kamoun
 
Don’t perish! A step by step guide to writing a scientific paper
Don’t perish! A step by step guide to writing a scientific paperDon’t perish! A step by step guide to writing a scientific paper
Don’t perish! A step by step guide to writing a scientific paperSophien Kamoun
 
Faites de la Science: Mes aventures de Biologiste
Faites de la Science: Mes aventures de BiologisteFaites de la Science: Mes aventures de Biologiste
Faites de la Science: Mes aventures de BiologisteSophien Kamoun
 
Plant health emergencies in the face of a changing environment
Plant health emergencies in the face of a changing environmentPlant health emergencies in the face of a changing environment
Plant health emergencies in the face of a changing environmentSophien Kamoun
 
Everything you wanted to know about research integrity but never dared to ask
Everything you wanted to know about research integrity but never dared to askEverything you wanted to know about research integrity but never dared to ask
Everything you wanted to know about research integrity but never dared to askSophien Kamoun
 
Hello kids, I'm a biologist!
Hello kids, I'm a biologist!Hello kids, I'm a biologist!
Hello kids, I'm a biologist!Sophien Kamoun
 
Intro to the Kamoun Lab @ TSL 2018
Intro to the Kamoun Lab @ TSL 2018 Intro to the Kamoun Lab @ TSL 2018
Intro to the Kamoun Lab @ TSL 2018 Sophien Kamoun
 
Plant pathology in the post-genomics era
Plant pathology in the post-genomics eraPlant pathology in the post-genomics era
Plant pathology in the post-genomics eraSophien Kamoun
 
What are world class scientific outputs?
What are world class scientific outputs?What are world class scientific outputs?
What are world class scientific outputs?Sophien Kamoun
 

More from Sophien Kamoun (9)

CRISPR Crops--a talk by Sophien Kamoun at Science Portal BD
CRISPR Crops--a talk by Sophien Kamoun at Science Portal BDCRISPR Crops--a talk by Sophien Kamoun at Science Portal BD
CRISPR Crops--a talk by Sophien Kamoun at Science Portal BD
 
Don’t perish! A step by step guide to writing a scientific paper
Don’t perish! A step by step guide to writing a scientific paperDon’t perish! A step by step guide to writing a scientific paper
Don’t perish! A step by step guide to writing a scientific paper
 
Faites de la Science: Mes aventures de Biologiste
Faites de la Science: Mes aventures de BiologisteFaites de la Science: Mes aventures de Biologiste
Faites de la Science: Mes aventures de Biologiste
 
Plant health emergencies in the face of a changing environment
Plant health emergencies in the face of a changing environmentPlant health emergencies in the face of a changing environment
Plant health emergencies in the face of a changing environment
 
Everything you wanted to know about research integrity but never dared to ask
Everything you wanted to know about research integrity but never dared to askEverything you wanted to know about research integrity but never dared to ask
Everything you wanted to know about research integrity but never dared to ask
 
Hello kids, I'm a biologist!
Hello kids, I'm a biologist!Hello kids, I'm a biologist!
Hello kids, I'm a biologist!
 
Intro to the Kamoun Lab @ TSL 2018
Intro to the Kamoun Lab @ TSL 2018 Intro to the Kamoun Lab @ TSL 2018
Intro to the Kamoun Lab @ TSL 2018
 
Plant pathology in the post-genomics era
Plant pathology in the post-genomics eraPlant pathology in the post-genomics era
Plant pathology in the post-genomics era
 
What are world class scientific outputs?
What are world class scientific outputs?What are world class scientific outputs?
What are world class scientific outputs?
 

Recently uploaded

Production technology of Brinjal -Solanum melongena
Production technology of Brinjal -Solanum melongenaProduction technology of Brinjal -Solanum melongena
Production technology of Brinjal -Solanum melongenajana861314
 
Role of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptxRole of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptxjana861314
 
6.2 Pests of Sesame_Identification_Binomics_Dr.UPR
6.2 Pests of Sesame_Identification_Binomics_Dr.UPR6.2 Pests of Sesame_Identification_Binomics_Dr.UPR
6.2 Pests of Sesame_Identification_Binomics_Dr.UPRPirithiRaju
 
Understanding Nutrition, 16th Edition pdf
Understanding Nutrition, 16th Edition pdfUnderstanding Nutrition, 16th Edition pdf
Understanding Nutrition, 16th Edition pdfHabibouKarbo
 
6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR
6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR
6.1 Pests of Groundnut_Binomics_Identification_Dr.UPRPirithiRaju
 
Science (Communication) and Wikipedia - Potentials and Pitfalls
Science (Communication) and Wikipedia - Potentials and PitfallsScience (Communication) and Wikipedia - Potentials and Pitfalls
Science (Communication) and Wikipedia - Potentials and PitfallsDobusch Leonhard
 
HEMATOPOIESIS - formation of blood cells
HEMATOPOIESIS - formation of blood cellsHEMATOPOIESIS - formation of blood cells
HEMATOPOIESIS - formation of blood cellsSachinSuresh44
 
Think Science: What Are Eclipses (101), by Craig Bobchin
Think Science: What Are Eclipses (101), by Craig BobchinThink Science: What Are Eclipses (101), by Craig Bobchin
Think Science: What Are Eclipses (101), by Craig BobchinNathan Cone
 
FBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptxFBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptxPayal Shrivastava
 
Observational constraints on mergers creating magnetism in massive stars
Observational constraints on mergers creating magnetism in massive starsObservational constraints on mergers creating magnetism in massive stars
Observational constraints on mergers creating magnetism in massive starsSérgio Sacani
 
