Male Sterility in context with Biotechnological applications

1. Assignment topic-
Submitted by – Jwalit
Biotechnological Applications in
Male sterility or Hybrid Breeding

2. Male sterility is defined as an absence or non-functioning of
pollen grain in plant or incapability of plants to produce or
release functional pollen grains.
 The use of male sterility in hybrid seed production has a
great importance as it eliminates the process of mechanical
emasculation.
 In 1763, Kolreuter observed anther abortion within species
and species hybrids.
 The first male sterility system(CGMS) was developed in
onion in 1943(Jones,1943).
 Induced CMS in pearl millet by Ethidium bromide (Burton
and Hanna, 1976).

3. Causes of Male Sterility:
• Absence or malformation of male organs (stamens) in
bisexual plants or no male flowers in dioecious plants.
• Failure to develop new anther.
• Abnormal pollen maturation; inability to germinate on
incompatible stigma.
• Non- dehiscent anthers but viable pollens.
• Barriers other than incompatibility preventing pollen from
reaching ovule.
(Kaul, 1988)

4. More prevalent than Female sterility:
 Male sporophyte and gametophyte less protected from
environment than ovule and embryo sac.
 Easy to detect male sterility, due to large no.of pollen
availability for study.
 Easy to assay male sterility;
1. Staining technique(caramine, lactophenol or
iodine)
2. female sterility requires crossing.
 Male sterility has propagation potential in nature.
(Kaul, 1988)

5. Types of Male Sterility:
1) Genetic male sterility (GMS) or Genic or Nuclear or mendelian sterility : is
usually caused by recessive alleles and follow Mendelian inheritance due to
nuclear genes.
A) Temperature sensitive genetic male sterility (TGMS)
B) Photoperiod sensitive genetic male sterility (PGMS)
 The major drawback with GMS is the impossibility to create 100% male
sterile populations. Thus in hybrid seed production, the fertile plants have
to be rouged out before anthesis (1:1 ratio).
2) Cytoplasmic male sterility (CMS) : is caused by sterile cytoplasm (S)
• CMS occurs as a result of structural changes in the cytoplasmic organellar
genome and mutation in the mitochondrial genome.
• It is maternally inherited.
• This makes CMS extra valuable for producing hybrid seed since, crossing
with maintainer lines result in 100% sterile plants.

6. 3) Cytoplasmic genetic male sterility (CGMS): CMS where a nuclear
gene for restoring fertility in the male sterile line is known. Fertility restorer
gene R is dominant in nature and found in certain strains of same species or
can be transferred form the related species.
4) Non genetic or chemically induced male sterility: Male sterility is
induced by Applied specific chemical.
e.g. Gametocides (mitomycin and streptomycin) or Chemical Hybridizing
Agents (CHA).
5) Genetically engineered or transgenic male sterility : Transgenic male
sterility is the production of male sterility by the help of transgene that
encodes protein which is responsible for the failure of pollen development.

7. Importance of Male sterility:
Hybrid seed production.
 To improve physical stability.
Higher responsiveness to fertilizers.
Male sterility is used in recurrent selection breeding
which is effective in breaking undesirable linkages and
increase desirable gene combinations especially in those
crops where emasculation is difficult.
 Increases the reproductive fitness of individual.
The male sterile genes are useful in genetic control of
microsporogenesis.

8. Biotechnological applications in Male
Sterility and Hybrid Breeding

9.  Targeting the Tapetum Tissue:
• A specialized anther tissue the tapetum, play an important part in
pollen development.
• The tapetum surrounds the pollen sac early in the anther
development, degenerates during the later stages of development.
M, microsporocytes (microspore mother cells); DP, developing pollen; T, tapetal
cell; and Tds, tetrads.

10. Barnase/Barstar System Engineered Male Sterility:
• Barnase is extracelluar Rnase; Barstar is inhibitor of barnase(both from
bacterium Bacillus amyloliquefaciens which uses barnase for protection from
microbial predators and barstar to protect itself from barnase.
•Fuse the barnase and barstar genes to TA29 promoter- TA29 is a plant gene
that has tapetum specific expression.
•Both gene link to bar gene(Murakami et al., 1986) which confers resistance to
the herbicide phosphinothricin.
•Brassica napus cv. Darkar containing the TA29- barnase construct are male
sterile; those with TA29-barstar are not affected by the transgene( Male
fertile).
•Cross male sterile(barnase) with male fertile(barstar) to get hybrid seed,
which now has both barnase and barstar expressed in tapetum and, hence is
fully fertile. Barstar is dominant over Barnase.

13. Hybrid Seed Production:

14.  RNA interference for Male sterility:
“Development of male sterility by silencing Bcp1 gene of
Arabidopsis through RNA interference”.
•Bcp1 is active in both diploid tapetum and haploid
microspores. Three batches of explants (A. thaliana) were
selected on herbicide glufosinate ammonium and putative
transgenes were confirmed through PCR and Southern
hybridization.
•Transgenic plants were phenotypically indistinguishable from
nontransgenic plants and by crossing with non-transgenic
fertile pollens successful seed set was observed.