BACTERIAL SECRETION SYSTEM by Dr. Chayanika Das
BACTERIAL SECRETION SYSTEM by Dr. Chayanika DasBACTERIAL SECRETION SYSTEM by Dr. Chayanika Das
BACTERIAL SECRETION SYSTEM by Dr. Chayanika DasChayanika Das
 
Pests of Sunflower_Binomics_Identification_Dr.UPR
Pests of Sunflower_Binomics_Identification_Dr.UPRPests of Sunflower_Binomics_Identification_Dr.UPR
Pests of Sunflower_Binomics_Identification_Dr.UPRPirithiRaju
 
Immunoblott technique for protein detection.ppt
Immunoblott technique for protein detection.pptImmunoblott technique for protein detection.ppt
Immunoblott technique for protein detection.pptAmirRaziq1
 
Food_safety_Management_pptx.pptx in microbiology
Food_safety_Management_pptx.pptx in microbiologyFood_safety_Management_pptx.pptx in microbiology
Food_safety_Management_pptx.pptx in microbiologyHemantThakare8
 
AICTE activity on Water Conservation spreading awareness
AICTE activity on Water Conservation spreading awarenessAICTE activity on Water Conservation spreading awareness
AICTE activity on Water Conservation spreading awareness1hk20is002
 
GLYCOSIDES Classification Of GLYCOSIDES Chemical Tests Glycosides
GLYCOSIDES Classification Of GLYCOSIDES  Chemical Tests GlycosidesGLYCOSIDES Classification Of GLYCOSIDES  Chemical Tests Glycosides
GLYCOSIDES Classification Of GLYCOSIDES Chemical Tests GlycosidesNandakishor Bhaurao Deshmukh
 
Environmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptxEnvironmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptxpriyankatabhane
 
The Sensory Organs, Anatomy and Function
The Sensory Organs, Anatomy and FunctionThe Sensory Organs, Anatomy and Function
The Sensory Organs, Anatomy and FunctionJadeNovelo1
 
Loudspeaker- direct radiating type and horn type.pptx
Loudspeaker- direct radiating type and horn type.pptxLoudspeaker- direct radiating type and horn type.pptx
Loudspeaker- direct radiating type and horn type.pptxpriyankatabhane
 

Recently uploaded (20)

Production technology of Brinjal -Solanum melongena
Production technology of Brinjal -Solanum melongenaProduction technology of Brinjal -Solanum melongena
Production technology of Brinjal -Solanum melongena
 
Role of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptxRole of Gibberellins, mode of action and external applications.pptx
Role of Gibberellins, mode of action and external applications.pptx
 
6.2 Pests of Sesame_Identification_Binomics_Dr.UPR
6.2 Pests of Sesame_Identification_Binomics_Dr.UPR6.2 Pests of Sesame_Identification_Binomics_Dr.UPR
6.2 Pests of Sesame_Identification_Binomics_Dr.UPR
 
Understanding Nutrition, 16th Edition pdf
Understanding Nutrition, 16th Edition pdfUnderstanding Nutrition, 16th Edition pdf
Understanding Nutrition, 16th Edition pdf
 
PLASMODIUM. PPTX
PLASMODIUM. PPTXPLASMODIUM. PPTX
PLASMODIUM. PPTX
 
6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR
6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR
6.1 Pests of Groundnut_Binomics_Identification_Dr.UPR
 
Science (Communication) and Wikipedia - Potentials and Pitfalls
Science (Communication) and Wikipedia - Potentials and PitfallsScience (Communication) and Wikipedia - Potentials and Pitfalls
Science (Communication) and Wikipedia - Potentials and Pitfalls
 
HEMATOPOIESIS - formation of blood cells
HEMATOPOIESIS - formation of blood cellsHEMATOPOIESIS - formation of blood cells
HEMATOPOIESIS - formation of blood cells
 
Think Science: What Are Eclipses (101), by Craig Bobchin
Think Science: What Are Eclipses (101), by Craig BobchinThink Science: What Are Eclipses (101), by Craig Bobchin
Think Science: What Are Eclipses (101), by Craig Bobchin
 
FBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptxFBI Profiling - Forensic Psychology.pptx
FBI Profiling - Forensic Psychology.pptx
 
Observational constraints on mergers creating magnetism in massive stars
Observational constraints on mergers creating magnetism in massive starsObservational constraints on mergers creating magnetism in massive stars
Observational constraints on mergers creating magnetism in massive stars
 
BACTERIAL SECRETION SYSTEM by Dr. Chayanika Das
BACTERIAL SECRETION SYSTEM by Dr. Chayanika DasBACTERIAL SECRETION SYSTEM by Dr. Chayanika Das
BACTERIAL SECRETION SYSTEM by Dr. Chayanika Das
 
Pests of Sunflower_Binomics_Identification_Dr.UPR
Pests of Sunflower_Binomics_Identification_Dr.UPRPests of Sunflower_Binomics_Identification_Dr.UPR
Pests of Sunflower_Binomics_Identification_Dr.UPR
 
Immunoblott technique for protein detection.ppt
Immunoblott technique for protein detection.pptImmunoblott technique for protein detection.ppt
Immunoblott technique for protein detection.ppt
 
Food_safety_Management_pptx.pptx in microbiology
Food_safety_Management_pptx.pptx in microbiologyFood_safety_Management_pptx.pptx in microbiology
Food_safety_Management_pptx.pptx in microbiology
 
AICTE activity on Water Conservation spreading awareness
AICTE activity on Water Conservation spreading awarenessAICTE activity on Water Conservation spreading awareness
AICTE activity on Water Conservation spreading awareness
 