15. How the procedure is carried out:
Total DNA was isolated from tobacco (Nicotiana tabacum cv. Samsun)
by the CTAB method (Doyle and Doyle, 1990).
Primers used for amplification of Bcp1 were BCp1sf (5’-CTTTCTCGA
GTTTCTGAGGTGTTGTATTTT-3’) and Bcp1sr (5’-
ACTACCATGGTATTGCTAAGGAAAGTTTAA-3’) for the sense
orientation and Bcp1af (5’- CTTTGGATCCTATTGCTAAGGAAA
GTTTAA-3’) and Bcp1ar (5’-ACTATCTAGATT TCTGAGGTGT
TGTATTTT-3’) for the anti-sense orientation.
Restriction endonuclease recognition sequences were included in the
primers to allow cloning of the amplified fragments into appropriately
digested vector.
 Purified amplification products were ligated into pTZ57R/ T
(Fermentas) and the complete sequence of the ‘‘sense’’ clone was
determined. Subsequently, the separate sense and anti-sense fragments
were transferred into the RNAi vector pFGC5941,

16. Agrobacterium -mediated plant transformation:
The gene construct Bcp1/pFGC was transformed in Agrobacterium tumefaciens
strain LBA4404 by electroporation.
The transformants were confirmed through PCR using forward and reverse
primers.
The constructs was transformed in Arabidopsis using leaf disc method.
Three batches of explants were selected on herbicide glufosinate ammonium.
The putative transgenic plants were confirmed through PCR using bar gene
specific primers and Southern hybridization, which gives amplification along with
positive and negative controls.
It was deduced that transcribed mRNA of RNAi construct will result into a
dsRNA with a hairpin loop and the resultant dsRNA triggered on the
RNAi machinery. It was found that the dsRNA interfere the Bcp1 gene
function in the transgenic Arabidopsis plants and consequently male sterile
plants were obtained.

19.  Inducible Sterility:
•Male sterility is induced only when inducible chemical is applied.
N-acetyl-L-
phosphinothricin
selfing
Plants of male sterile line were transformed by a gene, argE, which codes
for N-acetyl-L-ornithine deacetylase, fused to TA29 promoter.
Induction of male sterility can occur only when non-toxic compound N-
acetyl-L-phosphinothricin is applied.
Plant Transformed
by TA29-argE
fertile
Plant Transformed
by TA29-argE
fertile
Sterile plant Fertile plant
Fertile plant

20. Inducible Fertility:
If sterility was induced by inhibition of metabolite (amino acids, biotin,
flavonols, jasmonic acid) supply, fertility can be restored by application of
restricted metabolite and male sterile plant can be propagate by selfing.
Sterile Plant Restorer
Sterile Plant
Fertile Plant Fertile F1 Plant
Addition of
restricted metabolite
selfing

21. Two-Component System:
Male sterility is generated by the combined action of two genes brought
together into the same plant by crossing two different grandparental
lines each expressing one of the genes.
Two proteins which are parts
of barnase.
Two proteins can form
stable barnase.
Each grandparent has each part of Barnase

22. Two-Component System
X
fertilefertile
sterile
X
fertilefertile
X
sterile
selfing selfing
Bn3 : 3’ portion of barnase gene
Bn5 : 5’ portion of barnase gene
A1 (Bn5/Bn5)
A (Bn5/Bn3)
A1 (Bn5/Bn5) A2 (Bn3/Bn3)
A2 (Bn3/Bn3)
B (- -)A (Bn5/Bn3)
F1 (Bn3/-)
F1 (Bn5/-)
fertile
fertile
fertile

23. Cytoplasmic Male Sterility via Chloroplast Genome:
CMS is induced by the expression of phaA gene in
chloroplast in which the role of β-Ketothiolase governs the
sterility.
Male sterility is observed due to hyper-expression of
β-ketothiolase in leaves and anthers, with proportionately
high levels of enzyme activity.
Reversibility of the male-sterile phenotype was observed
under continuous illumination, resulting in viable pollen and
copious amount of seeds.
Non-transgenic plants are used as the maintainer for the
propagation of male sterile plants.

24. Reversibility in Male Fertility:
•Acetyl-CoA is the major component involved in the biosynthesis of
fatty acid which results into male fertility provided with continuous
illumination of light for 8 to 10 days.
•With the conversion of Acetyl-CoA into Acetoacetyl-CoA leads to the
male-sterile phenotype.
•But, due to continuous illumination of light the process is reverted and
it gets converted into Acetyl-CoA carboxylase which in the presence of
constant light gets converted into malonyl-CoA because acetyl-CoA is
not imported into plastids from the cytoplasm, it should be synthesized
in this organelle.
•Based on the lack of increase in β-ketothiolase activity but increased
Acetyl-CoA carboxylase activity during continuous illumination , de novo
fatty acid biosynthesis enhanced in transgenic lines and this reversed
male sterility.

26. Acetyl-CoA
β-ketothiolase
Acetoacetyl-CoA
Acetyl-CoA carboxylase
malonyl-CoA
De novo
Fatty acid
synthesis
Male Fertility
Male Sterility
Continuous
illumination for
upto 8 to 10 days

28. References:
a. Plant Breeding principles and methods, B.D.Singh; page no-86.
b. Research Papers;
1. Transgenic Male Sterlity For Hybrid Seed Production In Vegetables -A
Review; M.Ananthi, P.Selvaraju And P.Srimathi
2. Cytoplasmic Male Sterility in Plants- A molecular perspective ; K.K.Vinod
3. Development of male sterility by silencing Bcp1 gene of Arabidopsis
through RNA interference; Muhammad Tehseen,Muhammad Imran,
Mazhar Hussain, Shazia Irum, Shahid Ali, Shahid Mansoor and Yusuf Zafar.
c. Wikipedia.

29. Thank you…