GLYCOSIDES Classification Of GLYCOSIDES Chemical Tests Glycosides
GLYCOSIDES Classification Of GLYCOSIDES  Chemical Tests GlycosidesGLYCOSIDES Classification Of GLYCOSIDES  Chemical Tests Glycosides
GLYCOSIDES Classification Of GLYCOSIDES Chemical Tests Glycosides
 
Environmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptxEnvironmental Acoustics- Speech interference level, acoustics calibrator.pptx
Environmental Acoustics- Speech interference level, acoustics calibrator.pptx
 
The Sensory Organs, Anatomy and Function
The Sensory Organs, Anatomy and FunctionThe Sensory Organs, Anatomy and Function
The Sensory Organs, Anatomy and Function
 
Loudspeaker- direct radiating type and horn type.pptx
Loudspeaker- direct radiating type and horn type.pptxLoudspeaker- direct radiating type and horn type.pptx
Loudspeaker- direct radiating type and horn type.pptx
 

Sophien's lectures on Oomycetes, UEA BIO 6007B, January 2016

  • 1.
  • 2. Crop losses due to fungi and oomycetes (filamentous plant pathogens) Fisher et al. 2012
  • 3. Crop losses due to fungi and oomycetes (filamentous plant pathogens) Fisher et al. 2012
  • 4. Veredeling voor resistentie niet geluktThe Irish potato famine pathogen Phytophthora infestans causes potato blight
  • 5. Phytophthora Irish potato famine pathogen Greek for plant destroyer fungus-like oomycete
  • 6. Ü Infection cycle and diversity Ü Evolutionary history Ü Genome architecture and evolution Ü Virulence mechanisms: effector biology Ü Host resistance and evasion of resistance Ü Breeding host resistance: prospects and challenges What you will learn – Phytophthora and the oomycetes
  • 7.
  • 8. Fifi the oomycete is a scary parasite, With flagellated spores and hyphal threads She kills crops and triggers blight. Infection cycle and diversity
  • 9. Infection cycle of Phytophthora infestans
  • 10. Infection cycle of Phytophthora infestans Zoospore cyst appressorium Infection vesicle haustorium sporangium
  • 11. Phytophthora infestans necrotrophy biotrophy Phytophthora infestans is a hemibiotroph – undergoes a biotrophic phase and then becomes necrotrophic
  • 12. Filamentous growth of Phytophthora
  • 13. Appressoria – Infection structures that enable penetration of plant tissue appressorium
  • 14. Haustoria – Infection structures that enable nutrient uptake and secretion of effector proteins Coffey and Wilson, 1983 Tolga Bozkurt, Imperial College Extrahaustorial membrane (EHM) haustorium
  • 15. Haustoria – pathogen infection structures that are surrounded by a host-derived membrane Bozkurt et al. Curr Opin Plant Biol 2012
  • 16. Haustoria enable secretion of effector proteins and nutrient uptake suppress immunity, alter host physiology nutrients?
  • 17. Asexual spores – finding the host and dispersal Sporangia and zoospores
  • 18. a d c f g h ↓↓ ↓ ↓ ↓ ↓↓ ↓ ↓ ↓ b ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓ ↓↓ ↓ ↓ ↓ ↓↓ ↓ ↓ ↓ ↓↓ e ↓↓ ↓ ↓↓ ↓↓ ↓ ↓ ↓ ↓ * Phytophthora palmivora: Root tip (electrotaxis) Pythium aphanidermatum: Wound exudates (chemotaxis) Zoospore-root interactions
  • 19.
  • 20. Fifi the oomycete is a scary parasite, With flagellated spores and hyphal threads She kills crops and triggers blight. Infection cycle and diversity
  • 21. Oomycete phylogeny and diversity Colonized many ecological niches yet more than 60% of species are parasitic on plants
  • 22. ■  Obligate biotrophic parasites: require living plants to grow, usually do not kill host plants ■  Largest number of species ■  Typically host specific/specialized parasites: one species infects one plant species ■  Best studied is Hyaloperonospora arabidopsidis (Hpa); infects host plant Arabidopsis thaliana Downy mildews
  • 23. Variety of symptoms caused by downy mildews on plants
  • 24. ■  Phytophthora are the most important pathogens of dicot plants, causing tens of billions of dollars of losses annually ■  Phytophthora infestans, the agent of late blight of potato and tomato, causes more crop losses than any other member of the genus ■  But there are many other species that are damaging to natural and agricultural ecosystems Phytophthora: “plant killers”
  • 25. Phytophthora capsici causes blight on several vegetables
  • 26. Phytophthora capsici causes blight on several vegetables
  • 27. Phytophthora ramorum and Phytophthora kernoviae infect many native British woodland species and are a threat to the environment
  • 28.
  • 29. Fifi the oomycete is a heterokont, they say, She’s fungus-like but the scientists Know how she had plastids one day. Evolutionary history
  • 30. Phytophthora is an oomycete not a fungus
  • 31. Oomycetes are fungus-like filamentous microbes: a unique group of eukaryotic plant pathogens Plant pathogens in greenAnimal parasites in redTree adapted from Embley and Martin (2006) Nature 440:623 (Heterokonts)
  • 32. Christine Strullu-Derrien and Paul Kenrick @ Natural History Museum Oomycetes form an ancient eukaryotic lineage §  may have been parasitic ~300 million year ago §  present in the 407 million year-old Rhynie Chert, an ecosystem of plants, fungi and oomycetes
  • 33. ■  Unrelated to fungi, more closely related to brown algae and diatoms in the Stramenopiles (Heterokonts) ■  Supported by molecular phylogenies based on ribosomal RNA sequences, compiled amino acid data for mitochondrial proteins, and protein encoding chromosomal genes ■  Exhibit fungal-like filamentous (hyphal) growth and several fungal-like morphological structures Oomycetes - Phylogeny
  • 34.
  • 35. Fifi the oomycete has a big genome, they say, Full of repeats but don’t call it junk ‘cause can be handy one day. Genome architecture and evolution
  • 36. Veredeling voor resistentie niet geluktWhy the misery? Why are oomycetes the scourge of farmers worldwide? §  Phytophthora are astonishing plant destroyers that can wipe out crops in days but the secret of their success is their ability to rapidly adapt to resistant plant varieties §  How did Phytophthora and other oomycetes manage to keep on changing and adapting to ensure their uninterrupted survival over evolutionary time?
  • 37. 2006 maland e of the with the 10, 38). to ap- ntrol. In e vibra- dth are ence in owever, dths in to ma- ch long- ization. nterfer- splaced bility of obser- proper- ocesses, ted. 9 (2003). 990). Phys. 92, Mathies, Acad. Sci. . U.S.A. 97, 1 (2001). (2002). 7 (2002). J. 85, 5 (2004). ujimura, r, (2005). ler, 90). 01, 6629 New York, 1981). 33. D. Gelman, R. Kosloff, J. Chem. Phys. 123, 234506 (2005). 34. J. Hauer, H. Skenderovic, K.-L. Kompa, M. Motzkus, Chem. Phys. Lett. 421, 523 (2006). 35. D. Oesterhelt, W. Stoeckenius, in Methods in Enzymology, vol. 31 of Biomembranes (Academic Press, New York, 1974), pp. 667–678. 36. The saturation energy is related to the absorption cross section s as Es 0 1/strans (for a negligibly small contribution of the excited-state emission), and s is thank J.T.M. Kennis, Vrije Universiteit Amsterdam, for helpful discussions of preliminary results. Supporting Online Material www.sciencemag.org/cgi/content/full/313/5791/1257/DC1 Materials and Methods Figs. S1 to S5 References 1 June 2006; accepted 10 August 2006 10.1126/science.1130747 Phytophthora Genome Sequences Uncover Evolutionary Origins and Mechanisms of Pathogenesis Brett M. Tyler,1 * Sucheta Tripathy,1 Xuemin Zhang,1 Paramvir Dehal,2,3 Rays H. Y. Jiang,1,4 Andrea Aerts,2,3 Felipe D. Arredondo,1 Laura Baxter,5 Douda Bensasson,2,3,6 Jim L. Beynon,5 Jarrod Chapman,2,3,7 Cynthia M. B. Damasceno,8 Anne E. Dorrance,9 Daolong Dou,1 Allan W. Dickerman,1 Inna L. Dubchak,2,3 Matteo Garbelotto,10 Mark Gijzen,11 Stuart G. Gordon,9 Francine Govers,4 Niklaus J. Grunwald,12 Wayne Huang,2,14 Kelly L. Ivors,10,15 Richard W. Jones,16 Sophien Kamoun,9 Konstantinos Krampis,1 Kurt H. Lamour,17 Mi-Kyung Lee,18 W. Hayes McDonald,19 Mo´nica Medina,20 Harold J. G. Meijer,4 Eric K. Nordberg,1 Donald J. Maclean,21 Manuel D. Ospina-Giraldo,22 Paul F. Morris,23 Vipaporn Phuntumart,23 Nicholas H. Putnam,2,3 Sam Rash,2,13 Jocelyn K. C. Rose,24 Yasuko Sakihama,25 Asaf A. Salamov,2,3 Alon Savidor,17 Chantel F. Scheuring,18 Brian M. Smith,1 Bruno W. S. Sobral,1 Astrid Terry,2,13 Trudy A. Torto-Alalibo,1 Joe Win,9 Zhanyou Xu,18 Hongbin Zhang,18 Igor V. Grigoriev,2,3 Daniel S. Rokhsar,2,7 Jeffrey L. Boore2,3,26,27 Draft genome sequences have been determined for the soybean pathogen Phytophthora sojae and the sudden oak death pathogen Phytophthora ramorum. Oo¨mycetes such as these Phytophthora species share the kingdom Stramenopila with photosynthetic algae such as diatoms, and the presence of many Phytophthora genes of probable phototroph origin supports a photosynthetic ancestry for the stramenopiles. Comparison of the two species’ genomes reveals a rapid expansion and diversification of many protein families associated with plant infection such as hydrolases, ABC transporters, protein toxins, proteinase inhibitors, and, in particular, a superfamily of 700 proteins with similarity to known oo¨mycete avirulence genes. P hytophthora plant pathogens attack a wide range of agriculturally and orna- mentally important plants (1). Late blight of potato caused by Phytophthora infestans re- sulted in the Irish potato famine in the 19th cen- tury, and P. sojae costs the soybean industry millions of dollars each year. In California and Oregon, a newly emerged Phytophthora species, P. ramorum, is responsible for a disease called sudden oak death (2) that affects not only the live w.sciencemag.org SCIENCE VOL 313 1 SEPTEMBER 2006 1261 LETTERS Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans Brian J. Haas1 *, Sophien Kamoun2,3 *, Michael C. Zody1,4 , Rays H. Y. Jiang1,5 , Robert E. Handsaker1 , Liliana M. Cano2 , Manfred Grabherr1 , Chinnappa D. Kodira1 {, Sylvain Raffaele2 , Trudy Torto-Alalibo3 {, Tolga O. Bozkurt2 , Audrey M. V. Ah-Fong6 , Lucia Alvarado1 , Vicky L. Anderson7 , Miles R. Armstrong8 , Anna Avrova8 , Laura Baxter9 , JimBeynon9 ,PetraC.Boevink8 ,StephanieR.Bollmann10 ,JorunnI.B.Bos3 ,VincentBulone11 ,GuohongCai12 ,CahidCakir3 , James C. Carrington13 , Megan Chawner14 , Lucio Conti15 , Stefano Costanzo16 , Richard Ewan15 , Noah Fahlgren13 , Michael A. Fischbach17 , Johanna Fugelstad11 , Eleanor M. Gilroy8 , Sante Gnerre1 , Pamela J. Green18 , Laura J. Grenville-Briggs7 , John Griffith14 , Niklaus J. Gru¨nwald10 , Karolyn Horn14 , Neil R. Horner7 , Chia-Hui Hu19 , 3 18 2 2 20 Vol 461|17 September 2009|doi:10.1038/nature08358 2009
  • 38. Features of sequenced oomycete genomes Figure 2. Features of sequenced oomycete pathogen genomes. The representative phylogeny depicts oomycete pathogens with sequenced genomes and was generated using Interactive Tree Of Life (iTOL) with National Center for Biotechnology Information (NCBI) taxonomy identifiers (branch lengths are arbitrary). Pathogen lifestyles and major variations in effector gene families are indicated along the tree branches. Potential loss of particular effector classes in a lineage is indicated by a red cross. The principal host, genome size, repetitive DNA content (as a percentage of genome size), gene space (the percentage of the genome encoding genes), number of protein-coding genes and number and percentage of proteins encoding predicted secreted proteins (secretome) are indicated from left to right for each pathogen. CRN, Crinkler; ND, not determined. Pythium ultimum Phytophthora ramorum Phytophthora infestans Phytophthora sojae Phytophthora parasitica Hyaloperonospora arabidopsidis Saprolegnia parasitica Albugo candida Albugo laibachii CRN effectors CHXC effectors Host Varied Arabidopsis Arabidopsis Vegetables Potato,tomato Varied Soybean Varied Fish Woody plants 53 80 65 100 45 53 Genome size (Mb) % Repetitive DNA content ND 39 17 ND 43 22 Protein coding genes 20,822 16,988 14,451 14,543 15,824 20,088 Secretome (%) 1,561 1,867 1,523 727 1,255 RefsOomycetes % gene space 32 28 31 17 43 49 (7.5) (11.0) (10.5) (5.0) (3.3)515 (6.2) NPP1 -like NPP1-like 64 19 1,17619,80529 (5.9) 240 74 18,155 1,588 (8.7)10 43 7 15,291 843 (5.5)44 37 28 13,032 413 (3.2)48 Plant Biotroph Plant Necrotroph Fish Saprotroph/Necrotroph Non-repetitive Repetitive Non-coding Coding Phytophthora capsici RXLR effectors YxSL[RK] & RXLR effectors YxSL[RK] effectors [6] [11] [12] [13] [13] [14] [15] [16] [17] [18] Apoplastic effectors Cytoplasmic effecttors Plant Hemibiotroph Key (i): Key (ii): Pais et al. Genome Biology 2013, 14:211 http://genomebiology.com/2013/14/6/211 Page 3 of 10 Pais et al. Genome Biology, 2013
  • 39. The 240 Mbp genome of Phytophthora infestans – a repeat and transposon driven expansion
  • 40. P. infestans P. sojae P. ramorum P. sojae P. infestans P. ramorum B. Haas, S. Kamoun et al. Nature, 2009 Phytophthora infestans genome architecture - repeat- rich and gene-poor loci interrupt colinear regions
  • 41. RXLR Crinklers Protease inhibitors Phytophthora infestans genome: so many effectors! Apoplastic Host-translocated ~38 ~550 ~200 ~250ψ
  • 42. P. infestans P. sojae P. ramorum P. sojae RXLR effector gene P. infestans P. ramorum B. Haas, S. Kamoun et al. Nature, 2009 RSLR 43 47 100221 AVRblb2 Host translocation Effector activity Signal Peptide Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci
  • 43. Length of intergenic regions (kb) Nb of genes : 80-85 75-80 70-75 65-70 60-65 55-60 50-55 45-50 40-45 35-40 30-35 25-30 20-25 15-20 10-15 5-10 0-5 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 00-5 11-15 16-20 6-10 21-25 31-35 36-40 26-30 41-45 51-55 56-60 46-50 61-65 71-75 76-80 66-70 81-85 P. infestans (16442 genes) Core orthologs (7580) RXLR effectors (520) Phytophthora infestans effectors typically occur in the expanded, repeat-rich and gene-poor loci B. Haas, S. Kamoun et al. Nature, 2009
  • 44. The “two-speed genome” of P. infestans underpins high evolutionary potential P. sojae P. infestans P. ramorum §  Gene-sparse regions of genome show highest rates of structural and sequence variation, signatures of adaptive selection §  Gene-sparse regions underpin rapid evolution of virulence (effector) genes and host adaptation; cradle for adaptive evolution
  • 45. Several filamentous plant pathogens (fungi and oomycetes) have a “two-speed” genome architecture A C D B
  • 46. O, Fifi the oomycete Was as virulent as she’s been; and scientists say she secretes her way Inside potatoes and bean. Virulence mechanisms: effector biology
  • 47. bacterium   fungus   oomycete   haustorium   apoplas4c  effectors   plant  cell   Microbes alter plant cell processes using secreted “effector” molecules Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010 Cytoplasmic   effectors   targets   targets   Alter  plant  cell   processes   Help  microbe   colonize  plant  
  • 48. Ü Effectors have been described in bacteria, oomycetes, fungi, nematodes, insects etc. Ü Current paradigm - effector activities are key to understanding parasitism (and symbiosis) Ü Operationally effectors are plant proteins - Encoded by genes in pathogen genomes but function in (inside) plant cells Key concepts about plant pathogen effectors
  • 49. Effectors - sensus Dawkins in “The extended phenotype: the long reach of the gene” p. 210, 1981 “...parasite genes having phenotypic expression in host bodies and behavior” Phytoplasmas see Saskia Hogenhout’s lectures
  • 50. RXLR Crinklers Protease inhibitors The diverse effectors of Phytophthora infestans Apoplastic Host-translocated ~38 ~550 ~200 ~250ψ
  • 51. Apoplastic effectors are typically small cysteine-rich secreted proteins - often get processed upon secretion - disulfide bridges provide stability in apoplast Targeting Function
  • 52. (tomato cell) (apoplast) RCR3 PIP1 C14 CYP3 CatB1ALP CatB2 Immune response EPIC1 EPIC2B Phytophthora infestans Oomycete Phytophthora and fungal effectors inhibit the same plant immune proteases with Renier van der Hoorn Cladosporium fulvum Fungus AVR2
  • 53. RLLR SEER 21 44 59 147 Signal Peptide 1 RSLR DEER 21 51 72 1521 Signal Peptide RFLR EER 23 54 69 1681 Signal Peptide PEX-RD3 IPIO1 NUK10 AVR3a RQLR GEERSignal Peptide 19 50 77 2131 Cytoplasmic effectors of oomycetes have a conserved domain defined by the RXLR motif Targeting Function
  • 54. P. infestans RXLR effectors target a variety host proteins and processes Ü  AVR3a targets an E3 Ubiquitin Ligase CMPG1 to suppress immunity (Bos et al. PNAS, 2010) Ü  AVR2 targets a Kelch repeat phosphatase BSL1 to suppress immunity (Saunders et al. Plant Cell, 2012) Ü  PexRD54 binds ATG8 and antagonizes selective autophagy to counteract plant defense (Dagdas, Belhaj et al. eLife 2016) Ü  AVRblb2 interferes with secretion of cysteine protease C14 to counteract plant defense (Bozkurt et al. PNAS, 2011)
  • 55. Kamoun & van der Hoorn Labs EPIC C14 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
  • 56. Kamoun & van der Hoorn Labs EPIC C14 C14 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
  • 57. Kamoun & van der Hoorn Labs EPIC C14 C14 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
  • 58. Kamoun & van der Hoorn Labs EPIC C14 AVRblb2 P. infestans evolved distinct effectors and mechanisms to interfere with apoplastic proteases
  • 59. Fifi the oomycete found A resistant plant that day, So she said, "Let's run and There’ll be no fun Until I mutate away." Host resistance and evasion of resistance
  • 60. Resistance to Phytophthora infestans §  The Hypersensitive Response (HR): a programmed cell death response §  Activation of a plant immune receptor (R) by an effector
  • 61. effectors   bacterium   fungus   oomycete   haustorium   plant  cell   Some effectors “trip the wire” and activate immunity in particular plant genotypes Alter  plant  cell   processes   targets   NB-­‐LRR/NLR   immune  receptors   NLR-­‐   triggered   immunity   Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010
  • 62. effectors   bacterium   fungus   oomycete   haustorium   plant  cell   Concept: Host Resistance and Susceptibility genes Alter  plant  cell   processes   targets   NB-­‐LRR/NLR   immune  receptors   NLR-­‐   triggered   immunity   Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G.O., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., and Kamoun, S. Cold Spring Harbor Symposium on Quantitative Biology, 2013; Dodds, P.N., and Rathjen, J.P. Nature Reviews Genetics, 2010 R S
  • 64. NLR  /  NB-­‐LRR   immune  receptors   How do pathogen effectors evade immunity? AVR  effector   §  Effectors evade activating immune receptors by acquiring stealthy mutations target   §  But, they have to maintain their virulence activity! §  Still many effectors become nonfunctional (pseudogenes) or get deleted in the pathogen genome
  • 65. Functional redundancy among pathogen effectors enables “bet-hedging” Ü Many effectors are functionally redundant; affect different steps or converge on same target Ü Functional redundancy enables robustness in the face of the evolving plant immune system Ü “Bet-hedging” Win, J., et al. Cold Spring Harbor Symposium on Quantitative Biology, 2013
  • 66. For Fifi the oomycete Keeps evolving in her way, But don’t wave her goodbye, Don't you even try, She’ll be back again some day. Breeding host resistance: prospects and challenges
  • 67.
  • 68. An arms race between the plant breeder/ biotechnologist and the pathogen? •  Ability of the pathogen to adapt is astounding •  “Don’t bet against the pathogen” – silver bullet solutions unlikely to be durable •  Framework to rapidly generate new resistance specificities and introduce these traits into crop genomes •  Can we generate and deploy new resistance traits faster than the pathogen can evolve?
  • 69.
  • 70. HOME / SCIENCE : THE STATE OF THE UNIVERSE. No, You Shouldn’t Fear GMO Corn How Elle botched a story about genetically modified food. By Jon Entine Posted Wednesday, Aug. 7, 2013, at 2:45 PM | 1.2k 1784 Like 5.1k TweetTweet 181 NEW
  • 71. ... for peace of mind in potato cultivation UNDER DEVELOPMENTFOR YOURCONVENIENCE On top of that, you have to ensure that the weather is favorable in terms of wind strength and precipitation. If you want to put an end to precisely that situation, Fortuna is the right potato variety for you, as it provides lasting protection against late blight. So there’s no more need for you to regularly inspect your fields and check for signs of this disease. With Fortuna, you no longer have to worry about the right time and the right weather. And best of all, when you plant out your crops you can look for- ward to an extremely high yield and outstanding quality without any stress. What is Fortuna? Fortuna is a further development of the leading European potato variety used for making fries. Fortuna is identical to its parent variety, but has one key additional benefit: It provides complete protection against late blight. Fortuna therefore offers impressively high tuber yield and thanks to its tuber form, color and taste, it satisfies all the requirements to be used in making fries or as fresh produce. How was Fortuna developed? Dutch researchers have undertaken extensive research into the special resistance of the wild potato. They managed to identify the genes which give the wild potato protection against late blight. Agricultural and biotechnological experts at BASF then transferred these genes to the leading French fries potato variety using the soil bacterium Agrobacterium. This resulted in Fortuna which is equipped with the wild po- tato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. Why is Fortuna so useful to you? If you’re a potato farmer, you’re sure to be fami- liar with the following situation. July and August are mainly wet. Late blight attacks all of your potato fields, which you cared for intensively throughout the whole year. All you can do is wait until the rain subsides and machinery can move on the soil again. Now you have the prob- lem of, on the one hand, choosing the right time to use fungicides to protect against late blight. On the other hand, you don‘t want to risk driving on the land and causing soil compaction. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes 20 30 40 A 50 Application against Alternaria (A) and Phytophthora (P) 60 A 70 80 Fungicide treatments in Fortuna (due to lasting Phytophthora resistance) Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora tato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes
  • 72. ... for peace of mind in potato cultivation UNDER DEVELOPMENTFOR YOURCONVENIENCE On top of that, you have to ensure that the weather is favorable in terms of wind strength and precipitation. If you want to put an end to precisely that situation, Fortuna is the right potato variety for you, as it provides lasting protection against late blight. So there’s no more need for you to regularly inspect your fields and check for signs of this disease. With Fortuna, you no longer have to worry about the right time and the right weather. And best of all, when you plant out your crops you can look for- ward to an extremely high yield and outstanding quality without any stress. What is Fortuna? Fortuna is a further development of the leading European potato variety used for making fries. Fortuna is identical to its parent variety, but has one key additional benefit: It provides complete protection against late blight. Fortuna therefore offers impressively high tuber yield and thanks to its tuber form, color and taste, it satisfies all the requirements to be used in making fries or as fresh produce. How was Fortuna developed? Dutch researchers have undertaken extensive research into the special resistance of the wild potato. They managed to identify the genes which give the wild potato protection against late blight. Agricultural and biotechnological experts at BASF then transferred these genes to the leading French fries potato variety using the soil bacterium Agrobacterium. This resulted in Fortuna which is equipped with the wild po- tato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. Why is Fortuna so useful to you? If you’re a potato farmer, you’re sure to be fami- liar with the following situation. July and August are mainly wet. Late blight attacks all of your potato fields, which you cared for intensively throughout the whole year. All you can do is wait until the rain subsides and machinery can move on the soil again. Now you have the prob- lem of, on the one hand, choosing the right time to use fungicides to protect against late blight. On the other hand, you don‘t want to risk driving on the land and causing soil compaction. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes 20 30 40 A 50 Application against Alternaria (A) and Phytophthora (P) 60 A 70 80 Fungicide treatments in Fortuna (due to lasting Phytophthora resistance) Fortuna, the potato variety for your peace of mind. With natural resistance to Phytophthora tato‘s effective protection against late blight – without modifying its outstanding agronomic characteristics. 20 30 P 40 P+A 50 P P P Application against Alternaria (A) and Phytophthora (P; 5-12 treatments in “normal” years) 60 P+A 70 P P PP P P 80 Fungicide treatments in conventionally improved potatoes
  • 73. Ü Genomics-enabled gene mapping and cloning Ü Impacting plant breeding: from Marker Assisted Selection (MAS) to Genomic Selection (GS) Ü Applicable to both Resistance and Susceptibility genes Next-generation crop (disease resistance) breeding A RT I C L E S Genome sequencing reveals agronomically important loci in rice using MutMap Akira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, 3,4 3 3 3 5 6 ved. A RT I C L E S Genome sequencing reveals agronomically important loci in rice using MutMap Akira Abe1,2,7, Shunichi Kosugi3,7, Kentaro Yoshida3, Satoshi Natsume3, Hiroki Takagi2,3, Hiroyuki Kanzaki3, Hideo Matsumura3,4, Kakoto Yoshida3, Chikako Mitsuoka3, Muluneh Tamiru3, Hideki Innan5, Liliana Cano6, Sophien Kamoun6 & Ryohei Terauchi3 The majority of agronomic traits are controlled by multiple genes that cause minor phenotypic effects, making the identification of these genes difficult. Here we introduce MutMap, a method based on whole-genome resequencing of pooled DNA from a
  • 74. BACTERIA MAY NOT ELICIT MUCH SYMPA- thy from us eukaryotes, but they, too, can get sick. That’s potentially a big problem for the dairy industry, which often depends on bac- teria such as Streptococcus thermophilus to make yogurts and cheeses. S. thermophilus breaks down the milk sugar lactose into tangy lactic acid. But certain viruses—bacterio- phages, or simply phages—can debilitate the pany now owned by DuPont, found a way to boost the phage defenses of this workhouse microbe. They exposed the bacterium to a phage and showed that this essentially vaccinated it against that virus (Science, 23 March 2007, p. 1650). The trick has enabled DuPont to create heartier bacterial strains for food production. It also revealed something fundamental: Bacteria have a become important for more than food scien- tists and microbiologists, because of a valu- able feature: It takes aim at specific DNA sequences. In January, four research teams reported harnessing the system, called CRISPR for peculiar features in the DNA of bacteria that deploy it, to target the destruc- tion of specific genes in human cells. And in the following 8 months, various groups have The CRISPR CrazeA bacterial immune system yields a potentially revolutionary genome-editing technique IENCE/SCIENCESOURCE Fighting invasion. When viruses (green) attack bacteria, the bacteria respond with DNA-targeting defenses that biologists have learned to exploit for genetic engineering. onAugust23,2013www.sciencemag.orgDownloadedfrom www.sciencemag.org SCIENCE VOL 341 23 AUGUST 2013 BACTERIA MAY NOT ELICIT MUCH SYMPA- thy from us eukaryotes, but they, too, can get sick. That’s potentially a big problem for the dairy industry, which often depends on bac- teria such as Streptococcus thermophilus to make yogurts and cheeses. S. thermophilus breaks down the milk sugar lactose into tangy lactic acid. But certain viruses—bacterio- phages, or simply phages—can debilitate the bacterium, wreaking havoc on the quality or quantity of the food it helps produce. In 2007, scientists from Danisco, a Copenhagen-based food ingredient com- pany now owned by DuPont, found a way to boost the phage defenses of this workhouse microbe. They exposed the bacterium to a phage and showed that this essentially vaccinated it against that virus (Science, 23 March 2007, p. 1650). The trick has enabled DuPont to create heartier bacterial strains for food production. It also revealed something fundamental: Bacteria have a kind of adaptive immune system, which enables them to fight off repeated attacks by specific phages. That immune system has suddenly become important for more than food scien- tists and microbiologists, because of a valu- able feature: It takes aim at specific DNA sequences. In January, four research teams reported harnessing the system, called CRISPR for peculiar features in the DNA of bacteria that deploy it, to target the destruc- tion of specific genes in human cells. And in the following 8 months, various groups have used it to delete, add, activate, or suppress tar- geted genes in human cells, mice, rats, zebra- fish, bacteria, fruit flies, yeast, nematodes, and crops, demonstrating broad utility for the The CRISPR CrazeA bacterial immune system yields a potentially revolutionary genome-editing technique CREDIT:EYEOFSCIENCE/SCIENCESOURCE for genetic engineering. Published by AAAS infects plant scientists
  • 75. REVIEW Open Access Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system Khaoula Belhaj† , Angela Chaparro-Garcia† , Sophien Kamoun* and Vladimir Nekrasov* Abstract Targeted genome engineering (also known as genome editing) has emerged as an alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants. Until recently, available tools for introducing site-specific double strand DNA breaks were restricted to zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs). However, these technologies have not been widely adopted by the plant research community due to complicated design and laborious assembly of specific DNA binding proteins for each target gene. Recently, an easier method has emerged based on the bacterial type II CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) immune system. The CRISPR/Cas system allows targeted cleavage of genomic DNA guided by a customizable small noncoding RNA, resulting in gene modifications by both non-homologous end joining (NHEJ) and homology-directed repair (HDR) mechanisms. In this review we summarize and discuss recent applications of the CRISPR/Cas technology in plants. Keywords: CRISPR, Cas9, Plant, Genome editing, Genome engineering, Targeted mutagenesis Introduction Targeted genome engineering has emerged as an alter- native to classical plant breeding and transgenic (GMO) methods to improve crop plants and ensure sustainable food production. However, until recently the available methods have proven cumbersome. Both zinc finger nucleases (ZFNs) and TAL effector nucleases (TALENs) based on the Cas9 nuclease and an engineered single guide RNA (sgRNA) that specifies a targeted nucleic acid sequence. Given that only a single RNA is required to gen- erate target specificity, the CRISPR/Cas system promises to be more easily applicable to genome engineering than ZFNs and TALENs. Recently, eight reports describing the first applications PLANT METHODS Belhaj et al. Plant Methods 2013, 9:39 http://www.plantmethods.com/content/9/1/39
  • 76. Humans have been modifying the genomes of animals and plants… …using mutagens (chemicals, irradiation) and selective breeding §  We are now moving into an era of precise genome editing (synthetic biology, biohacking etc.); ultimate in editing §  Accessing and generating genetic diversity will not be a limiting factor anymore; key is to know which genes influence agronomically important traits
  • 77. 500 - 400 - 300 - bp 1 2 8 10WT 500 - 400 - 300 - bp 200 - 1 2 83 4 5 6 7 9 10 ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG! ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG! ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48! ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48! ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48! ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49! WT Plant 1 Plant 2 Plant 8 Plant 10 PAM PAMTarget 1 Target 2 500 - 400 - 300 - 8-1 500 - 400 - 300 - bp 8-2 8-3 8-4 8-5 WT 8-6 SlMlo1 T-DNA 8-4 T-DNA: - - +- WT slmlo1& 8-6 b c d e f Figure 1 Transform with Cas9/sgRNAs Callus tissue T0 plantlets T1 seeds slmlo1 T-DNA segregating Regenerate T0 plants and screen for slmlo1 homozygotes Screen T1 generation for T-DNA-free plants 3.5 months T2 seeds slmlo1 T-DNA-free 0 3 6 9.5 Time, months3 months 3 months 3.5 months Tomelo – A DNA deletion results in fungus resistance Tomelo – A DNA deletion in the S gene mlo results in resistance to powdery mildew fungus Vladimir Nekrasov
  • 78. Deletion of CMPG1 in tomato reduces infection by P. infestans Lesionsize(mm2) Wild-Type cmpg1 mutants Mutant 1 Mutant 2 Mutant 3 P. infestans 88069 (5 dpi) Wild-Type cmpg1 mutant Angela Chaparro-Garcia